ID: 1092085793

View in Genome Browser
Species Human (GRCh38)
Location 12:5758416-5758438
Sequence GTGGGGCTGTGGAGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 652}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092085793 Original CRISPR GTGGGGCTGTGGAGGGAAAT AGG (reversed) Intronic
900418965 1:2547337-2547359 GTGGGGCTGTGGAGGCACTGCGG + Intergenic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901764732 1:11492545-11492567 GTGGGGGTGGGGAGAGGAATCGG - Intronic
902126934 1:14222285-14222307 GGGGAACTGTGGGGGGAAATGGG + Intergenic
902175852 1:14650149-14650171 GTGGGTATGTGGAAGGAAGTAGG + Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902388755 1:16090774-16090796 CTGGCAATGTGGAGGGAAATGGG + Intergenic
902729153 1:18357295-18357317 GTGGGGATGAGGGTGGAAATGGG + Intronic
902799686 1:18821463-18821485 GAAGGGCTGTGGACGGAGATAGG + Intergenic
902909615 1:19585818-19585840 GTGGGGCTAGGGAGGGAATGGGG + Intergenic
903321614 1:22546778-22546800 GTGGGGCTGTGGGAGGGAACGGG + Intergenic
904044751 1:27602796-27602818 GTGGGGCGGAGGAGGGATTTGGG - Intronic
905250160 1:36643297-36643319 CTGGGGCTGGGGATGGAACTGGG - Intergenic
905434551 1:37947593-37947615 GTGGGGCTAAGGGAGGAAATAGG - Intergenic
905458547 1:38105498-38105520 ATGGAGCTGTGGAGGGAATGTGG + Intergenic
905737171 1:40337561-40337583 GTGGGGTTGGGGAGGGAAACCGG - Intergenic
905787126 1:40767221-40767243 TTGGGGGTGTTGAGGGACATGGG + Intronic
907495475 1:54841382-54841404 TTGGAGCAGTGGAGGGAAAGTGG + Intronic
908789692 1:67769425-67769447 GTGGGTCTTTGGAGGGAGGTAGG + Intronic
909603927 1:77489820-77489842 ATGGGAGTGTGGCGGGAAATGGG - Intronic
910158102 1:84243261-84243283 GTGGGGGTGGGGAGGGAACCAGG + Intergenic
910458909 1:87427125-87427147 GCAGGGCTGAGGAGGGGAATGGG - Intergenic
910873126 1:91853052-91853074 GGGGGTCTGTGGGGGGAAAATGG + Intronic
911885243 1:103289466-103289488 GTGGGGTTGTGGTGGGAATCTGG - Intergenic
912634068 1:111274878-111274900 GTTGGGGAGTGGAGGAAAATTGG + Intergenic
912924907 1:113905264-113905286 GTGGAGCTGCGGCGGGCAATCGG + Exonic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913087294 1:115450818-115450840 GTGGAGCTGGGGAGGGTAAAGGG - Intergenic
913318573 1:117573486-117573508 GTGGGTCTGTGGAGGGGATGAGG + Intergenic
913360491 1:117975216-117975238 GGGGGGATGTGGAGAGAAACAGG + Intronic
914316191 1:146514024-146514046 GCAGGGCTGAGGAGGGGAATGGG - Intergenic
914324126 1:146594693-146594715 GTGGGGTTGGGGGCGGAAATGGG + Intergenic
914498164 1:148219337-148219359 GCAGGGCTGAGGAGGGGAATGGG + Intergenic
914755163 1:150558169-150558191 GAGGTGCTGGGGAGGGGAATGGG + Intronic
914880037 1:151540109-151540131 GTGGGGCTTGGGAGCGACATGGG - Intergenic
915254816 1:154619203-154619225 CTGGGGCTGGGGAGGGAACCTGG - Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915361825 1:155290478-155290500 GTGGGGCTTTGGAGGGGTGTGGG + Exonic
915365262 1:155311589-155311611 GTGGGGATGGGGAAGGAAACTGG + Intronic
916752641 1:167737405-167737427 ATGAGGCTGGGGAGGGAACTGGG + Intronic
918663076 1:187113777-187113799 TTGGGGACGTGGGGGGAAATGGG - Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919261635 1:195202824-195202846 GTGGGGCTGTTGGCGGAAGTGGG - Intergenic
920440252 1:205975963-205975985 GTGGGGCTGTGCAGGGCATGGGG + Intergenic
920577196 1:207070263-207070285 GTATGACTGTGGAGGGAAATGGG - Exonic
920984231 1:210870295-210870317 GTGGGGGTGAGGATGGAAAGAGG - Intronic
921101044 1:211929912-211929934 GTGGGGCAGTTCAGGGAATTTGG + Intergenic
921292489 1:213671370-213671392 GTGGGGAGGTGGAGGGGAACGGG + Intergenic
922007559 1:221547428-221547450 CTAGGGCTGTGGCAGGAAATAGG + Intergenic
922124895 1:222712465-222712487 GTTTGGCTGTGGCGGCAAATGGG - Exonic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923209311 1:231788794-231788816 AGGGGGCAGTGGTGGGAAATGGG + Intronic
923550636 1:234960192-234960214 GTGGGGCTGTGTGAGGAATTAGG - Intergenic
923739717 1:236644240-236644262 GTGGGGCGGAGGAGGGAAAGGGG + Intergenic
924120808 1:240796024-240796046 GTGGGGCTGAGGCGGGAACGTGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924761622 1:246992795-246992817 GTAGGGCTGTGGTGGGTAAATGG - Intronic
1062830761 10:603986-604008 GTGGGGCTGATGAGGGAGCTGGG - Intronic
1062960210 10:1567643-1567665 GTAGGGCTGTGGAGGCACCTGGG - Intronic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063623314 10:7667512-7667534 CTGGGGAGGTGGGGGGAAATGGG - Intergenic
1064751966 10:18539331-18539353 GTGGGGCTGAGGAGGAAGAGCGG - Exonic
1065287321 10:24198626-24198648 CTCGGGCTGTGGTAGGAAATGGG + Intronic
1066093510 10:32050181-32050203 GTGGGGATGTGGAGGGTAGTAGG - Intronic
1067101855 10:43339723-43339745 GTGGGGCAGGGGAGGACAATGGG + Intergenic
1067466557 10:46503424-46503446 GTGGGTCTGTGAAGGGACTTGGG - Intergenic
1067620631 10:47881181-47881203 GTGGGTCTGTGAAGGGACTTGGG + Intergenic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1069036976 10:63655940-63655962 GTGGGGCCTTGGGAGGAAATTGG + Intergenic
1069087910 10:64163024-64163046 GTGAGGCAGTGGAAAGAAATTGG + Intergenic
1069571153 10:69495161-69495183 GAGGGGCTCTGGAGGGCAAAGGG + Intronic
1069896698 10:71684485-71684507 GTGTGGCTGTGGAGGCACATGGG + Intronic
1070607005 10:77905800-77905822 GTGGGTGAGGGGAGGGAAATGGG - Intronic
1070607389 10:77908422-77908444 CTGGGGCTGGAGAGGGGAATGGG - Intronic
1071277137 10:84065605-84065627 GAGGGCCTGTGGAGGGAGCTTGG - Intergenic
1071458634 10:85870632-85870654 GTGGTGCTGTGGAAGGAAGGTGG + Intronic
1072049432 10:91688696-91688718 ATGAGGCTGTGGAGAGAAAGGGG + Intergenic
1072453596 10:95558359-95558381 GTGGAGCTGGGGTGGGAACTCGG - Intronic
1072635618 10:97175951-97175973 CTGGGGCTGTAAAGGCAAATTGG - Intronic
1072754922 10:98013026-98013048 GTGGGGATGGGGGAGGAAATGGG + Intronic
1073156942 10:101354498-101354520 GCGGGGCCCTGGAGGGAAAGGGG + Intronic
1073633894 10:105177584-105177606 GTGGCACTGGGGAGGGAAAATGG + Intronic
1073892030 10:108113092-108113114 GTGATGCTGTGGATGGAAACAGG - Intergenic
1074285711 10:112096240-112096262 GTGGGGCTGTGAATTGAATTTGG - Intergenic
1074305954 10:112278709-112278731 GTGGGGGTGAGGAGGGAGAGGGG + Intergenic
1074882735 10:117671350-117671372 CTGGGGCTGTGGAGTGAACTGGG - Intergenic
