ID: 1092087190

View in Genome Browser
Species Human (GRCh38)
Location 12:5772882-5772904
Sequence AAACACGTGCTGTCAAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092087183_1092087190 3 Left 1092087183 12:5772856-5772878 CCACTCCCAAGGGAGTCCAGGGG 0: 1
1: 0
2: 0
3: 26
4: 186
Right 1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1092087185_1092087190 -2 Left 1092087185 12:5772861-5772883 CCCAAGGGAGTCCAGGGGATTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1092087178_1092087190 26 Left 1092087178 12:5772833-5772855 CCACATAATATGGATGTTAATAG 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 105
1092087186_1092087190 -3 Left 1092087186 12:5772862-5772884 CCAAGGGAGTCCAGGGGATTAAA 0: 1
1: 0
2: 1
3: 14
4: 122
Right 1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092087190 Original CRISPR AAACACGTGCTGTCAAGAAG GGG Intronic
902711406 1:18242508-18242530 AAACAAGTATTGTCAAGTAGTGG + Intronic
908053021 1:60253433-60253455 ATACATGTGCTGTCAAGTATAGG - Intergenic
908224169 1:62039638-62039660 AAACACAGGTTATCAAGAAGGGG + Intronic
915006035 1:152637472-152637494 AAACAGATGATGTCAAGACGTGG - Intergenic
918260730 1:182793497-182793519 GAACACCTGGTGTCAAGCAGAGG + Intronic
919185610 1:194144247-194144269 AAAAACTTGCTCTCAAGAAAAGG - Intergenic
920891756 1:209993594-209993616 AAACAGGGCCTGTCCAGAAGGGG + Intronic
922885771 1:229019467-229019489 ATCCAAGTGCTGGCAAGAAGAGG + Intergenic
924199110 1:241640744-241640766 CACCACGTGCTGGCAAGAATTGG + Intronic
924943473 1:248828808-248828830 AAAAACGTGCTGTCCAGGAAAGG - Intergenic
1062986158 10:1771241-1771263 AAACACGTGCTGTGAAAAGCAGG - Intergenic
1062992826 10:1836392-1836414 AAAGACGTGGTGTGGAGAAGGGG + Intergenic
1065081501 10:22134138-22134160 AAACCTGTGCTTTCAAAAAGAGG - Intergenic
1067415810 10:46101555-46101577 AAACATTTTCTGTCCAGAAGTGG - Intergenic
1067435880 10:46276833-46276855 AAACATTTTCTGTCCAGAAGTGG - Intergenic
1068316500 10:55350574-55350596 GAACACTTGATGTCTAGAAGTGG - Intronic
1069311579 10:67044419-67044441 AAAAACTTGCTTTTAAGAAGAGG + Intronic
1076175642 10:128365880-128365902 AAAAACGTGTTGTGATGAAGCGG - Intergenic
1080725637 11:34897707-34897729 ACACACATGGTGACAAGAAGAGG - Intronic
1084325608 11:68398142-68398164 AAACACGTGCTGTCAGAGGGTGG + Intronic
1084380847 11:68811800-68811822 AAACATGTGCTATCAACAGGCGG + Intronic
1090363523 11:126188924-126188946 AGACACTTGCTGACAGGAAGAGG + Intergenic
1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG + Intronic
1093699018 12:22196776-22196798 AAACTCGTGCTGTCTAAATGTGG - Exonic
1093960350 12:25265754-25265776 AAAAAATTGCTATCAAGAAGTGG - Intergenic
1094306930 12:29030680-29030702 AAACAATTGCTGTAAAGCAGTGG - Intergenic
1094647323 12:32338357-32338379 AAAAACCTGCTTTCAAGAAAAGG - Intronic
1094829822 12:34294970-34294992 AAATATGTGCGGCCAAGAAGGGG - Intergenic
