ID: 1092092587

View in Genome Browser
Species Human (GRCh38)
Location 12:5815206-5815228
Sequence GAGAGTGTAAAATGCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092092587 Original CRISPR GAGAGTGTAAAATGCATGGC AGG (reversed) Intronic
900688997 1:3968250-3968272 GAGAGTGTGTAAGGCATGACAGG + Intergenic
901423408 1:9165776-9165798 GAGGGGGTAAGATGGATGGCTGG - Intergenic
903772361 1:25771931-25771953 CAGGGTGTAAAATGCCTGGCTGG - Intronic
904536970 1:31205922-31205944 GAGAGTTTAAAATGCTTGTCTGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
907869056 1:58426367-58426389 CATAGTGTCAAATTCATGGCAGG - Intronic
909248747 1:73325635-73325657 CAGAATATAAAATGCTTGGCTGG + Intergenic
911606725 1:99914384-99914406 GAGAGTCTAAAATTCTTTGCCGG - Intronic
912940587 1:114041359-114041381 GAGGGTGGAAAATGGATGGATGG - Intergenic
913508493 1:119541076-119541098 CAGAGTGAAAAATTCAAGGCTGG - Intergenic
917150137 1:171934539-171934561 GAGAGACTAAAATGCATCCCTGG - Intronic
917235061 1:172883140-172883162 GAGAGTGAAAACTGCAGGGGCGG + Intergenic
919213322 1:194517559-194517581 GGGCTTATAAAATGCATGGCTGG + Intergenic
920120061 1:203649872-203649894 GCGAGTGTGACATGCCTGGCCGG - Intronic
921359515 1:214317684-214317706 GAAAGTGTAAAATGGATGGGGGG + Intronic
922005008 1:221521472-221521494 GGGTGTGTGAAAGGCATGGCGGG + Intergenic
922987527 1:229877542-229877564 GAGAGTGAAAAACACATGGGGGG + Intergenic
924185657 1:241486941-241486963 CAGAGTGCAACATGCCTGGCTGG - Intergenic
1062841071 10:672388-672410 GGGAGTGGACAGTGCATGGCCGG - Intronic
1066385446 10:34937544-34937566 GAGAGTGTAGAATCCAAAGCTGG + Intergenic
1066982405 10:42430053-42430075 CACAGTGTAATATGAATGGCAGG + Intergenic
1071413669 10:85421354-85421376 GAGAGTTTTAAAAGCATTGCAGG - Intergenic
1071770018 10:88718106-88718128 GGGAATGTAGAATGCATGGGAGG - Intergenic
1072504857 10:96055559-96055581 GAGACAGTAAAATGCATGTTTGG + Intronic
1073232868 10:101987201-101987223 TAGAGTGTAGAGTGCATGGAGGG - Intronic
1076827347 10:132975686-132975708 GTGAGTATAAAATTCAAGGCTGG + Intergenic
1078706479 11:13748595-13748617 TGGTGTGTAAAATGCAGGGCAGG - Intergenic
1079295616 11:19230804-19230826 GAGGGAGTAAAATGAATGACTGG + Exonic
1081785476 11:45743823-45743845 AAGAGTATGAGATGCATGGCGGG + Intergenic
1083111116 11:60408247-60408269 GAGAGTGTAGAATACGTGGAAGG - Intronic
1087835630 11:102871968-102871990 GAGAGAGAAAAATGTATGGAAGG + Intronic
1088240593 11:107770162-107770184 GAGAGTGCAAAATGCAAATCTGG - Intergenic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1090019482 11:123114599-123114621 GTGAGTAGAAAATGCAGGGCTGG - Intronic
1092092587 12:5815206-5815228 GAGAGTGTAAAATGCATGGCAGG - Intronic
1095238066 12:39822469-39822491 GAGAAAGGAAAATGCGTGGCTGG - Intronic
1096583539 12:52603724-52603746 GAGAATTGAAAATGCATTGCTGG + Intergenic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1100391787 12:94150243-94150265 GAGAGTGTAAAAAGGGGGGCGGG + Intronic