1074988548 10:118680335-118680357 GTGGGGCAGGGGAGTGAAAATGG + Exonic
1075167853 10:120085335-120085357 GTGGAGGGGAGGAGGGAAATGGG + Intergenic
1077077306 11:707468-707490 GTCGGGCTGTGGAGGGGAGGAGG - Intronic
1077223386 11:1427124-1427146 GTGGGGCTGTGGGGAGAGAGGGG - Intronic
1077348106 11:2073682-2073704 TTGGGGATGTGGAGAGAAAGTGG - Intergenic
1077934353 11:6768152-6768174 TTGGGGCTGTGGAAGGAACTGGG + Exonic
1077935970 11:6785821-6785843 CTGGTGCTGTGGAAGGAACTGGG - Exonic
1078143017 11:8705254-8705276 GCATGGCTGTGGAGAGAAATAGG - Intronic
1079367797 11:19824428-19824450 GTGGGGCACTGCAGGGACATTGG + Intronic
1079702286 11:23563708-23563730 GTGTGGTTTGGGAGGGAAATTGG - Intergenic
1080685080 11:34508733-34508755 GTGGAGGCGAGGAGGGAAATTGG - Intronic
1080842008 11:35992691-35992713 GTGGGGGTTTGGGAGGAAATAGG + Intronic
1080899557 11:36475666-36475688 TTGGGGCTGTGGATGGCAATGGG + Intergenic
1081282483 11:41226803-41226825 GTTTGATTGTGGAGGGAAATAGG - Intronic
1081397485 11:42603845-42603867 ATAGGGCTGGGGATGGAAATGGG + Intergenic
1081435607 11:43024293-43024315 GTGGGGATGTAGGGGGAGATTGG - Intergenic
1081650107 11:44818244-44818266 GCAGGGCCGTGGAGGGAAATGGG - Intronic
1081664585 11:44909454-44909476 GTGGGGCTTGGGTCGGAAATTGG + Intronic
1081816375 11:45945850-45945872 GTGGGGCTGGGCAGGGACACAGG + Exonic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082763515 11:57148622-57148644 GTGGGCCTGTGGAGGAGAAGAGG + Intergenic
1083206223 11:61150846-61150868 GTGAGGCTCTGGAGGGCAACTGG - Intronic
1083625217 11:64068886-64068908 GTGGGGACTTGGCGGGAAATGGG + Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083954502 11:65976111-65976133 GAGGGGCTTTGGAGGGGGATTGG + Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084699784 11:70778960-70778982 GAGGGGCTGTGGAGAAAAAAAGG + Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085839695 11:79997171-79997193 GTGGGGGGGTGGAGAGAAAGTGG + Intergenic
1086495845 11:87403844-87403866 GTGGGCCTCTGGAGGGTATTAGG + Intergenic
1086755709 11:90558837-90558859 GGTGGGGTGTGGAGGGAAAGGGG + Intergenic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089060688 11:115623583-115623605 GTGGGGCTGTGTATGGAAATGGG - Intergenic
1089619272 11:119713234-119713256 GGAGGGCTGTGGAGGGACAGAGG + Intronic
1090051429 11:123383038-123383060 GTGGGGCTGTGTAGCAAGATGGG + Intergenic
1090299930 11:125626306-125626328 GTGGGGCTGTGGATGGGGATGGG + Intronic
1090403479 11:126463503-126463525 GCTGGGCTGTGGAAGGAAAAAGG + Intronic
1090867394 11:130713717-130713739 GTAGGGCTGAGGAGGGAGAGAGG - Intronic
1090921179 11:131207148-131207170 GGGGTGCTGTGGAGGGCAAATGG - Intergenic
1091041215 11:132283802-132283824 GGGGGGCTTTAGAGGGAAAGTGG + Intronic
1091444161 12:534097-534119 GTGAAGCTGTTGAGGGAAAGGGG + Intronic
1091706307 12:2695644-2695666 CTGGGGCTGGGGAGGGCAGTGGG - Intronic
1091711535 12:2743873-2743895 CTGGGGCTGGGGAGGGCAGTGGG - Intergenic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092247496 12:6871791-6871813 GTGTGGCTGAGGAAGGAAGTAGG + Intronic
1092574656 12:9767233-9767255 CAGGGCTTGTGGAGGGAAATGGG - Intergenic
1092970362 12:13688140-13688162 GTGGGGCATTGGAAGGAAAATGG - Intronic
1093165977 12:15804733-15804755 GTGGGGTTGTTGAGGGGAAGGGG - Intronic
1094639734 12:32262343-32262365 ATGGGGCTGGAGAAGGAAATGGG - Intronic
1095870841 12:47026374-47026396 GTCGAGATGTGCAGGGAAATGGG - Intergenic
1096106803 12:49000766-49000788 GTTGGGTTTTAGAGGGAAATGGG + Intergenic
1096110036 12:49023118-49023140 GGTGGGGTGTGGAGGGAGATGGG + Intronic
1098174296 12:67774649-67774671 GGGGGGTTGGGGAGGGAAAGGGG + Intergenic
1099016582 12:77350446-77350468 GGGGTGGTGAGGAGGGAAATAGG + Intergenic
1101308321 12:103553674-103553696 GTGGGGCTGGGGTGGGGACTGGG - Intergenic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102230039 12:111256174-111256196 GGGGGGCTGTGGTGGGAGATAGG - Intronic
1102231400 12:111264914-111264936 CCGGGGCTGGGGAGGGAGATTGG + Intronic
1102381851 12:112473740-112473762 GGGAGGCTGAGGCGGGAAATTGG + Intronic
1102550108 12:113685426-113685448 GGGGGGCTGGGGAGGGAAGGGGG + Intergenic
1102927244 12:116835695-116835717 GTGGGCTTGGGAAGGGAAATAGG + Intronic
1103202251 12:119097252-119097274 GTGGGGCTGTGGAGGGCTGAGGG + Intronic
1103556257 12:121768547-121768569 TTGGGACTGGGCAGGGAAATGGG - Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103875007 12:124120201-124120223 GTGGGTCCCTGGAGGGAAACTGG + Intronic
1103999896 12:124853862-124853884 GTGGTCCTGTGCAGGGCAATGGG - Intronic
1104123247 12:125819323-125819345 GGGGGGAAGTGGAAGGAAATTGG + Intergenic
1104996869 12:132663587-132663609 GAGGGGCTATGGTGGGAAATGGG + Intronic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106176775 13:27338521-27338543 GTGGGGATGTGGAGGGCATGAGG - Intergenic
1106497474 13:30293717-30293739 GTGGGCCTGTGTAGGGAGAAGGG - Intronic
1107284821 13:38779223-38779245 GTCGGGGGGTGGAGGGAAAGGGG + Intronic
1107415639 13:40197593-40197615 GAGGTGGTGTGGAGGGGAATGGG + Intergenic
1107650844 13:42543123-42543145 GTGGAGCTGTTGGCGGAAATAGG - Intergenic
1109592787 13:64508897-64508919 GTCGGGGTGTGGGGGGAAAAAGG - Intergenic
1109790103 13:67235394-67235416 GGGGGACTGTGGGGGGAATTTGG - Intergenic
1111198970 13:84909288-84909310 GTGAGGCTGTGGAGAGAAATAGG + Intergenic
1111458071 13:88509104-88509126 CTGAGGCTGTGCAGGGCAATGGG + Intergenic
1112497268 13:99915147-99915169 GTGGGGCTGGGGAGGGGACCTGG - Intergenic
1113535932 13:111066291-111066313 CAGGGGCTGGGGAGGGCAATGGG + Intergenic
1113554285 13:111219170-111219192 CAGGGGCTGGGGAGGGGAATGGG - Intronic
1113608050 13:111624264-111624286 GAGGGGCTTTGCAGGGAAATAGG - Intronic
1113631910 13:111893851-111893873 GCGGTGCTGTGGAGGGAGAAGGG + Intergenic
1113798119 13:113070618-113070640 CGGGGGCTGAGGAGGGACATGGG - Intronic
1114607813 14:24012239-24012261 GTGGGGCTGTATAGGGAGACTGG + Intergenic
1114993825 14:28321277-28321299 GTGGAGTTGGGGAAGGAAATGGG + Intergenic
1114993967 14:28323547-28323569 TGGGGGATGGGGAGGGAAATGGG + Intergenic
1115088781 14:29549128-29549150 GTGGGGCTGGGGAGGGAGGGGGG + Intergenic
1115200145 14:30844281-30844303 GTGGGGCTGTAGGGAGAAAGTGG - Intergenic
1116870546 14:50065712-50065734 GTGTGACTGTGTGGGGAAATGGG - Intergenic
