ID: 1092094276

View in Genome Browser
Species Human (GRCh38)
Location 12:5828402-5828424
Sequence GGCTGGCGTCCCCGAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092094276_1092094278 -9 Left 1092094276 12:5828402-5828424 CCACCTGCTCGGGGACGCCAGCC 0: 1
1: 0
2: 2
3: 20
4: 201
Right 1092094278 12:5828416-5828438 ACGCCAGCCAGACCGTGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 79
1092094276_1092094282 14 Left 1092094276 12:5828402-5828424 CCACCTGCTCGGGGACGCCAGCC 0: 1
1: 0
2: 2
3: 20
4: 201
Right 1092094282 12:5828439-5828461 AAAGTGCTCTGCAACAGCAAAGG 0: 1
1: 0
2: 2
3: 19
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092094276 Original CRISPR GGCTGGCGTCCCCGAGCAGG TGG (reversed) Intronic
900097481 1:945908-945930 GGCTGGAGGCTCCGGGCAGGTGG - Intronic
900603779 1:3514969-3514991 GGCTGGAGTCACAGAGCTGGGGG - Intronic
900659242 1:3774602-3774624 GGGTGGCTGCCCAGAGCAGGAGG - Intronic
903678681 1:25082820-25082842 GGCTGGGGGCCAGGAGCAGGTGG + Intergenic
906184651 1:43852135-43852157 GGCTGGCTTCCCAGAGAAGCAGG - Intronic
906722732 1:48021009-48021031 GGCAGGCTTCCCAGAGAAGGTGG + Intergenic
907012720 1:50978180-50978202 GGCAGCGGTCCCCGAGGAGGCGG + Intergenic
915279644 1:154813820-154813842 GGCTGGCGTCTCCGATGGGGTGG - Intronic
915322586 1:155063877-155063899 GGCTGGAGCCCCCGCGCAGAGGG - Exonic
921646982 1:217630889-217630911 GGCTGGCGGCCCTGGGGAGGGGG - Intronic
922461039 1:225814610-225814632 GGCTGGTGACCGGGAGCAGGAGG + Intronic
922558286 1:226549241-226549263 TCCTGGCGTCCCCGGGCAGGTGG + Intronic
924205519 1:241707693-241707715 GGATGGCGTCCCAGAGCTGTGGG - Intronic
1065122594 10:22543780-22543802 GGCTGGCTTCACCGTGCGGGTGG - Intronic
1065342707 10:24722782-24722804 GGCCGGCGTCCCCGAGGAGGCGG + Intronic
1067462193 10:46466034-46466056 TGCTGGGGTCCCGGGGCAGGCGG - Intergenic
1067625003 10:47918564-47918586 TGCTGGGGTCCCGGGGCAGGCGG + Intergenic
1067705842 10:48605922-48605944 GGCTGGCATCACAGAGCAGCAGG - Intronic
1067836476 10:49644649-49644671 GGCTGGCTTCCCAGAGTAGAAGG + Intronic
1068029114 10:51685760-51685782 GGCTGGTCACCCCAAGCAGGAGG - Intronic
1069962578 10:72087506-72087528 GGCTGGGGTCCCCGTGCAGAAGG - Intronic
1071573108 10:86708726-86708748 AGCTGGCATCCCAGACCAGGGGG - Intronic
1074404103 10:113165774-113165796 GGGTGGCCTCAGCGAGCAGGAGG - Exonic
1075121802 10:119669899-119669921 GGGTGGCCTTCCCTAGCAGGCGG - Exonic
1076169861 10:128309961-128309983 GGCAGGCTTCCCAGAACAGGGGG + Intergenic
1077026501 11:442177-442199 GGCTGGAGTTCCCGGGAAGGGGG + Intergenic
1077356316 11:2120540-2120562 GGCTGGCCGGCCCCAGCAGGTGG - Intergenic
1077412735 11:2411044-2411066 GCTTGGCCTCCCCAAGCAGGAGG + Intronic
1077539527 11:3139984-3140006 GGCTGGCTTCTCAGAGCAGGGGG - Intronic