1100551187 12:95647605-95647627 GAGAGTGTAGAATGCAGAGTAGG + Intergenic
1100975967 12:100122921-100122943 GAGAGGGTGAAAAGCATGCCAGG - Intronic
1103053931 12:117803775-117803797 GTGAGGATTAAATGCATGGCCGG - Intronic
1103346300 12:120252710-120252732 GAGAGGGTCAAATACAAGGCTGG + Intronic
1104464980 12:128983009-128983031 GAGAATGTATCATTCATGGCAGG + Exonic
1105657125 13:22453748-22453770 CAGAGTGCAAAGTGCCTGGCCGG + Intergenic
1110307913 13:74011700-74011722 GAGAATGTAAAGTGTATGGGAGG + Intronic
1111226758 13:85283742-85283764 GAGAATGGAAAAGGCATGGTAGG + Intergenic
1112941970 13:104874578-104874600 GAGAGTTTTAATTACATGGCAGG + Intergenic
1117075742 14:52102218-52102240 GAGAGGTTAAAGTGCATGGTTGG + Intergenic
1118163989 14:63317912-63317934 GATAGTGACAAATGCATGGTTGG - Intronic
1119084313 14:71725954-71725976 CAGAGTGCAAGAGGCATGGCGGG + Intronic
1121189379 14:92011548-92011570 GAGTGTCGAAAATGCATGACTGG - Intronic
1122046070 14:99024937-99024959 GAGAATGTGCAATGCATGGAGGG + Intergenic
1124915149 15:33963093-33963115 TATTGTGTAAAATGGATGGCAGG + Intronic
1125106480 15:35977480-35977502 GAAAGTGTAAAATGCATAGCAGG - Intergenic
1125151387 15:36536395-36536417 GAGAGAGTAAAATTCATTTCCGG - Intergenic
1127725272 15:61743635-61743657 GAGAGTGCTAAATGAATGGTGGG + Intergenic
1128018820 15:64372316-64372338 TAGAAAGTAAAATGCAGGGCTGG + Intronic
1128519666 15:68366999-68367021 CACAGTGGAAAATGCAAGGCTGG - Intronic
1131403492 15:92145119-92145141 GGGAGAGAAAAATGCATGGTGGG + Intronic
1132097073 15:98994670-98994692 GACAGTGTGAAATGCAAGGAGGG - Intronic
1133123924 16:3631817-3631839 GAGATTTTAAAATCCATGGCCGG - Intronic
1133622885 16:7543125-7543147 GAGTGATTTAAATGCATGGCGGG - Intronic
1134449232 16:14353769-14353791 GGGAGGGGAAAAGGCATGGCAGG + Intergenic
1135571213 16:23550731-23550753 AAGAGTATAAAATGGTTGGCCGG - Intronic
1137862949 16:51865173-51865195 AAGGTTGTAAAATGAATGGCTGG + Intergenic
1138783390 16:59815620-59815642 GAAAGTATAAAACTCATGGCTGG + Intergenic
1139272602 16:65698070-65698092 GAGAGTTTACCAGGCATGGCCGG + Intergenic
1140586327 16:76296894-76296916 GAGATTTAAAAATCCATGGCAGG + Intronic
1141398291 16:83724172-83724194 GTGAGTGATAAATGCATGGGTGG + Intronic
1141878736 16:86844294-86844316 CGGAGTGGAAAATGCATGGAAGG - Intergenic
1144573308 17:16414349-16414371 TAGAGTGTAATGTGCATGACAGG + Intergenic
1144957324 17:19025486-19025508 GAGAGAGAAAAATCCGTGGCTGG - Intronic
1144977833 17:19149031-19149053 GAGAGAGAAAAATCCGTGGCTGG + Intronic
1145003370 17:19321094-19321116 TAGAGTGGGAACTGCATGGCGGG + Intronic
1148531261 17:48394639-48394661 GAGAGTTAAACATGTATGGCAGG - Intronic
1150247179 17:63685303-63685325 GAGGGAGAAAAATGCTTGGCTGG - Intronic
1152350319 17:79780605-79780627 AAGAGTGTAAAACCCATGGGTGG + Intronic
1154370879 18:13762137-13762159 CAGAGGATAAACTGCATGGCAGG - Exonic
1155242365 18:23875891-23875913 GGGAGTGTGAGATGCATGGTGGG - Intronic
1160672157 19:370777-370799 GAGAGTCTCAGATGCAGGGCGGG + Intronic