1118048000 14:61993259-61993281 GTGGGGGTGTGGGGGGCAAGGGG + Intergenic
1118894694 14:69936030-69936052 GGAGGGATGTGGAGGGACATTGG - Intronic
1118897690 14:69959940-69959962 GTGGGGCTGGGGAGCTAAAAAGG - Intronic
1120522983 14:85546439-85546461 GTGGGGCTGTTTAGGGAAGTAGG + Intronic
1120646272 14:87078295-87078317 TGGGGGCTGTGGTGGGAAAAAGG - Intergenic
1120924130 14:89781213-89781235 TTGGGACTGTGGAGGGAAACTGG - Intergenic
1121580834 14:95028379-95028401 ATTGGGCTGGAGAGGGAAATAGG - Intergenic
1122387172 14:101357044-101357066 GGGGGGCTGTAGAGAGTAATGGG + Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1124956483 15:34363726-34363748 GTGGGGGTGGGGGTGGAAATGGG - Intronic
1125251771 15:37713270-37713292 GTGAGGCTGTGCAGGGCAGTGGG - Intergenic
1125814361 15:42571828-42571850 GTGGGGCTGTGGCCGGACAGTGG - Intergenic
1126388995 15:48125885-48125907 GTGGGGCTGGGGTGGGACAGGGG - Intronic
1127855741 15:62952279-62952301 GTGGGGGGGTGGGGGGAAATTGG + Intergenic
1128410701 15:67394060-67394082 ATGGGGCTTTGGAGTGAAACAGG - Intronic
1128743749 15:70099636-70099658 GTGGGGCTGGAGCGAGAAATGGG - Intergenic
1129150580 15:73685122-73685144 TTGGGGGTGGGGAGGGAATTGGG + Intronic
1129689974 15:77707660-77707682 GTGGGACTCTGGAGGCCAATAGG - Intronic
1129794935 15:78368989-78369011 GTGGGCCTGGGGTGGGGAATGGG - Intergenic
1129799788 15:78405521-78405543 GCGGGGCTGTGGTGGCAAAACGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130119848 15:81038426-81038448 GTGGTGTTGTGGAGGCCAATAGG + Intronic
1130736371 15:86554454-86554476 GTGGTGGTGTGGAGAGAGATGGG + Exonic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1131023409 15:89119191-89119213 GAGAGGCTTTGGAAGGAAATTGG - Intronic
1131111494 15:89767588-89767610 GTGGGAATGTGGAAGGGAATTGG - Intronic
1131260305 15:90884404-90884426 GCGGGCCTGTGGAGGGGAAGGGG - Exonic
1132191122 15:99861788-99861810 GTGGCGGTGTGGAGGGAGGTGGG - Intergenic
1132292039 15:100710545-100710567 GTGGGGATGGGGGTGGAAATGGG + Intergenic
1132671129 16:1102725-1102747 GGGGGTCTGTGGAGGGAGGTGGG - Intergenic
1132671161 16:1102804-1102826 GGGGGTCTGTGGAGGGAGGTGGG - Intergenic
1132702389 16:1227375-1227397 GTGGGGCTGGAGAGGGCACTGGG + Intronic
1134122781 16:11596656-11596678 GGGAGGATGTGGAGGGAAAAAGG + Intronic
1135177772 16:20246213-20246235 TTGGGGCTGTGGCTGGAATTGGG - Intergenic
1135180272 16:20267355-20267377 CTGGGACTGTGCTGGGAAATAGG + Intergenic
1135323796 16:21513333-21513355 GGGGGGCTGTGGGTGGAAGTAGG - Intergenic
1135389438 16:22077692-22077714 GTGGGGCTGTCACGGGATATGGG - Intronic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136335279 16:29606598-29606620 GGGGGGCTGTGGGTGGAAGTAGG - Intergenic
1136346424 16:29679103-29679125 GTGGGACTGTGGAGGGAGGGAGG - Exonic
1136591605 16:31221160-31221182 GTGTGGCCGTTGAGGGAAAGAGG + Intronic
1137609431 16:49809050-49809072 GTGGGGCCGTGCAGGGCTATGGG - Intronic
1137627388 16:49918062-49918084 GAGGGGCTGTGGAGCGACAAGGG + Intergenic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1137737556 16:50736200-50736222 CTGGGCCTGTGTAGGGAACTAGG + Intergenic
1137760452 16:50935990-50936012 GGGGGGTGGTGGAGTGAAATTGG + Intergenic
1137933560 16:52611531-52611553 GTGAGGCTGAGAAGGGGAATAGG - Intergenic
1138419804 16:56891954-56891976 GTGGGGCTGTGGAGGCCAGGTGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140442278 16:74997618-74997640 GTGGGGGGGTGGGGGGAGATGGG - Intronic
1140453037 16:75086958-75086980 GGAGGGCTGGGGAGGGAAACTGG + Intronic
1141248026 16:82329048-82329070 GTGAGGCTGAGGCTGGAAATGGG - Intergenic
1141257611 16:82417285-82417307 GTGGGGCTGTGGAACAAGATAGG + Intergenic
1141369463 16:83473738-83473760 GTGGAGCTGAGTAGGGAAGTTGG + Intronic
1141834744 16:86531400-86531422 GCGGGGCTGGGGAGGGGAAGAGG + Exonic
1142399048 16:89849699-89849721 GTGGTTCTGTGGAGTGATATGGG - Intronic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142657136 17:1401578-1401600 GTGGGCCTAGGGAGGGAAAAAGG - Intergenic
1142903983 17:3030870-3030892 GTGGAGCTGTGGAGGCCACTGGG - Intronic
1143513452 17:7408034-7408056 GTGGGGAAGGGGAAGGAAATGGG - Intronic
1143526829 17:7478017-7478039 GTGGGGCTGCGGAGGGGATTTGG - Intronic
1143688774 17:8542311-8542333 ATGGGGAGGTGGAGGGAAAATGG + Intronic
1144523043 17:15967067-15967089 GTGGGGCCGAGGAGGGAGACTGG + Intronic
1145374586 17:22335631-22335653 GTGGGGAAATGGAGGGATATGGG + Intergenic
1145886816 17:28387816-28387838 GTCTGGCTTTGGTGGGAAATAGG + Intronic
1146955343 17:36933841-36933863 GTGGGTCTGTGGAGGACATTGGG + Intergenic
1147309871 17:39589159-39589181 TTGGGGGTGTGGAGGAAAATGGG - Intergenic
1147330555 17:39696546-39696568 CTGGGGCTCTTGAGGGTAATGGG + Intronic
1147993737 17:44350360-44350382 GGGGGTATGTGGAGGGAAGTGGG + Intronic
1148102905 17:45103550-45103572 GTGGGGAGGAGGAGGGACATTGG - Intronic
1148205139 17:45775252-45775274 GGGTGGATGTGGAGGGGAATGGG + Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1151077177 17:71287357-71287379 GTGGAGATCTGGAGGGAAAGGGG + Intergenic
1151535851 17:74738376-74738398 GTGGGCTTGTGGCAGGAAATGGG + Intronic
1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG + Intergenic
1151618767 17:75232095-75232117 GTGGGGCTGTGGACGCCAAGAGG + Intronic
1151747269 17:76018300-76018322 CTGGGGCTGGGGAGGGAGAGAGG - Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152726965 17:81952290-81952312 GTGGGGCTGGGGAGGGGAGGTGG + Intergenic
1152736932 17:82001610-82001632 CTGGGGCTGTGGGGAGAACTGGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153516000 18:5901832-5901854 GTGGGGCCCTGGAGGGACAGTGG - Intergenic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1155259768 18:24030617-24030639 TTGGGGCTGTTGAGAGAATTAGG - Intronic
1155551670 18:26972028-26972050 GCAGGGGTGTGGAGGGGAATGGG + Intronic
1156211392 18:34947393-34947415 GTGGGGCTTTGGGGGAAAAAAGG - Intergenic
1156469442 18:37368276-37368298 ATGGGGCTGAAGAGGGAGATGGG - Intronic
1156511234 18:37638390-37638412 TTGAGGGTGAGGAGGGAAATGGG + Intergenic
1156853734 18:41757557-41757579 ATGGGGGTGTTGAAGGAAATAGG - Intergenic
1157443745 18:47729565-47729587 GTGGGGCTCAGGGTGGAAATGGG + Intergenic
1157762501 18:50275040-50275062 GGGGTGCTGTAGAGGCAAATGGG + Exonic
