ID: 1092094656

View in Genome Browser
Species Human (GRCh38)
Location 12:5831672-5831694
Sequence CAGCAGAGATGGATAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 484}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092094656 Original CRISPR CAGCAGAGATGGATAGGAGA TGG Intronic
900153907 1:1196314-1196336 CAGAAGAGACGGATAGCAAATGG - Intronic
900609697 1:3539313-3539335 CAGCAGAGATGCATGGGGGAGGG + Intronic
901355220 1:8640791-8640813 TACCAGAGATAGATGGGAGAAGG - Intronic
902044351 1:13513781-13513803 CAGCAGGGATGGAGAGGGGAGGG + Exonic
902250812 1:15153480-15153502 CAGCCGAGTTGGATAAGAGGGGG - Intronic
902705268 1:18199952-18199974 CAGGAGGGATGGGTAGGAGCGGG + Intronic
903268698 1:22174348-22174370 CAGGAGAGAGGGATGGAAGAAGG - Intergenic
903362098 1:22783301-22783323 CCCCAGACATGGATAGGAGAGGG + Intronic
903823597 1:26124502-26124524 CAGCAGAGATTCATAGATGATGG + Exonic
904262466 1:29297541-29297563 CCGCAGAGATGGGAAGGAAAGGG + Intronic
904320639 1:29695759-29695781 CAGCAGAGAGGGCTTGCAGAAGG + Intergenic
904394952 1:30213870-30213892 CTGCTGAGATGGGTAGGAAAAGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
906584073 1:46961242-46961264 AACCAGAGATGTTTAGGAGAGGG + Intergenic
907219749 1:52897580-52897602 GAGCAGAGATAGCTATGAGAAGG + Intronic
908366098 1:63425234-63425256 CAGCAGAGAAGGAAAGCTGATGG + Intronic
909409050 1:75328082-75328104 CAGCAGGGATGGAAAGCAGCTGG - Intronic
910328881 1:86045388-86045410 TAGCATACATTGATAGGAGAAGG + Intronic
910453605 1:87372313-87372335 CAGGAGAGAAGGAAAGGACAAGG - Intergenic
910689902 1:89955126-89955148 TAGCAGAGATGGGTCCGAGAGGG + Intergenic
912214367 1:107590784-107590806 CAGCAGAGAAGGATAGTGGCAGG - Intronic
912704121 1:111899342-111899364 AAGCAAAGATGGAAGGGAGAGGG - Intronic
913185281 1:116365052-116365074 CAGCAGAGAAGGGTAGGATTTGG + Intergenic
914699187 1:150115224-150115246 CAGCACAGACAGATAGCAGATGG - Intronic
915593598 1:156884123-156884145 CAGCTGAGATGGATAGCTGCTGG + Intergenic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915802238 1:158806786-158806808 GAGCAGAGATGGAAAGGTGTTGG - Intergenic
915876281 1:159614696-159614718 CAGCAGAGAGAGTTAGGAAAGGG + Intergenic
916115236 1:161480375-161480397 CAGCACAGAGGGATAGCAGAGGG - Intergenic
916175070 1:162031288-162031310 CAGCAGGGATGAATAGAAGCTGG + Intergenic
916683967 1:167127903-167127925 CAGCAGAGTTGGCAAAGAGATGG + Exonic
916693510 1:167213964-167213986 AAGCAGAGATGGCTTTGAGAAGG + Intergenic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917707554 1:177649413-177649435 GGGCAGGGATGGATGGGAGAGGG + Intergenic
917722219 1:177796682-177796704 CTTCAGAGAGGGACAGGAGAGGG - Intergenic
917921398 1:179753618-179753640 CTGGAGAGAAGGATAGGATAAGG + Intronic
918256030 1:182748264-182748286 AGGCAGAGATGGTTAGGAGAGGG - Intergenic
918796073 1:188898368-188898390 CAACAGAAATGGATAGGGGAAGG + Intergenic
919429889 1:197479452-197479474 CAAAAGAGATGGAGAGGGGATGG - Intergenic
920100732 1:203515564-203515586 TAGCAGAGTTGGATGGGAGAAGG + Intergenic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