1081661210 11:44889506-44889528 GGCTGGCTGGCCCCAGCAGGAGG + Intronic
1083640877 11:64144637-64144659 GCTTGGCTTCCCCGAGGAGGAGG + Intronic
1083659783 11:64246718-64246740 GGCGGGCGTCCCGGAGGCGGTGG - Exonic
1084370487 11:68739031-68739053 GGCTGGCCTCCACGGGCTGGAGG + Intronic
1084717516 11:70883283-70883305 GGATGGCTTCCCAGAGGAGGAGG - Intronic
1085022467 11:73218187-73218209 GGGCGGCGTCCCGGAGCGGGTGG + Intergenic
1085454332 11:76657175-76657197 GGCTGGGGACCCCAAGGAGGAGG + Intergenic
1086821890 11:91445651-91445673 GGCTGGAGTCCCAGGGCAGTGGG - Intergenic
1088029126 11:105224663-105224685 GGCTGATGTCCCAGAGCAGGAGG - Intergenic
1088823374 11:113474944-113474966 GGCGGGCGCTCCCGAGCAGGCGG + Intronic
1089186141 11:116615880-116615902 GGCTAGGGTCACCTAGCAGGGGG + Intergenic
1092094276 12:5828402-5828424 GGCTGGCGTCCCCGAGCAGGTGG - Intronic
1097848573 12:64390219-64390241 GGCAGCCCTCCCCGCGCAGGAGG + Intronic
1101832656 12:108271471-108271493 GGATGGCTTCCCAGAGGAGGTGG - Intergenic
1103560218 12:121789689-121789711 GGCTGGGGTCACCCAGAAGGTGG - Intronic
1106758031 13:32841516-32841538 GGCTGGGGTCCCAGAACAGTGGG - Intergenic
1107046324 13:35996556-35996578 GGCTGACCTCCACAAGCAGGAGG + Intronic
1113928665 13:113954765-113954787 GGCTGGAGTCCTCCAGCTGGTGG + Intergenic
1114568658 14:23650343-23650365 GGCTGGGCTCGCCCAGCAGGAGG + Intergenic
1114736692 14:25049916-25049938 GGCACGCGTCCCAGAGCACGAGG + Exonic
1116426505 14:44798670-44798692 GGCCGGCCGCTCCGAGCAGGGGG - Intergenic
1122435040 14:101689411-101689433 GGCGGGCACCCCGGAGCAGGAGG - Intergenic
1122893010 14:104741714-104741736 GGCTGGCGACCCCACGGAGGGGG + Intronic
1122935328 14:104953191-104953213 GGCTGGCTCCCTCGGGCAGGGGG + Exonic
1128231294 15:66037200-66037222 GGATGCCTTCCCAGAGCAGGTGG - Intronic
1128514039 15:68331162-68331184 GGCGGGCGTCCCCGAGCAGCAGG + Intronic
1129410336 15:75347510-75347532 GGGTGGGGTCCCCGAGCTTGGGG - Intronic
1130053327 15:80502292-80502314 GGCTGGCTGCCCCGGACAGGAGG + Intronic
1132704768 16:1239034-1239056 GGCTGGGGTCCCAGGGGAGGTGG - Intergenic
1132746032 16:1436688-1436710 GGATGGCCTCCCCCAGCAGGTGG - Exonic
1132765212 16:1531043-1531065 GGCTGGTGCCCTCGAGCAGGAGG - Intronic
1132793559 16:1706885-1706907 GGGTGGGGTCCCGGGGCAGGCGG - Intronic
1134202447 16:12210214-12210236 TGCTGGGGTCTCAGAGCAGGAGG + Intronic
1135343237 16:21666386-21666408 GGCTGGGGTGTCCCAGCAGGAGG + Intergenic
1136288219 16:29256592-29256614 GGCTGGTGTGCCCGAGAAGCAGG - Intergenic
1136315978 16:29454960-29454982 GGAAGGCGTCCCAGAGGAGGCGG + Exonic
1136430555 16:30194302-30194324 GGAAGGCGTCCCAGAGGAGGCGG + Exonic
1137563677 16:49519984-49520006 GGAGGGCCTCCCCGAGGAGGTGG - Intronic