1157885526 18:51362700-51362722 GGGGGGCTGGGGAAGGAAGTGGG - Intergenic
1158270172 18:55704362-55704384 GTGGGGATGGGGAGGAAAAATGG + Intergenic
1158550187 18:58429425-58429447 GTGGGGGTGGGGAGGGCGATGGG - Intergenic
1158888302 18:61849473-61849495 GTGTGGCTGTTGGGGGAAAGAGG - Intronic
1159347195 18:67221465-67221487 GTGGGGCGGTGAAGGGAAGGAGG - Intergenic
1160124277 18:76155967-76155989 GTAGAGCTGTGGAGCGAAATAGG - Intergenic
1160170978 18:76554094-76554116 GAGAGGTTGGGGAGGGAAATGGG + Intergenic
1160503971 18:79417124-79417146 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160503976 18:79417141-79417163 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160503981 18:79417158-79417180 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160503986 18:79417175-79417197 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160503993 18:79417199-79417221 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504000 18:79417223-79417245 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504005 18:79417240-79417262 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504012 18:79417264-79417286 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504017 18:79417281-79417303 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504024 18:79417305-79417327 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504042 18:79417369-79417391 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504049 18:79417393-79417415 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504054 18:79417410-79417432 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504061 18:79417434-79417456 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504068 18:79417458-79417480 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504086 18:79417522-79417544 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504093 18:79417546-79417568 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504098 18:79417563-79417585 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504105 18:79417587-79417609 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504110 18:79417604-79417626 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504117 18:79417628-79417650 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504135 18:79417692-79417714 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504142 18:79417716-79417738 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504149 18:79417740-79417762 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504154 18:79417757-79417779 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504161 18:79417781-79417803 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504166 18:79417798-79417820 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504173 18:79417822-79417844 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504191 18:79417886-79417908 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504198 18:79417910-79417932 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504209 18:79417951-79417973 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160522270 18:79514592-79514614 GTGGGGGTGGGGAGTGAGATTGG - Intronic
1160975533 19:1790549-1790571 GAGGGGCAGTGGAGGGAGAAGGG - Intronic
1161239990 19:3217261-3217283 CAGGGGCTGGGGAGGGAGATGGG + Intergenic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1161787893 19:6339451-6339473 GAGGGGCTGGGGAGGGGGATAGG + Intergenic
1161931458 19:7343328-7343350 CAGGGGCTGGGGAGGGAGATGGG + Intergenic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162819399 19:13213374-13213396 GAGGGGATGCGGTGGGAAATGGG - Intronic
1162925373 19:13928224-13928246 GTGGGGCTGAGAGGGGAATTGGG - Intronic
1162927225 19:13936685-13936707 GTGGGGGTGTTGGGGGAATTGGG - Intronic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1163493171 19:17629196-17629218 ATGGGGCTGAGGAGGGAGATAGG + Intronic
1163737547 19:18990611-18990633 GGGAGGCTGGGGAGGGTAATCGG - Intergenic
1163763455 19:19149479-19149501 GTGGGGTGGTGTAGGGGAATTGG + Intronic
1164615382 19:29664393-29664415 GGGTGACTGTGGAGGGAGATGGG + Intergenic
1165084007 19:33330035-33330057 GTGGGGCTGGAGAAGGACATAGG - Intergenic
1165706898 19:37982769-37982791 ATGTGGCTGTGGAGGGAGAGAGG + Intronic
1165861452 19:38911525-38911547 ATGGGGTTGTGGAGGGCAAGTGG + Intronic
1165868342 19:38952863-38952885 GTGGGGCACTGGAGGGAATGAGG - Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166334457 19:42096692-42096714 GTGGGGCTGTTGAGAGAATCGGG + Intronic
1166870598 19:45868032-45868054 GCGGGGGTGGGGAGGGAGATGGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167151328 19:47711960-47711982 GGAGGGCTGTGGAGAAAAATAGG + Intergenic
1167266452 19:48485352-48485374 GCCGGGCTGGGGAGGGAAAGGGG + Exonic
1167483152 19:49745400-49745422 GAGGGGCAGAGGAGGGGAATGGG + Intronic
1167708166 19:51094095-51094117 GTGGGGCTTAGGAGGGACACAGG - Intergenic
1168707655 19:58479121-58479143 ATGGGGCTGTGGAGGGAGCCTGG - Intronic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925022409 2:582056-582078 CTGGGGCTGTGACGAGAAATTGG + Intergenic
925689537 2:6506876-6506898 GTGGGGCAATGGAGAGAAAGCGG + Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
926426901 2:12746472-12746494 GTGGGGCCTTGGGGGGTAATTGG - Intergenic
926427019 2:12747357-12747379 GTGGGGCCTTGGGGGGTAATTGG - Intergenic
926564753 2:14456725-14456747 GTTGTGCTGTGGAGGAAAAGTGG + Intergenic
927274640 2:21252247-21252269 GTGAGGCCGTGGAGCAAAATAGG + Intergenic
927304934 2:21560103-21560125 GTTGGGATGTGGAGGGCAAGAGG + Intergenic
927356747 2:22182187-22182209 GTGGGGCAGTGTTGAGAAATGGG - Intergenic
927844281 2:26463415-26463437 GTTGGGCCGTGGTGGGAAGTGGG + Intronic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
928086769 2:28350861-28350883 GGAGGGCTGGGGAGGGAGATGGG + Intergenic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
929304533 2:40345840-40345862 GTCGGGCGGTGGAGGGCAAGGGG + Intronic
929444553 2:41992073-41992095 GTTGGGCAGGGGAGGGAAAGTGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931376633 2:61713856-61713878 GTGGGGATGGGGAGGGACAGGGG - Intergenic