920931991 1:210397679-210397701 GAGTAGAGATGGATGGGACAGGG + Intronic
921154681 1:212430025-212430047 CAGCGAAGGTAGATAGGAGAGGG + Intergenic
922034009 1:221830850-221830872 CAGGGGAGATGGATATGGGAAGG - Intergenic
922434770 1:225593118-225593140 CAGAAAAGATTGATAAGAGATGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
1062995017 10:1857654-1857676 CAGGAGATATGAATAGGAAAGGG + Intergenic
1063089401 10:2848821-2848843 AATCAGAGATGGAAGGGAGAGGG + Intergenic
1063380022 10:5578470-5578492 CAGCAGAGGTGCTTGGGAGACGG + Intergenic
1063854196 10:10228904-10228926 CAACAGAAATGGAGAGGGGAAGG + Intergenic
1064680461 10:17806512-17806534 CAGCAGAGAAAGAGAGAAGAAGG - Intergenic
1064745569 10:18475106-18475128 GAGGAGAGAGGGATGGGAGAGGG + Intronic
1065682416 10:28250257-28250279 CAGCAGAGAGGCGGAGGAGAGGG + Intronic
1066504810 10:36029951-36029973 CTGTAGAGATGGATAAGTGATGG + Intergenic
1066542091 10:36458425-36458447 AAGAAGAGAGGGGTAGGAGAAGG - Intergenic
1068621952 10:59195614-59195636 CAGGGGAGAAGGGTAGGAGAAGG + Intronic
1068646989 10:59479144-59479166 TAGCAGAGATGGAAAGGATTTGG - Intergenic
1068957583 10:62832954-62832976 CAGAAAAGATGAAGAGGAGATGG + Intronic
1069706263 10:70460575-70460597 CAGAAGAGATGGGGAGGAGCAGG - Intergenic
1070726704 10:78796798-78796820 CAGCAGTGATGGACAGAAGGAGG + Intergenic
1071901437 10:90124485-90124507 TGGCAGAGAAGGATAGGAGAAGG - Intergenic
1072089212 10:92110574-92110596 CAACAGAGCAGGAGAGGAGAAGG - Intronic
1072763788 10:98080058-98080080 ATGTAGAGATGAATAGGAGAGGG + Intergenic
1073113142 10:101074510-101074532 CAGCGGGGATGGAAAGGAGAGGG + Intergenic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073324925 10:102637106-102637128 CAGCAGAGTGGGAGAAGAGAAGG + Intergenic
1073333865 10:102689975-102689997 GAGCAGAGATGGAAAAGACAGGG + Intronic
1073429036 10:103474328-103474350 GAGAAGAGATGGATAGATGATGG - Intronic
1073438577 10:103537882-103537904 CAGCAGGGAGGAGTAGGAGAGGG - Intronic
1074425588 10:113348410-113348432 AAGCAGAGATAGTAAGGAGAGGG + Intergenic
1076436398 10:130447081-130447103 AAGCAAAGATGGAAAGAAGAGGG - Intergenic
1076474042 10:130740086-130740108 GAGCAGAGAGGGATAAGGGAAGG + Intergenic
1078148444 11:8738590-8738612 CAGCAGGGATGGGGAGGAGGGGG - Intronic
1080052439 11:27871064-27871086 TAGCACAGAGGGATAGGAAAGGG - Intergenic
1080819210 11:35789124-35789146 CAGCAGAGACAGGTAGGAGGAGG - Intronic
1080923079 11:36728289-36728311 GAGCTGAGATGGTTATGAGATGG - Intergenic
1081668301 11:44929289-44929311 CATCAGAGATGGCCAGGAGAAGG + Exonic
1083560761 11:63671361-63671383 CAGCAGGGGTGCAGAGGAGAGGG + Exonic
1083700869 11:64476979-64477001 CAGCAGAGGGGGGTAGGAGGCGG - Intergenic
1084858015 11:72001137-72001159 CAGCAGAGCAGGGTAGGGGAAGG + Intronic
1085017357 11:73183535-73183557 GAGGAGAGATGGGTAGGAGACGG - Intergenic
1085173051 11:74464963-74464985 CTGCAGAGATGAATTGGAGTTGG - Intronic
1085302268 11:75465769-75465791 CAGCAGAGAAGGTTCTGAGAGGG + Intronic
1086115630 11:83246550-83246572 GAGCAGAGAGAGACAGGAGAGGG + Intronic
1086500168 11:87444667-87444689 CAGCAGAGCTAAATAAGAGATGG - Intergenic