1163521554 19:17794953-17794975 GAGAGGGGAAGAGGCATGGCCGG + Intronic
1163707741 19:18825572-18825594 AAGGGAATAAAATGCATGGCTGG - Intergenic
1165090766 19:33387384-33387406 GAGATTGAAGCATGCATGGCAGG - Exonic
1165396112 19:35564450-35564472 GAGAGTGTTGTAAGCATGGCAGG - Intergenic
1167074679 19:47241017-47241039 GAGACCGTAACGTGCATGGCTGG + Intergenic
930416257 2:51094252-51094274 GGGAGAGTAGTATGCATGGCTGG - Intergenic
930676354 2:54204921-54204943 AAGGATGTAAAATGAATGGCTGG - Intronic
930975115 2:57448859-57448881 GTGAGTGTAAAATAAATGTCTGG - Intergenic
932318259 2:70800892-70800914 GAGAGTGGAAAATGCTTGTCAGG + Intergenic
934942897 2:98515322-98515344 GAGAAAGTAAAATGAAAGGCTGG - Intronic
940603671 2:155892697-155892719 CAGAGTATAAAATCCAGGGCAGG - Intergenic
941274417 2:163472636-163472658 GAGACTGCAAAATGCATAGTGGG - Intergenic
941736610 2:168984048-168984070 GTGAGTGTAAAAGGCCTGACTGG + Intronic
943799023 2:192034597-192034619 GAGAGAGTAAAATGCTTGATTGG - Intronic
944121502 2:196245502-196245524 GAGACTGAAAAATACAGGGCTGG + Intronic
946876310 2:224133094-224133116 GAGAGTGTAACTTGCATCACAGG + Intergenic
947201688 2:227620058-227620080 GAAAATATAAAATGCAGGGCTGG + Intronic
1170312437 20:15007422-15007444 GAGAGTATATAATGTATGACAGG - Intronic
1174175143 20:48639857-48639879 AAGAGTGTACAATCCGTGGCCGG - Exonic
1175560803 20:59927966-59927988 GAAGGTGAAAAATGCAGGGCTGG + Intronic
1177145364 21:17401521-17401543 GTGAGTGTAAAAGGAAAGGCTGG + Intergenic
1179913367 21:44461487-44461509 GAGAGTGTAAACTGCATATGAGG + Exonic
1182099720 22:27649359-27649381 GAGAGGGTAGGATGCATGGATGG + Intergenic
949922372 3:9013323-9013345 GTGTATGAAAAATGCATGGCTGG - Exonic
950140517 3:10612000-10612022 GAGAGTGTAAAATGCGATGCTGG - Intronic
950849433 3:16048619-16048641 GAGAGTGTACAAAGGATGCCTGG - Intergenic
953951363 3:47192919-47192941 AAGTGTGTGAAATGCATGGGGGG - Intergenic
955954357 3:64273438-64273460 GAGAATTTAAAATGCATCGAGGG + Intronic
970681499 4:18513816-18513838 GAAAGGGCAAAATGCATGTCGGG + Intergenic
974419787 4:61658733-61658755 GAGGGTAGAAAAGGCATGGCAGG - Intronic
979470727 4:121093157-121093179 CAGTGTGGAAAATGGATGGCCGG + Intergenic
981125155 4:141097338-141097360 AAGTTTGCAAAATGCATGGCTGG - Intronic
986661119 5:10061081-10061103 TAGAGTTAGAAATGCATGGCTGG + Intergenic
988739563 5:34056804-34056826 TAGAATGTAAAAGTCATGGCCGG - Intronic
990293063 5:54374568-54374590 GAAAGTCTAGAAGGCATGGCTGG - Intergenic
990369761 5:55105377-55105399 CTGAGTGCAAAAAGCATGGCTGG + Intronic
990495205 5:56340534-56340556 GAGAGTTTATGGTGCATGGCAGG + Intergenic
992044957 5:72878407-72878429 GAGAAATTAAAATTCATGGCTGG - Intronic
1000406076 5:160889676-160889698 GAGAATGGAAAATGCAGGGCAGG + Intergenic
1001559708 5:172661046-172661068 GAGAGAGGAAAAGGCAAGGCTGG - Intronic
1002813554 6:657387-657409 GAGGTTGTAAAATGTATGCCTGG - Intronic
1003432834 6:6055900-6055922 GAGAAAATAAAAAGCATGGCAGG + Intergenic