931622955 2:64229641-64229663 GTGAGCCTGCGGAGGGAGATGGG + Intergenic
931869127 2:66440626-66440648 CGGGGGCGGGGGAGGGAAATAGG - Intronic
931939116 2:67232567-67232589 GTGGGCTTGTGGTGGGGAATAGG - Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
933723509 2:85413079-85413101 CTGGGGCTGGGGATGGAAATAGG - Intronic
933776780 2:85775922-85775944 GTGGGGCTGTGGTGAGGACTGGG - Intronic
935695289 2:105766148-105766170 GTGGGGCTGAGTGGGGAAGTGGG + Intronic
935709781 2:105888036-105888058 GTGGGGATGTGGAGCTAAATAGG + Intronic
936573105 2:113632784-113632806 GTGTGGCTGTGGAGTGAAAGGGG + Intronic
936957761 2:118040518-118040540 GGGGGGCTGTGGTGTGAAACAGG - Intergenic
936972984 2:118192456-118192478 GTGGGGCTATGGATGGATAAAGG + Intergenic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937471018 2:122173969-122173991 GCTGGGCTGTGGTGGGAGATGGG + Intergenic
937978015 2:127593365-127593387 GTTGGGGTGAGGAGGGAACTCGG - Intronic
938014698 2:127857884-127857906 GTGGGGCTGGGGAGGGAACATGG - Intronic
938256896 2:129866203-129866225 GTGGGGCAGTGGAAGGAATGTGG - Intergenic
938894741 2:135738837-135738859 GTGGGGTGGTGGAAGAAAATGGG - Intergenic
942480433 2:176381924-176381946 GTGGGGCAGGGGATGGAGATGGG + Intergenic
942803626 2:179903617-179903639 GTGAGGCTGTGAAGGGCAGTGGG + Intergenic
942957287 2:181788086-181788108 GTGAGGCTGTGACAGGAAATTGG - Intergenic
943544076 2:189252899-189252921 ATGGGACTGTGAAGGAAAATTGG + Intergenic
943623742 2:190177713-190177735 ATGGGGCTGGGGATGGAAATGGG + Intronic
944317167 2:198295705-198295727 GGGTGGCTGGGAAGGGAAATGGG - Intronic
945958715 2:216109774-216109796 GTGGGGCTAGGGAGTGGAATGGG - Intronic
945992211 2:216405656-216405678 ATGGGGCTGGGGAGAGAAATAGG - Intergenic
946047598 2:216834056-216834078 GTGGAGATGTGGAGGGAGAGGGG + Intergenic
946215715 2:218181946-218181968 TTGGGACTCTGGTGGGAAATGGG + Intergenic
946299230 2:218812437-218812459 GAGGGGCTGGGGAAGGGAATGGG + Intronic
946974603 2:225134230-225134252 GTGGGGCTGTGGTAGAATATTGG + Intergenic
947591888 2:231390565-231390587 GAGAGGCTGTGGAGGGAGAGGGG + Intergenic
947732464 2:232439026-232439048 GTGGGGCTGTGGTGTGACAGTGG - Intergenic
947744336 2:232499888-232499910 GGGGTGCTGAGGTGGGAAATGGG + Intergenic
947744363 2:232499963-232499985 GGGGTGCTGGGGTGGGAAATGGG + Intergenic
948513750 2:238489951-238489973 CTGAGGCTGCAGAGGGAAATAGG - Intergenic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948603488 2:239120608-239120630 GGGGGGCGGGGAAGGGAAATAGG + Intronic
948818338 2:240525400-240525422 GGGGTGCTGTGGAGGGAGAGTGG - Intronic
948912821 2:241013235-241013257 CAGGGGCTGAGGTGGGAAATGGG - Intronic
948913355 2:241017598-241017620 GTGGGGCTGAGGAGGTAGCTTGG - Intronic
949034532 2:241810466-241810488 GGGGCGCTGTGGTGGGAAACAGG - Intronic
1169192955 20:3669422-3669444 CTGGGGCTGGGGAGGGGCATAGG + Intronic
1169535326 20:6532744-6532766 CTGGGCATTTGGAGGGAAATGGG + Intergenic
1169538893 20:6578821-6578843 TGGGGGATGGGGAGGGAAATGGG + Intergenic
1170083300 20:12500891-12500913 GTGGGGCTGAAGAGGACAATTGG - Intergenic
1170425257 20:16228936-16228958 GTGGGGTTGGGGAGGGGAAATGG - Intergenic
1170719200 20:18860326-18860348 GTGGGGGAGTGGGGGGAAAGGGG + Intergenic
1170806451 20:19636630-19636652 CTGGCTCTGTGGAGGTAAATAGG - Intronic
1171126131 20:22603583-22603605 GTCGTGCTGGGGAGGGAAACAGG - Intergenic
1171341348 20:24431617-24431639 GGAAGGCTGTGGAGGGAATTTGG - Intergenic
1171447476 20:25214970-25214992 GTGGGGCTGTGCAGTGAGGTGGG + Intronic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172766582 20:37354376-37354398 GTGGGGCTGGGGTGGGGACTGGG + Intronic
1172892683 20:38278191-38278213 GTGGGGCCATAGAGGGAAAGGGG - Intronic
1172950624 20:38721274-38721296 GTGGGGCTGGGGGTGGAAATGGG - Intergenic
1173381601 20:42549432-42549454 GTGGGGTTGGGGAGGGACACGGG + Intronic
1173501349 20:43556391-43556413 GTGGGGCTGGGGGTGGGAATAGG + Intronic
1173557906 20:43980382-43980404 GTGGGGCAGAGGGGGGACATGGG + Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1174360251 20:50024342-50024364 GTGGGGCTGAGGTGGGAGAGGGG + Intergenic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175902622 20:62366101-62366123 GTGGGGCTGAGGTGGGGAATGGG + Intronic
1175936786 20:62517796-62517818 GGGAGGCTGTGGTGGGGAATGGG - Intergenic
1176099117 20:63356953-63356975 GTGGGGATGTGGAAGGAGGTGGG - Intronic
1176111882 20:63414587-63414609 CTGGGGCTGAGGCGGGGAATGGG + Intronic
1176300035 21:5095087-5095109 GTGGCGCTGTGGAGGGTGACCGG + Intergenic
1176925244 21:14741301-14741323 GTGGGGCTGGGAAGGGAGGTGGG - Intergenic
1177689068 21:24480273-24480295 TTGGGGGTGGGGGGGGAAATAGG - Intergenic
1178714116 21:34948035-34948057 GTGGGGATGATGAGGGTAATGGG - Intronic
1178886858 21:36491675-36491697 GTGGGGCTGTGTCAGGAAAGTGG + Intronic
1178944099 21:36931935-36931957 TTGGGGATGTGGGGGGAAAACGG - Intronic
1179049700 21:37878738-37878760 GTGGGGCTGGGTGGGGAAAGAGG + Intronic
1179567933 21:42260778-42260800 GTGGGGCTGTGGGGAAAAGTGGG - Intronic
1179856987 21:44166824-44166846 GTGGCGCTGTGGAGGGTGACCGG - Intergenic
1180189575 21:46155970-46155992 CTGGGGCTGTGGAGGGCGAGAGG + Intergenic
1180245338 21:46543577-46543599 CGGGGGCTGTGGAGGGTCATGGG - Intronic
1180692862 22:17731985-17732007 GTGGGGCTGTGGAGTGAAGTAGG + Intergenic
1181086425 22:20441673-20441695 GTGGGGCTGTGGGGGCAGCTGGG - Exonic
1182435364 22:30326534-30326556 GTGGGGCAGGGGAGGGAACGGGG + Intronic
1182931282 22:34176641-34176663 GGGGGACTGGGCAGGGAAATTGG + Intergenic
1183691603 22:39392773-39392795 GTGGGGCTGTGTGGGGACAGTGG - Intergenic
1183945845 22:41325260-41325282 CTGGGGCTGTGGCTGGAAGTGGG + Intronic
1184131494 22:42519418-42519440 GAGCGGGTGTGGACGGAAATGGG + Intronic
1184261046 22:43316575-43316597 GTGGGGCTGTGGAGGTGAGCAGG - Intronic
1184455582 22:44607942-44607964 GTCGGGCGGGGAAGGGAAATGGG - Intergenic
1184512326 22:44940893-44940915 GTGGGGCTGTGGAGGTGAGTGGG + Intronic
1184871359 22:47240359-47240381 GTGGGCAGGAGGAGGGAAATTGG + Intergenic
1184989031 22:48154937-48154959 GTAGGGCGGTGGAGTGAAAAGGG - Intergenic
1185427080 22:50778090-50778112 GTGTGGCTGTGGAGTGAAAGGGG - Intronic
949511222 3:4768779-4768801 GTGGGGGCGTGGAGGGAGCTCGG + Intronic