1137594067 16:49712307-49712329 GGCTCGCGTGCCTGAGCAGGTGG + Intronic
1138619186 16:58198007-58198029 GGCTCGCGGCCCCCAGGAGGCGG + Intergenic
1140128509 16:72137491-72137513 GGCTGGCCTCCCTGCGAAGGTGG + Intronic
1140662031 16:77197460-77197482 GGGTGGCCTCCCTGAGCAGATGG + Intronic
1140774291 16:78235858-78235880 GGCTGGTTTCCCCCAGCAGAGGG + Intronic
1142093895 16:88229359-88229381 GGCTGGTGTGCCCGAGAAGCAGG - Intergenic
1142120351 16:88383698-88383720 GGCGGGCGGCCCGGAGGAGGCGG - Intergenic
1142220283 16:88850937-88850959 GGCTGGCGTCTGGGAACAGGAGG - Intronic
1142517416 17:441697-441719 GGCTGGCGTGGCCCAGCAGCGGG - Exonic
1143107294 17:4536132-4536154 TCCCGGCGTCCCCCAGCAGGTGG - Exonic
1144786839 17:17836825-17836847 GGCGGGCCTCCCGGAGGAGGCGG - Exonic
1145890202 17:28408773-28408795 AGCTGGAGTCCCAGAGCATGTGG + Intergenic
1146652400 17:34614750-34614772 GGCTGGTGTCCCTGGGCTGGAGG - Intronic
1151343023 17:73484101-73484123 GGCTTTCCTCCCCGAGCCGGAGG - Intronic
1151697175 17:75723664-75723686 GGCTGGGGTCCCCGAGGTGCTGG - Intronic
1151983819 17:77529273-77529295 GGCTGGCGTGGCCCGGCAGGAGG + Intergenic
1152008598 17:77697199-77697221 CACTGGCGTCCCCAAGAAGGTGG + Intergenic
1152461883 17:80445924-80445946 TGCTGGTGTCCCCTGGCAGGAGG - Intergenic
1152503091 17:80726137-80726159 AGCAGGCTTCCCAGAGCAGGCGG + Intronic
1152701452 17:81821862-81821884 GGCTGGCCTCCCCGGGGAGGAGG - Intergenic
1152870835 17:82752217-82752239 CGCGGGCGGCCCCGAGGAGGAGG + Exonic
1155582781 18:27329469-27329491 AGCTGGGGTCTCCGATCAGGTGG + Intergenic
1160119978 18:76121676-76121698 GACTGGCCTCTCCGAGCAAGGGG - Intergenic
1160663835 19:313605-313627 CGCTGGGGTCCCAGAGCAGCTGG + Exonic
1162575163 19:11495076-11495098 GGCTGGCATCTCGGAGCAGGTGG - Intronic
1162762554 19:12897213-12897235 GGAAGGCGTCCTGGAGCAGGGGG + Intronic
1162773694 19:12965805-12965827 GGAAGGCCTCCCCGAGTAGGTGG - Intronic
1163640931 19:18461574-18461596 GGATGGCCTCCTCCAGCAGGTGG - Exonic
1165141062 19:33700141-33700163 GGCTGCTTTCCCCGGGCAGGTGG + Intronic
1165354611 19:35295869-35295891 GGCTGACGTTGCTGAGCAGGAGG - Exonic
1166334223 19:42095756-42095778 GGCTGGGGTTCCCGCGTAGGGGG - Intronic
1167100034 19:47399055-47399077 GGTTGGCATCTCAGAGCAGGAGG - Intergenic
1167117814 19:47498253-47498275 GCCTGGCTTCCCCAAGCAGGTGG - Intronic
1167506052 19:49871658-49871680 GGCTGGGGGCACTGAGCAGGTGG + Exonic
927943140 2:27118457-27118479 GGCTGTCGTCCGCTTGCAGGTGG - Intronic
929559356 2:42946074-42946096 GGCTGGCGTCCTCAGTCAGGGGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
933183336 2:79251591-79251613 GGCTGGCTTCCCCGAGAGTGAGG - Intronic
934664126 2:96158224-96158246 GGCTGGCCTCCCAGCACAGGGGG + Intergenic
934666403 2:96174326-96174348 GACTGGCCTCCAGGAGCAGGAGG + Intergenic