1095535035 12:43235156-43235178 AAAAAGCTGCTGTCAAGTAGTGG - Intergenic
1096940559 12:55340329-55340351 AAACAGATACTGGCAAGAAGAGG - Intergenic
1097078401 12:56411890-56411912 AAAAACGTGCTGGCCAGATGTGG - Intergenic
1106140736 13:27008828-27008850 AACCACGTGGTGAAAAGAAGAGG - Intergenic
1109077445 13:57854728-57854750 AAACACGTGCTGTTTTGAAGAGG + Intergenic
1110027687 13:70562370-70562392 AAGCACGTGCTATCAATAACTGG - Intergenic
1112356122 13:98676066-98676088 AGGCAGGTGCTGGCAAGAAGCGG - Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1113695655 13:112343479-112343501 AAACACCCTCTGTTAAGAAGAGG - Intergenic
1116162644 14:41289079-41289101 AAACACTTGCTGTGCTGAAGGGG - Intergenic
1119253291 14:73176299-73176321 AAACACGTGCAGACAAAAAAAGG - Intronic
1125513555 15:40305763-40305785 AAACAGGTGCTGTCATAAATTGG - Intronic
1126621186 15:50641525-50641547 AGACACATGAAGTCAAGAAGAGG - Intronic
1130827884 15:87568094-87568116 AAACCGGTGTTGTCAATAAGAGG - Intergenic
1131911558 15:97210272-97210294 AAGCACATGCTTTCTAGAAGTGG + Intergenic
1139035793 16:62945035-62945057 AAATACGTGCTTTCAACTAGAGG - Intergenic
1139315498 16:66064585-66064607 AAACACTTTCTGTCAAGGAATGG - Intergenic
1140464874 16:75173315-75173337 AAACAGGAGCTGTGAATAAGGGG + Intergenic
1142805153 17:2367570-2367592 AGACAGGTGCTGGCAAGAAAAGG + Intronic
1151198193 17:72446723-72446745 AAACAAGGGCTGTTCAGAAGCGG - Intergenic
1152844314 17:82590443-82590465 AAAGACGTGCTGGCCAGAGGCGG - Intronic
1160403746 18:78630042-78630064 CAAAACGTGCTGTCAACCAGAGG + Intergenic
928358698 2:30645428-30645450 AAACACTTGTTATCAAGAACAGG + Intergenic
933987423 2:87603554-87603576 ACACACATGCTGTCAGGAAGTGG - Intergenic
936306416 2:111347254-111347276 ACACACATGCTGTCAGGAAGTGG + Intergenic
940068538 2:149657121-149657143 AAGCACTTGCTGTCAATCAGTGG + Intergenic
946953090 2:224898539-224898561 AAACACGTGCTTTGCAGAATTGG - Intronic
1170837119 20:19894095-19894117 AAACACGTGGTGGGGAGAAGGGG + Intronic
1173150820 20:40565363-40565385 AAACACGTCCTGTAAGGAATAGG + Intergenic
1175155707 20:56969973-56969995 AAATCTGTGCTGTAAAGAAGAGG - Intergenic
1177012791 21:15749110-15749132 ATACACTTGCTGTGAATAAGAGG + Intronic
1178137474 21:29643568-29643590 AAGCACATGCTGGCAAGAGGAGG - Intronic
1179254187 21:39700575-39700597 TAACACATGCTGTAAGGAAGTGG - Intergenic
1183222323 22:36523646-36523668 AAACACAGGCAGGCAAGAAGAGG - Intronic
949376820 3:3400232-3400254 AAACACGTGCTGTGCTGCAGGGG + Intergenic
950029335 3:9841842-9841864 ATACAAGTACTGTGAAGAAGAGG - Intronic
950714295 3:14836829-14836851 AGCCACGTGCTTTGAAGAAGAGG + Intronic
954295015 3:49669554-49669576 AAACAGGTGCAGTCAAGAGCTGG - Exonic
957530513 3:81435203-81435225 TAACAAGTGCTGTCAAGGATTGG + Intergenic
959773896 3:110134203-110134225 AAACTGGTGCAGTCAAGAACAGG + Intergenic
960980082 3:123215760-123215782 GAACACATGCTGCCAAGAAAGGG - Intronic
964504547 3:157384532-157384554 AGACACATGCTTTAAAGAAGGGG - Intronic