1003451625 6:6239846-6239868 GAGAGGGAAAAATGCAGAGCAGG + Intronic
1003558487 6:7161700-7161722 GAGAGAGTAAAGAGCATGGATGG - Intronic
1004275381 6:14231075-14231097 GTGAGTGGAAAGTGCAGGGCAGG + Intergenic
1004764918 6:18715215-18715237 GAGAGTGTCAAATGAATGTCTGG - Intergenic
1010058490 6:71592461-71592483 GAGAGAGTCAAATTCTTGGCAGG + Intergenic
1010060844 6:71620877-71620899 GAGTGTGTACAGTGCATTGCAGG + Intergenic
1010266311 6:73872104-73872126 GGGAGCGTATAATGCATTGCAGG + Intergenic
1012139230 6:95601200-95601222 GAGAGTGTAAAAATCAGGGCTGG + Intronic
1012424261 6:99096708-99096730 GAGATTGAGAAATGCAAGGCTGG + Intergenic
1021239880 7:18187310-18187332 GAGAGTTTAAGAGGCATGTCTGG + Intronic
1021838121 7:24700824-24700846 GAGACTGTCAACAGCATGGCAGG + Intronic
1022176554 7:27876657-27876679 AAGAAAGTAAAAGGCATGGCTGG + Intronic
1022691033 7:32654775-32654797 GAGTGTATAAAATGCATGGAAGG + Intergenic
1022918600 7:34988668-34988690 GAGTGTATAAAATGCATGGAAGG + Intronic
1023169573 7:37377608-37377630 GAGAGTCTAAATTGAATGCCAGG - Intronic
1024593843 7:50915698-50915720 GCGAGTGTGAAATGCACAGCAGG + Intergenic
1028088320 7:86665631-86665653 AAGACTATAATATGCATGGCAGG - Intronic
1029335681 7:99897387-99897409 GAGAGTGTAAAATCCCAGGGAGG - Intronic
1029346377 7:99981475-99981497 GTGAGTTTAAAATTCATGCCGGG + Intergenic
1030124234 7:106139386-106139408 CAGAGTGGAAATTTCATGGCTGG - Intergenic
1032062005 7:128732696-128732718 GAGGGTGGAAAAAGCATTGCTGG - Intergenic
1032416844 7:131742223-131742245 GAGAGTGCAATATGCATGCCAGG - Intergenic
1032516805 7:132512526-132512548 TAGTGTGTAAAATGAAAGGCTGG - Intronic
1032621066 7:133532948-133532970 CAGGGTGAAAATTGCATGGCTGG + Intronic
1033995568 7:147342130-147342152 GAGAGTGTAGCCTTCATGGCAGG - Intronic
1034080894 7:148276768-148276790 CAGAGTGCAAAATGCATAACAGG + Intronic
1036420674 8:8592767-8592789 CAGAGTTGAAAAAGCATGGCAGG + Intergenic
1040910696 8:52515621-52515643 GATACTTTAAAATGCATGGTTGG - Intergenic
1040911257 8:52521465-52521487 GACAATATAAAATGCATTGCTGG + Intergenic
1045184134 8:99818902-99818924 GAAAATGTAAAATGTATGGAAGG - Intronic
1046396189 8:113642975-113642997 GAGAGTATACAATGCATGGCAGG + Intergenic
1048499891 8:134965875-134965897 GAGCTTGCAGAATGCATGGCAGG + Intergenic
1055212388 9:73812399-73812421 GAGTTTGTTAAATGGATGGCAGG - Intergenic
1056777430 9:89523812-89523834 GAGAGTGAAAACTGAAGGGCAGG + Intergenic
1057150314 9:92790853-92790875 AAAAGTGTAAAATGCTTGGTGGG + Intergenic
1059761465 9:117341663-117341685 GAAAGTGTAAAGTGCATAGGAGG + Intronic
1062027130 9:134345756-134345778 GTCAGTGCAAAATGCATGACGGG + Intronic
1186913883 X:14199207-14199229 CAGGATGTAAAATGCTTGGCTGG + Intergenic
1190212867 X:48461430-48461452 GAGGGGGTGATATGCATGGCTGG - Intronic
1193225573 X:78978671-78978693 CAGAATATAAAATTCATGGCTGG + Intergenic
1194117260 X:89918488-89918510 CAAAGTGTAAAATACCTGGCAGG + Intergenic
1198028626 X:132733212-132733234 GAGATTGGAAAATGCATGAGAGG - Intronic