949512808 3:4781583-4781605 GTGCGGCTGTGAAGGGTAATAGG + Intronic
950218611 3:11177674-11177696 GTTGGGCACTGGAGGGAAAGGGG - Intronic
950522678 3:13505918-13505940 CAGGGGCTGGGGAGGGAAAGTGG + Exonic
951515637 3:23556014-23556036 ATGGGGGTGGGGAGGGAAATGGG + Intronic
952075695 3:29694793-29694815 TTGGGGCTGGGGTGGGAGATGGG - Intronic
952400547 3:32959450-32959472 GTGGGGCAGTGGAGCAAAGTAGG + Intergenic
952518739 3:34132727-34132749 TTGGCTCTGTGGAGGGAAGTTGG + Intergenic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
953287201 3:41622595-41622617 GTCGGGGAGTGGAGGGAAAGGGG + Intronic
953492564 3:43363758-43363780 GTTGGGCTGTGAAGTGAATTGGG + Intronic
954116203 3:48468176-48468198 CCTGGGTTGTGGAGGGAAATTGG - Exonic
954857886 3:53662372-53662394 GCGGGGCTGTGGAGAGAATGGGG - Intronic
955018291 3:55092847-55092869 GTGGAGAGGAGGAGGGAAATGGG - Intergenic
955065304 3:55528878-55528900 CTGGGGGTGGGGAGGGATATGGG + Intronic
955157349 3:56429696-56429718 GTAGGGCCTTGGAGGGAACTGGG + Intronic
955516489 3:59731140-59731162 TGGGGGCTGTGGAGAGAACTAGG + Intergenic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955768117 3:62366032-62366054 GTGGGCCGGGGGAGGGAAAGAGG - Intergenic
955799285 3:62669292-62669314 ATGGGGCTGTGGAGGAAAGGAGG - Intronic
956998337 3:74853837-74853859 ATTGGGCTGCAGAGGGAAATAGG + Intergenic
958558431 3:95709741-95709763 GTGGAGATGAAGAGGGAAATGGG + Intergenic
958586123 3:96090571-96090593 GTGAGGATATGGTGGGAAATTGG + Intergenic
959822108 3:110747978-110748000 GTGGGGTAGTGGAAAGAAATGGG - Intergenic
960057352 3:113284873-113284895 GTGGGGCTTGGGAGTGAAAGGGG - Intronic
960066845 3:113383440-113383462 GTGGGGCCTTTGAGGGAATTAGG - Intronic
960205824 3:114896595-114896617 GTGGGAGTGCAGAGGGAAATGGG + Intronic
960284455 3:115811245-115811267 GTGGGTCTGAGAGGGGAAATAGG + Intronic
961325594 3:126107457-126107479 GGAGTGCTGTTGAGGGAAATGGG + Intronic
961464643 3:127073664-127073686 GAGGGGCTGGGGAGGGACAGAGG + Intergenic
961474876 3:127140332-127140354 GTGGGGCTGGGGAGAAAAGTGGG + Intergenic
961639696 3:128357518-128357540 GTAGGGCTGTGGAGGAAAAGTGG + Intronic
962249052 3:133823756-133823778 GTGGGGCTGGGGATGGAATATGG + Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
964347017 3:155764223-155764245 GTGGTTCTGTGGAGGGGAAGTGG + Intronic
964501602 3:157354165-157354187 GTGGGGCACAGGAGGTAAATGGG + Intronic
964999361 3:162933102-162933124 CAGGGGCTGGGGAGGGGAATTGG - Intergenic
965733042 3:171792567-171792589 CTGGGGCTGGGCAGGGAAACAGG - Intronic
966322707 3:178718707-178718729 GTGGGGCAGTGGAAAGAAACTGG - Intronic
968075104 3:195811995-195812017 GTGGGGCTGAGGAGAGAAAAGGG - Exonic
968351515 3:198058240-198058262 GTAGGGCTGGGGCTGGAAATGGG - Intergenic
968610969 4:1556830-1556852 GTGGGGCCGAGGAGGGAATGAGG - Intergenic
968641720 4:1718112-1718134 GTGGGGCTGCGGAGGGCACATGG - Intronic
968977972 4:3831580-3831602 GTGGGGCTGGGAAGGCAGATTGG - Intergenic
969067975 4:4505074-4505096 CTGGGGGTGTTGGGGGAAATGGG - Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969591481 4:8124418-8124440 CAGGGGCTGCGGAGGGAAAACGG - Intronic
969643677 4:8413621-8413643 GTGGAGGGGTGGAGGGAGATGGG - Intronic
970138792 4:12957145-12957167 GTGGCGCTGTGTCAGGAAATTGG - Intergenic
970335346 4:15033866-15033888 GTGGGTGTGGAGAGGGAAATAGG + Intronic
970540547 4:17074071-17074093 GTGGGGCTGGAGAGGCTAATGGG - Intergenic
971029436 4:22620894-22620916 GCAGGGGTGTGGAGGGGAATGGG + Intergenic
971116240 4:23648795-23648817 GTGGGGAAGTGGAGAGAAAATGG - Intergenic
971325409 4:25639407-25639429 GTGGGGCTGGAGAGAGAAAGAGG + Intergenic
973110299 4:46390048-46390070 CTGGGGCCGGGGGGGGAAATTGG + Intronic
974364355 4:60927033-60927055 GTGGGTCTGTGGGGAGAAGTGGG - Intergenic
974834907 4:67236713-67236735 GTGGGGCTATGAAGAGAAAGGGG + Intergenic
974886845 4:67829866-67829888 ATGTTGATGTGGAGGGAAATGGG + Intronic
975355349 4:73396106-73396128 TGGGGGTTGTGGAGGGAAATTGG + Intergenic
975679476 4:76861751-76861773 GAGGGGCTTTGGGGTGAAATAGG + Intergenic
976754344 4:88482464-88482486 GAGGGTCTGTGGTGGGAGATGGG - Intronic
977464660 4:97368826-97368848 GTGGGGTTGGGGAGGGGAAATGG - Intronic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
977630318 4:99235233-99235255 GTGGTGCTATGGAAGGAAACTGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978383270 4:108153103-108153125 GAGGTGCTGGGGAGGGAAAAGGG - Intronic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
981113744 4:140965750-140965772 GTGGGGGAGTGGAGAGAAAATGG + Intronic
981851715 4:149239197-149239219 GTGGGGGTGGGGAGAGAACTAGG + Intergenic
982101301 4:151970885-151970907 GTGAGGATGTGGCGGGAAAAGGG - Intergenic
985124877 4:186683226-186683248 GCGGTGCTGTGGAGGAAAACAGG - Intronic
985283790 4:188313466-188313488 GTCAGGCGGTGGAGGGAAAAGGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985698600 5:1357406-1357428 GGAGGGCTGTGGAGGACAATGGG - Intergenic
986216652 5:5725732-5725754 GTGGGGAGGAGGAGAGAAATGGG + Intergenic
987141776 5:14953713-14953735 GTGGGACTGTGGAGCCACATAGG - Intergenic
987955796 5:24738281-24738303 CTGGTGCTGTGCATGGAAATTGG + Intergenic
988043096 5:25912541-25912563 GTGGGGGTGTGGAAGGGACTAGG - Intergenic
988067846 5:26245152-26245174 CTGGGGCTGTGGATGGAAACTGG - Intergenic
989140393 5:38195909-38195931 TAGGGGCAGTGGAAGGAAATTGG - Intergenic
991017325 5:61945974-61945996 GAGGGGCTGGGGAGGGGAATGGG + Intergenic
991205841 5:64049479-64049501 GTGGGGTTGGGCAGGGAAGTGGG + Intergenic
991718159 5:69471391-69471413 GAGAGGATGTGGAGAGAAATAGG + Intergenic
992025066 5:72662159-72662181 CTGGGTCTGTGGAGGGCAGTGGG - Intergenic
993764066 5:91833577-91833599 GTCGGGGTGTGGGGGGAAAGGGG - Intergenic
993877626 5:93326765-93326787 GTGGGGCTAGGCAGGGAGATAGG - Intergenic
994879188 5:105464396-105464418 GTGGGGGTGTGGTGGGGATTGGG + Intergenic
994990787 5:106994453-106994475 GTTGGGTGGTGGAGGGCAATGGG - Intergenic
995226665 5:109708438-109708460 GTGGGGCCCTGGAGGGGAATGGG + Intronic
995527768 5:113064266-113064288 GTGGCACTGTGGAAGGGAATTGG + Intronic
995544672 5:113218098-113218120 GTGGGGGTGAGGTGGGAAACTGG + Intronic
996404734 5:123094112-123094134 GAGGGGCTGGGGAGAGAAAAGGG + Intronic
996805932 5:127453929-127453951 GTGGGTGTGGGGAGGGAAATAGG - Intronic