934966796 2:98730926-98730948 GGCTGGCGGCCCCGGGCTGCGGG - Intronic
935090417 2:99890558-99890580 GGCAGGAGCCCCGGAGCAGGAGG + Intronic
935600401 2:104916576-104916598 GTTTGACGTCCCCCAGCAGGAGG + Intergenic
938081807 2:128374197-128374219 GCCTGGCCTCCCCTAGCAGTGGG + Intergenic
938119932 2:128626167-128626189 GGCTGGTCTCCCTGAGCAGAGGG + Intergenic
938289351 2:130141228-130141250 AGCTGACGTCCCCCAGAAGGCGG - Exonic
942763694 2:179429247-179429269 GCCTGGCATCCCCAAACAGGTGG - Intergenic
943692287 2:190881187-190881209 TGCCGGCGTCCCCGAGGCGGGGG + Exonic
945241577 2:207681523-207681545 GGCGGGCGTCCCGGAGGCGGCGG + Intergenic
945357535 2:208857418-208857440 GGCTGGCGTCCCGGGTTAGGAGG + Intergenic
946026167 2:216673209-216673231 GGCTGGCCTCCCCTAGAGGGTGG - Exonic
946039094 2:216768775-216768797 GCCTGGCTTCCCAGAGGAGGTGG + Intergenic
947637828 2:231689004-231689026 GGCCGGCGGCCGGGAGCAGGAGG + Intergenic
1168961265 20:1871574-1871596 GGCTGGCTTCCCAAAGGAGGAGG - Intergenic
1173252406 20:41371133-41371155 GGCTGTGGTCCCTGTGCAGGAGG - Intergenic
1173613618 20:44388744-44388766 GGAGGGCGTCCCGGAGGAGGCGG - Intronic
1173861661 20:46287817-46287839 TGCTGGGGTCCCCCATCAGGTGG + Intronic
1175144540 20:56885741-56885763 GGCTGCCTTCCGCGACCAGGAGG - Intergenic
1175715132 20:61250501-61250523 GACTGGGGTCCAGGAGCAGGTGG - Intergenic
1176029718 20:63006082-63006104 GGAGGGCGTCCCGGAGAAGGCGG + Exonic
1176242710 20:64082531-64082553 AGCTGGAGCCCCCTAGCAGGAGG + Intronic
1176363737 21:6020004-6020026 GGCAGGGGTCCCCGAGGAGAAGG - Intergenic
1178610348 21:34073884-34073906 GGCGGGCGTCCGCGGGAAGGGGG + Intronic
1179759781 21:43518541-43518563 GGCAGGGGTCCCCGAGGAGAAGG + Intergenic
1181026787 22:20131631-20131653 GGCTGGGGTCCCCGAGGCCGCGG + Intronic
1181455400 22:23057477-23057499 GGCTGGAGTCCCAGATCTGGGGG + Intergenic
1181634911 22:24170017-24170039 GCCTGGCGTCGCCCAGCAGCAGG - Intronic
1182015048 22:27032450-27032472 GGCTGGCGTCGGTGGGCAGGAGG - Intergenic
1182406635 22:30139021-30139043 GACTGGCCTCCCTGAGCGGGAGG + Intronic
1183293773 22:37018477-37018499 GGCTGGCTTCGCCGAGTATGTGG - Exonic
1183456421 22:37925648-37925670 GGCTGGTGTCCTGGAGGAGGGGG - Exonic
1183504333 22:38200897-38200919 GGCTGGAGTCCAGGAGAAGGAGG + Intronic
1184429677 22:44434598-44434620 GGCTGGGGACCCCGAGGATGGGG + Intergenic
1185191185 22:49437578-49437600 GGCAGCTGTGCCCGAGCAGGTGG - Intronic
949339075 3:3009216-3009238 GGCTGGCCTCCCAGAGAAAGAGG - Intronic
953414677 3:42708883-42708905 GGCTGGCTTCCCGGAGCAGATGG + Exonic
954106113 3:48410624-48410646 GGCTGGTGTCCCTGTGGAGGAGG - Intronic
954130476 3:48558243-48558265 GGCTGGGGATCCCGAGGAGGCGG - Intronic
963133066 3:141876353-141876375 GGCGGGCGTCCCCGCGCCGCAGG - Intronic