964882455 3:161439172-161439194 AAACAGGTGCTGGCAAGGATGGG + Intergenic
968865725 4:3210031-3210053 CAACATGTGTTGTCAACAAGTGG - Intronic
972520726 4:39853440-39853462 AAACAGCTGCTGTGAAGAAGTGG - Intronic
972842503 4:42948329-42948351 AAACAAGTGCATTAAAGAAGGGG - Intronic
979197955 4:117942268-117942290 AAACACGTGCTGTTGAAAAGCGG - Intergenic
982842055 4:160201462-160201484 AAACACATGCTGTTAAAAAATGG + Intergenic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
985804645 5:2033558-2033580 AAACACGTCCATTCAAAAAGAGG + Intergenic
986835285 5:11630435-11630457 TACCAGGTGCTGTCAAGAATTGG - Intronic
991528443 5:67590028-67590050 AAACAAGTGCTTTTGAGAAGTGG + Intergenic
995566977 5:113441042-113441064 AAACAAGTTCTGTCAAGGTGTGG + Intronic
996039440 5:118793672-118793694 AACCACCTGCTCTAAAGAAGGGG - Intergenic
1004658440 6:17687807-17687829 AAACACGTGCTTTAAAGGATAGG + Intronic
1005789251 6:29279390-29279412 GAACACGTGGTGACAGGAAGGGG + Intergenic
1010306032 6:74323751-74323773 AAACAAGGGCTCTCAAGAAAGGG + Intergenic
1011036851 6:82986382-82986404 AATCACTTGAAGTCAAGAAGTGG + Intronic
1017288180 6:152702524-152702546 GATCAAGTGCTGTCAAGAGGAGG + Intronic
1024680825 7:51685492-51685514 AAAGAAGTGCTGTCAATAACAGG + Intergenic
1028066106 7:86386751-86386773 AAAAAAATGATGTCAAGAAGAGG - Intergenic
1028589220 7:92478836-92478858 GTACATGTGCTGACAAGAAGAGG - Intergenic
1029639572 7:101811362-101811384 TAACATATGCTGTCCAGAAGTGG + Intergenic
1031016956 7:116585785-116585807 AAACATGGGAAGTCAAGAAGAGG - Intergenic
1031918861 7:127587290-127587312 AATCACGTGCTGGCAAGTGGTGG + Intronic
1036576128 8:10029307-10029329 AGACACCTGCTGTCAGGGAGAGG + Intergenic
1037446422 8:18970582-18970604 AAACAGGTGCTGTTAAGAGAAGG - Intronic
1037823147 8:22145308-22145330 AAACAGGTGTTGTCAAGCTGTGG - Intergenic
1038839147 8:31163246-31163268 AAACAGATGCTGTCAATATGTGG - Intronic
1039451541 8:37678648-37678670 CAACACTAGCTGTCAAGCAGTGG - Intergenic
1041850506 8:62386175-62386197 TCACACGTGCTTTCAAAAAGTGG - Intronic
1042167471 8:65959562-65959584 AAACACGCCCTTTCAAAAAGGGG - Intergenic
1043639059 8:82426139-82426161 CACCACATGCTGACAAGAAGTGG - Intergenic
1045506096 8:102779794-102779816 ACACACCTGCTTTCAAGCAGTGG + Intergenic
1048486706 8:134855094-134855116 AAAAATGTGCTATCAAAAAGTGG - Intergenic
1050199736 9:3131597-3131619 AAACACGGGTTGAAAAGAAGTGG - Intergenic
1050830202 9:10000789-10000811 GCACACGTGCTGACAAGAAAAGG - Intronic
1052059970 9:23947566-23947588 AAACTAGTGCTGTCTAAAAGAGG - Intergenic
1187515361 X:19964765-19964787 AAACACGTGAATTCATGAAGAGG + Intronic
1188346579 X:29073972-29073994 AAACCCCTTCTGTTAAGAAGAGG - Intronic
1189234670 X:39477935-39477957 AAACATTTGCTGACAGGAAGAGG - Intergenic
1190792941 X:53716682-53716704 GACCACATCCTGTCAAGAAGAGG - Intergenic
1191587296 X:62842497-62842519 ATAAACATGCTGTTAAGAAGAGG - Intergenic