997085838 5:130797490-130797512 GTGTGGCTGGTGAGGGACATGGG - Intergenic
997601820 5:135144192-135144214 GTGAGGCTGTGGAAAAAAATAGG - Intronic
998634431 5:143937217-143937239 GTGGGGGAGTGGGGTGAAATGGG + Intergenic
999229538 5:150053517-150053539 GTGAGGCTGTGGAGTGAAGGCGG + Exonic
999304444 5:150510546-150510568 GTGGGGCTGTGTGGGGAACACGG - Intronic
999752620 5:154640764-154640786 GTGGGGCTGTATAGGGAGACTGG + Intergenic
999841508 5:155432608-155432630 GGGAGGCTGAGGAGAGAAATGGG + Intergenic
1000862574 5:166474396-166474418 GTGGTCCTGTGGAGGGAGTTGGG + Intergenic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1001032990 5:168276335-168276357 GTGGGGCTGGGGAGGGCGTTAGG - Intergenic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001266506 5:170278315-170278337 GGGGGGCTGGGGAGGGGGATGGG + Intronic
1001569233 5:172719238-172719260 GTGGGGCTATGGTGGGGAAAAGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002190336 5:177474250-177474272 GGGGGGCTGTGGTTGGGAATTGG - Intronic
1002394947 5:178945472-178945494 GTGTGTATGTGGAGGGATATGGG + Intronic
1002670409 5:180861596-180861618 GTGGGGGCCTGGCGGGAAATGGG + Intergenic
1003308648 6:4950017-4950039 GCGGGGCTGTGGAGGAAGACCGG + Intronic
1003420484 6:5953274-5953296 GTGGGGATGGGGAGGGAAATGGG - Intergenic
1003701220 6:8467197-8467219 GTGGGGGTGTGGATGAAAAGTGG + Intergenic
1003885246 6:10515785-10515807 GTAGGGGTATGGAGGGAAAGGGG - Intronic
1004135621 6:12963295-12963317 GTGCAGCTGTGGAGGGGAAGAGG - Intronic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004533503 6:16477109-16477131 GTGGGTCTTTGCAAGGAAATGGG - Intronic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1005813854 6:29534813-29534835 GTGGGGCTGAGGTGGGAGAATGG + Intergenic
1006029843 6:31170687-31170709 GTGGGACTGGGGAGGGAGAGAGG - Exonic
1007081924 6:39113103-39113125 GCGGGGCTGGGGTTGGAAATGGG + Intronic
1007109425 6:39304427-39304449 GAGGGGCTGTGGTGGGAATTGGG - Intronic
1007589862 6:43014446-43014468 GTGGGGGTGGGGAGGGAGCTAGG + Intronic
1007628943 6:43262141-43262163 ATGGGGCTGGTGAGGGAAATGGG + Intronic
1007951439 6:45876068-45876090 GTGGGGCTGCAGAGGGGAGTGGG + Intergenic
1009645576 6:66396376-66396398 GTGGGCCTGAGGAGGGCAGTGGG + Intergenic
1009856000 6:69264670-69264692 GTGGGGGTGTGGAGTGAGTTTGG - Intronic
1010468740 6:76200048-76200070 GTGGGTGTGTTGAGGGAAACAGG + Intergenic
1010609191 6:77932032-77932054 GTGGGGTTGTGGGTGGAGATGGG + Intergenic
1011364019 6:86560673-86560695 TTTGGGCTCTGGAGGGAAAGTGG - Intergenic
1011542597 6:88448222-88448244 GTGAAGATGTGGAGAGAAATTGG + Intergenic
1011788128 6:90868781-90868803 GTGGAGGTGAGGAGGGAAAGAGG + Intergenic
1011997623 6:93613120-93613142 GTGGGGCGGTGGGGGGAAGAGGG + Intergenic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1014754991 6:125292625-125292647 GTTGGGGTGGCGAGGGAAATGGG + Intronic
1015459771 6:133476399-133476421 GTGGGGCTGGAGAGGGAGACTGG - Intronic
1015772752 6:136785708-136785730 GTGGGGCTGTGGTGAGGAAGGGG - Intronic
1015922057 6:138276143-138276165 GTGGGGCTTTGGAGGGTAAGAGG + Intronic
1016356415 6:143223560-143223582 GTGGGGCTGGGGAGGGAGATGGG - Intronic
1017352849 6:153463408-153463430 GAGGGGCAGGGGAGGGGAATGGG + Intergenic
1018174702 6:161168456-161168478 ATAGGGCTGTGGAGGGTACTGGG - Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1018923500 6:168191465-168191487 CTGGGCTTGTGGAGAGAAATGGG + Intergenic
1019058693 6:169240907-169240929 GTGGGACTGGGGTGGGAACTAGG + Intronic
1019491368 7:1315025-1315047 GCGGGGCTGTGGGCGGAATTGGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019978618 7:4604794-4604816 GGGGGGCCGTGGAGAGAAAGTGG + Intergenic
1020082985 7:5296514-5296536 GTGGGGCTGGGAAGGGAGGTGGG + Intronic
1020800735 7:12729182-12729204 GTGGGGCGGTGGTGGGGAAGAGG - Intergenic
1020863916 7:13531840-13531862 GTAGGCCTGTGGGGGCAAATTGG + Intergenic
1021465532 7:20938756-20938778 GTGTGACTGTGCAGGCAAATGGG + Intergenic
1021496578 7:21281416-21281438 GTGAGGCTGTGGTTGGAGATGGG + Intergenic
1021788304 7:24174619-24174641 CTGGTGCTGTGAAGGGAAAGTGG + Intergenic
1021996967 7:26188417-26188439 TTGGGGTAGTGGAGGGGAATTGG - Intergenic
1022282694 7:28927017-28927039 GTGGGGCTTGGGAAGGAAAAAGG + Intergenic
1022323230 7:29306531-29306553 GAGGGGCTGTGGCAGGAAAGGGG + Intronic
1022659100 7:32349398-32349420 GGGAGAGTGTGGAGGGAAATGGG + Intergenic
1022780710 7:33579749-33579771 GTGAGGAGGTGGAGGGAATTGGG - Intronic
1022822390 7:33974223-33974245 TTGGGGATGTGGAGTGAGATTGG + Intronic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023245720 7:38201423-38201445 GTGGGTTTGTGGAAGGAAAAAGG + Intronic
1023311620 7:38893167-38893189 GTGAGGCTGGTGAAGGAAATTGG - Intronic
1023538456 7:41238931-41238953 ATGTGGCTGTGCAGGGAAACAGG - Intergenic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1025089755 7:56052120-56052142 GTGGGGCTTAGGAGGGACACAGG - Intronic
1025913005 7:65842442-65842464 CTGGGGGTGAGGAGGGGAATGGG + Intergenic
1026403165 7:70036873-70036895 GTGGGGATGTAGAGGGACAAAGG + Intronic
1026499297 7:70929583-70929605 GAGGGGCTGTGGAGAGAAGTTGG - Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026911632 7:74094717-74094739 GTGGGGCGGAGGACGGAAGTTGG - Intronic
1027173827 7:75890750-75890772 GGGGGGCTGTGGAGGGAGGGTGG + Intergenic
1027854002 7:83485753-83485775 GGGTGCATGTGGAGGGAAATAGG + Intronic
1029139571 7:98400637-98400659 GAGGGGCTGTGGAGGGCCAGGGG + Intronic
1029537944 7:101166775-101166797 GTGGGGGGGAGGACGGAAATGGG + Intergenic
1029660571 7:101958309-101958331 GTGGGGCTGTCGTGGGAACTGGG + Intronic
1030585907 7:111419380-111419402 TTGGAGCTGTGAAAGGAAATGGG + Intronic
1030790491 7:113721452-113721474 ATGGGGCTGTAGAGGAAAATAGG - Intergenic
1031325434 7:120391062-120391084 GTTGGGCAGTGGAGGCAAAGGGG - Intronic
1031899134 7:127391706-127391728 GCGGGTCCGTGGAGGGAAAGCGG - Intronic
1032497173 7:132371139-132371161 GTTGGGGTGGAGAGGGAAATGGG + Intronic
1032749746 7:134826844-134826866 GTTGGACTGAGGAGGTAAATGGG - Intronic
1033273635 7:139955290-139955312 GGGGGGAGGTGGAGGGAGATGGG - Intronic
1033361225 7:140640451-140640473 GTCGAGCTGGGGAGGGAAAGGGG - Intronic