964445148 3:156750628-156750650 GGTTTGAGTCTCCGAGCAGGAGG + Intergenic
967261947 3:187651118-187651140 AGCTGTCATCCCAGAGCAGGGGG - Intergenic
968051796 3:195659403-195659425 GGAGGGCGTCCACAAGCAGGAGG + Intergenic
968104018 3:195988932-195988954 GGAGGGCGTCCACAAGCAGGAGG - Intergenic
968302321 3:197626521-197626543 GGAGGGCGTCCACAAGCAGGAGG - Intergenic
968585437 4:1414206-1414228 TGCGGGCGGCCCCAAGCAGGCGG - Intergenic
968591115 4:1460105-1460127 GGCTGGGGTCCTGGAGGAGGTGG + Intergenic
968965324 4:3766490-3766512 GGCGGGCGCGCCCGAGCAGCAGG + Exonic
969657242 4:8505371-8505393 TGCTGGCCTCCCAGGGCAGGAGG - Intergenic
969864878 4:10068670-10068692 GGCAGGCTTCCTGGAGCAGGAGG - Intergenic
970194625 4:13542406-13542428 GGCAGGCGTCGCGGAGGAGGAGG - Exonic
972076979 4:35101891-35101913 GGCTGGCTTCCCTCAGCAGGCGG - Intergenic
976970515 4:91096385-91096407 GGCTGGCTTCCCTCGGCAGGTGG + Intronic
977002339 4:91519397-91519419 GGCTGGTGTCCCAGACCAGTGGG + Intronic
977662790 4:99610118-99610140 GGCTGTAGTCTCCCAGCAGGTGG + Intronic
978751529 4:112253552-112253574 GGTTGGCCTGCCCCAGCAGGGGG + Intronic
980694425 4:136337201-136337223 GGCTGGGGTCCCAGGTCAGGAGG - Intergenic
980963870 4:139501934-139501956 AGGTGGCATCCCAGAGCAGGCGG + Intronic
985596072 5:788798-788820 GGATGGCGTCGCAGAGCAGAGGG + Intergenic
985757984 5:1730540-1730562 GGCTGGTGCTCCCCAGCAGGCGG + Intergenic
989202765 5:38781620-38781642 GGGTGGCTTCCTCGAGGAGGTGG + Intergenic
991772053 5:70049712-70049734 TGGCGGCGTCCCGGAGCAGGAGG + Exonic
991851346 5:70925130-70925152 TGGCGGCGTCCCGGAGCAGGAGG + Exonic
998833421 5:146182568-146182590 GCCTGGCATCCCCGAGAGGGAGG - Exonic
998872279 5:146564471-146564493 GGCTGGCCTCACTGAGCAGGAGG + Intergenic
999174039 5:149619079-149619101 GGCTGGGTTCCCCTGGCAGGAGG + Intronic
1000994585 5:167946026-167946048 GGCTGGCTTCACAGGGCAGGTGG - Intronic
1003171737 6:3725921-3725943 GCCAGGCATCCCGGAGCAGGTGG + Intronic
1005182817 6:23125856-23125878 GGCTGGCAGCACCTAGCAGGAGG - Intergenic
1006646660 6:35519656-35519678 GGCTGGAGCCTCCAAGCAGGGGG - Intergenic
1007239013 6:40411725-40411747 GGCAGGCCTCACCGAGAAGGTGG - Intronic
1007495756 6:42259501-42259523 GGGTGGGGTCCAGGAGCAGGTGG + Exonic
1007784565 6:44272303-44272325 GGCTGGGGTCCCTGAGCGGCAGG - Intronic
1009946687 6:70348390-70348412 GGCTGGAGTCCCAGGTCAGGAGG + Intergenic
1015526158 6:134176488-134176510 GGCTCACGTCCCCGCGCCGGCGG - Intronic
1018330955 6:162727398-162727420 GCCTGGCGTCCCCGTCGAGGCGG + Intronic
1018844640 6:167547242-167547264 GGCTGGAGTCCCCGAGTCGGTGG + Intergenic
1019425828 7:976079-976101 GGCTGGCGGCCCCCAGAAGCTGG - Intergenic
1019533003 7:1512978-1513000 GTGTGGCTTCCCCGTGCAGGTGG - Intergenic
1019994069 7:4711950-4711972 GGCAGGTGCCGCCGAGCAGGAGG + Intronic
1021196441 7:17679604-17679626 GGCTGGCCTAGCAGAGCAGGTGG + Intergenic
1021818078 7:24467549-24467571 GGCTGGCTTCTCTGAGCAGGCGG + Intergenic
1022427274 7:30281402-30281424 GGCTGTGGTCCCCGACCAAGAGG + Intergenic
1023998674 7:45177308-45177330 GGTGGGTGTCCCAGAGCAGGCGG + Exonic
1026740521 7:72975922-72975944 GGCAGGCTTCCCAGAGGAGGCGG + Intergenic
1026987253 7:74562267-74562289 GGCAGGTGTCCCAGGGCAGGTGG + Intronic
1027103211 7:75389149-75389171 GGCAGGCTTCCCAGAGGAGGCGG - Intergenic
1033583777 7:142759548-142759570 GGCTGTCAGCCCCAAGCAGGTGG + Intronic
1033585252 7:142770126-142770148 GGCTGTCAGCCCCAAGCAGGTGG + Intergenic
1034436278 7:151064231-151064253 GCCTGGGTTCCCCGAGCAGGAGG + Exonic
1034676658 7:152897047-152897069 GGCTGGGGGCTCCGAGGAGGTGG + Intergenic
1037810001 8:22081470-22081492 GGGGGCCGTCCCGGAGCAGGTGG - Exonic
1037963525 8:23116847-23116869 GGCAGGAGTCCCCGGGCTGGTGG - Exonic
1037963536 8:23116892-23116914 GGCAGGAGTCCCCGGGCTGGTGG - Exonic
1040838587 8:51759317-51759339 GGCTGGCCTGCCAGAGAAGGTGG - Intronic
1045036154 8:98178029-98178051 GGCTGGGGTCACGGGGCAGGGGG + Intergenic
1048485477 8:134843945-134843967 CTCTGGGGTCCCCCAGCAGGAGG + Intergenic
1048993759 8:139776216-139776238 GCCTGGCGTCCCTGTGCAGGAGG - Intronic
1049235184 8:141508632-141508654 GGGTGGCTTCCCCGAGGAGGTGG - Intergenic
1049655163 8:143794001-143794023 GGCTGTGGCCCCCGACCAGGAGG + Intronic
1050017289 9:1247393-1247415 GGCTGGAGTTCCAAAGCAGGAGG + Intergenic
1050873922 9:10612710-10612732 GGCTGGCGGCGCCGCGCCGGAGG + Intronic
1053291491 9:36882379-36882401 GCCTAGCCTCCCCAAGCAGGGGG - Intronic
1054455227 9:65426985-65427007 GGCTGGCCTCCTCGGGCATGTGG - Intergenic
1055373539 9:75625096-75625118 GGCTGGAGTCCCAGATCAGGAGG + Intergenic
1057828188 9:98387099-98387121 GGCAGGCTTCCCAGAGGAGGTGG + Intronic
1060931967 9:127494828-127494850 GGCTGGAGTGCCCGAGTAGCTGG - Intronic
1061090059 9:128421243-128421265 GTCTGTCGTCTCCCAGCAGGGGG - Intronic
1061181677 9:129028237-129028259 GGCTGGTGCCCCGCAGCAGGTGG - Exonic
1061818272 9:133208775-133208797 GGCTGGGAGCCCTGAGCAGGGGG - Intronic
1061920885 9:133781757-133781779 GGACGGCGTCCCCCAGCAGAGGG + Intronic
1062147002 9:134995078-134995100 GGCTGGCATTCCCAAGCAAGAGG + Intergenic
1062242180 9:135546583-135546605 GGCTGGGAGCCCTGAGCAGGGGG + Intronic
1062395301 9:136350379-136350401 GGCGGGGGTCCCTGAGCAGAGGG + Intronic
1190527576 X:51343380-51343402 GGCTGACCTCCCTGAGCAAGGGG - Intergenic
1194201534 X:90958266-90958288 GGCTGGAGTCCCAGGTCAGGAGG - Intergenic
1198969568 X:142266553-142266575 GGCTGGCTTCCCTTGGCAGGTGG - Intergenic
1200547375 Y:4533721-4533743 GGCTGGAGTCCCAGGTCAGGAGG - Intergenic