1033512138 7:142069649-142069671 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1033515219 7:142098581-142098603 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1034073146 7:148207292-148207314 GTCGGGCAGGAGAGGGAAATGGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034833452 7:154330027-154330049 GTCGGGCGGTGGAGGGGAAGGGG + Intronic
1034994837 7:155571037-155571059 GTGGGGGTGGGGAGGGAGGTGGG - Intergenic
1035176398 7:157055126-157055148 GTGGGGCTGTGGGAGGGAAGCGG - Intergenic
1036773158 8:11592622-11592644 GTGGGCAGGTGGAGGGGAATCGG - Intergenic
1037487765 8:19364569-19364591 GGGGGGCGGGGGAGGGAAAGGGG - Intronic
1037844428 8:22270568-22270590 CTGGGGCTGGGGTGGGAATTAGG - Intergenic
1037923496 8:22826028-22826050 GTGGGGTGGTGGGGGGACATGGG + Intronic
1038526315 8:28276675-28276697 GAGGGGCTGTGGAGGACAGTGGG - Intergenic
1038963541 8:32548179-32548201 GTGGGGGTGTGGTGGGGAAGAGG + Intronic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039542128 8:38381566-38381588 TGGGGGGTGTGGAGGGAATTGGG - Intronic
1039610644 8:38916396-38916418 GTGGGGGGCTGGGGGGAAATGGG - Intronic
1039964538 8:42274436-42274458 GGGGAGTTGTGGAGGGAAATAGG - Intronic
1040102283 8:43516396-43516418 GTGGGAGTGTGGAGGGTAGTAGG + Intergenic
1040437400 8:47404711-47404733 GAGAGGATGTGGAGAGAAATAGG + Intronic
1041726457 8:61022165-61022187 GTGAGGATGTGCAGGGAAATCGG - Intergenic
1042427217 8:68662113-68662135 TTGGGGCTTTGGCGGGAAAGTGG + Intronic
1042908829 8:73803550-73803572 GTGGGGGTGGGAAGGGAGATAGG - Intronic
1044751037 8:95415718-95415740 GTTGGGCTGTGAAGGGTAAGGGG - Intergenic
1045470561 8:102508710-102508732 GAGGGGCTGTGTGGGGAAAGGGG + Intergenic
1045942402 8:107754840-107754862 GTGGGGCTGGGGATGGGAAGTGG - Intergenic
1046787146 8:118280069-118280091 GTGGTGATGTGTAGGGAATTGGG + Intronic
1047498604 8:125426147-125426169 GTGAGGCTCGGAAGGGAAATGGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1049283478 8:141762298-141762320 GTGGGGCTGGGGAGGGTGAGAGG + Intergenic
1049318907 8:141985486-141985508 CTGGGGTTGTTGAGGGACATAGG - Intergenic
1049371091 8:142267734-142267756 GTGGGTCTGTGATGAGAAATAGG - Intronic
1049421069 8:142516962-142516984 CTGGGGCTGTGCAGGGCCATGGG + Intronic
1049589315 8:143449059-143449081 CTGGGGCTGTGCAGGGCAGTGGG + Intronic
1049974530 9:848985-849007 GTGGGGCTGAGATGAGAAATGGG + Intronic
1050259500 9:3826665-3826687 GTGGGACTGTGGAGGGAGACTGG + Intronic
1050715306 9:8517821-8517843 GTTTGGTTGAGGAGGGAAATAGG - Intronic
1051279825 9:15431181-15431203 GGGGAGCTGTGGAGGGAAATGGG - Intronic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1052864692 9:33457832-33457854 GTGGGGTTGTGCAGGGAGAGAGG - Intergenic
1053221512 9:36316946-36316968 ATGGAGCTGTGGAGAGGAATGGG + Intergenic
1053433289 9:38058237-38058259 CTGGGTCTGTGGGAGGAAATGGG - Intronic
1054850583 9:69842978-69843000 GTGGGGGTGGGGAAGGAAAGAGG + Intronic
1058944199 9:109841616-109841638 GTGGGGGGGTGGAGGGAAAGAGG + Intronic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059426141 9:114222166-114222188 GAGGGGCCCTGGAGGGAGATGGG + Intronic
1059688328 9:116659422-116659444 TTGGGGCTGTGGTGATAAATTGG - Intronic
1060140453 9:121205177-121205199 GTGGGGATGGGGTTGGAAATGGG - Intronic
1060263568 9:122095729-122095751 GTAGGTTTGTGGAGAGAAATGGG - Intergenic
1061053730 9:128210790-128210812 GTGGGACTGGGGTGGGGAATAGG - Intronic
1061100058 9:128485501-128485523 GTGGCGCTGTTGAGGGACTTGGG + Intronic
1061798984 9:133104033-133104055 GTGGGGCTGGGGAGGGCCAGGGG - Intronic
1061893137 9:133633300-133633322 GTGGGGGTGGGGATGGGAATGGG - Intergenic
1062152923 9:135031169-135031191 GGGGGGCTGTGGGGGGCTATGGG + Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186082802 X:5951773-5951795 GTGGGGCTTTGGAAGGTATTTGG - Intronic
1186789569 X:12983769-12983791 GTGGGTCTGTGGAAGGAGAGAGG + Intergenic
1187035979 X:15539939-15539961 GAGAGGATGTGGAGAGAAATAGG + Intronic
1187859157 X:23665237-23665259 GGGGGGCTGGGGAGGAAAGTGGG + Intronic
1188660846 X:32756892-32756914 GATGAGCTGTGGAGGGATATAGG - Intronic
1189172859 X:38926213-38926235 GTGGAGCTGTGGAGGCAACTGGG - Intergenic
1189471972 X:41321748-41321770 CCTGGGTTGTGGAGGGAAATTGG - Intergenic
1190464808 X:50715697-50715719 GTGAGGCTGTGGAGGAAAGGTGG + Intronic
1190759756 X:53429700-53429722 GTAGGGATGTGGAAGGAACTAGG - Intronic
1191870507 X:65741194-65741216 GTGGGGGTGTGGAAGGGACTAGG - Exonic
1192453101 X:71255473-71255495 TAGGGGCTGTGGTGGGAAGTGGG - Intergenic
1192603183 X:72486382-72486404 GTGGAGCAGTAGAGGGAAAGGGG - Intronic
1192758146 X:74067138-74067160 CCTGGGTTGTGGAGGGAAATTGG + Intergenic
1192860937 X:75069683-75069705 GTGGGGTTGGGGAGGGAGAAGGG + Intronic
1193605400 X:83561912-83561934 GTCAGGGTGTGGAGGGTAATGGG - Intergenic
1195122335 X:101768067-101768089 GTGGGGGCCTGGAGGGGAATGGG - Intergenic
1195343945 X:103929612-103929634 GTGGGGCTGGAGATGGGAATGGG + Intronic
1195378443 X:104249836-104249858 GGGGAGGTGTGGAGGGAAAATGG + Intergenic
1195504524 X:105642130-105642152 GGGGGGCTGTGCAGGGAATATGG - Intronic
1195923036 X:110002022-110002044 GTGGGGCTGTGGCTAGAAAGGGG + Intergenic
1195991889 X:110691205-110691227 GTGGGTCTGGGGAGGGAACAGGG - Intronic
1196387860 X:115177788-115177810 GTGGGGGTGTGGGGGGCAAGGGG - Intronic
1196532109 X:116799978-116800000 GTGGGGGTTTGGGAGGAAATGGG - Intergenic
1196574011 X:117297489-117297511 GTGGGGGTGTTGTGGGAAGTTGG - Intergenic
1197159094 X:123303740-123303762 GTGGGGCTTTGGGGGCTAATGGG - Intronic
1197655725 X:129114110-129114132 ATAGGGCTGTGGAGGAAAAGAGG + Intergenic
1198561821 X:137858489-137858511 GTGGGAATGTGGATAGAAATAGG + Intergenic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198798883 X:140429556-140429578 CAGGGGCTGGGGAGGGTAATGGG + Intergenic
1199894792 X:152118767-152118789 GTGGGGATGGGGATGGAAATGGG + Intergenic
1199947262 X:152679627-152679649 GTGGGGGTGGGGATGGGAATGGG - Intergenic
1199949896 X:152699169-152699191 GTGGGGGTGGGGATGGGAATGGG - Intronic
1199959778 X:152769292-152769314 GTGGGGGTGGGGATGGGAATGGG + Intronic
1199962418 X:152788827-152788849 GTGGGGGTGGGGATGGGAATGGG + Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200045461 X:153398511-153398533 CTGGGGCTGTGCAGGAAAACTGG + Intergenic