1088054237 11:105555833-105555855 CAGAAGAGATGCATAGGGCAAGG - Intergenic
1088230537 11:107669561-107669583 CCACAGAGATGGTTAGGACAGGG + Intergenic
1088311736 11:108467460-108467482 CAGCAGCGATTGGTAGGTGAAGG - Exonic
1088549854 11:111001666-111001688 CAGTAGAGCTGGAGAAGAGAAGG + Intergenic
1088920172 11:114254839-114254861 AGGCAGAGATGGCCAGGAGAGGG + Intergenic
1089015975 11:115165791-115165813 CAGCTTAGAGAGATAGGAGAAGG + Intergenic
1089472410 11:118731545-118731567 CAGCAAAGACAGATAGGAGTGGG + Intergenic
1089618712 11:119709923-119709945 GGGCAGAGATGGATAGGGAAGGG + Intronic
1089690575 11:120184545-120184567 CAGCAGAGGAGGAAAGGGGAGGG - Intronic
1089780448 11:120869937-120869959 CAGCAGAGATGGAAAAGATTTGG - Intronic
1090202886 11:124868689-124868711 CCGCAGAGAAGCATAGGAGATGG + Intronic
1090827868 11:130400570-130400592 CAGGAAAGATGGATGGGGGAAGG + Intergenic
1090949761 11:131463339-131463361 CAGCAGAGAGGCATGGGTGAGGG + Intronic
1090955549 11:131510397-131510419 CAGCATAGATGGAGAGTGGATGG + Intronic
1091206607 11:133825551-133825573 CAGCAGAGAATGTTTGGAGAAGG + Intergenic
1091632546 12:2172919-2172941 CAGCAGAGTTGGTGAGGAGCTGG + Intronic
1091923458 12:4324230-4324252 CAGTAGTGCTGGATAGGTGATGG - Intronic
1091980155 12:4858212-4858234 CAGGAGAGAGGGAAAGGAGCTGG + Intergenic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095352092 12:41225863-41225885 TAGCTCAGAAGGATAGGAGAAGG - Intronic
1098055208 12:66497724-66497746 CAGCAAAAATGGAGAGGAGCAGG + Intronic
1098204423 12:68093000-68093022 CAGCAGGGGTAGATAAGAGACGG + Intergenic
1099158376 12:79208558-79208580 CAGGAGAGAGGGATACGAGAAGG + Intronic
1101210447 12:102530211-102530233 AAGCAGTGATGGAGAGGAGGAGG - Intergenic
1101488682 12:105192223-105192245 CGGCAGAGATGAAAAGTAGATGG - Intronic
1102637300 12:114335665-114335687 CAGGAGAGATGGATGGGCCAGGG - Intergenic
1102689870 12:114751910-114751932 GAGAAGAGAAGGAAAGGAGAAGG - Intergenic
1102716814 12:114980927-114980949 AAGCAGAGATGGAGATGAAATGG + Intergenic
1102786018 12:115605532-115605554 CAGCAGAGAGGAAAAGGAAAAGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103918646 12:124388508-124388530 CAGCAGGGAGAGAGAGGAGAGGG + Intronic
1104114981 12:125740878-125740900 GAGCAGAGATGGGCAAGAGAGGG - Intergenic
1104258157 12:127157943-127157965 CAGCAAAGGGAGATAGGAGAGGG - Intergenic
1104513626 12:129403995-129404017 AATAAGAGATGGATAGGTGATGG + Intronic
1105042652 12:132972698-132972720 AAGCAGAAATGGAGAGGAGGAGG - Intergenic
1106524451 13:30527629-30527651 AAAAAGAGATGGAGAGGAGATGG + Intronic
1106571944 13:30935073-30935095 CTGCAGGGATGGATGGGTGAAGG - Intronic
1106579160 13:31002995-31003017 GGGGAGAGAAGGATAGGAGATGG - Intergenic
1107416160 13:40202592-40202614 AGGCAGAGATGGATGGGAAAGGG + Intergenic
1107835889 13:44412367-44412389 AAGCAGGGAGGGAAAGGAGAAGG - Intergenic
1108024090 13:46160644-46160666 CAGCAGTGATGCACAGGAAAAGG - Intronic
1108527307 13:51296857-51296879 CAGCAGAAAGAGAGAGGAGAGGG + Intergenic
1108950247 13:56083649-56083671 CAGGAGAGAAGGGCAGGAGAAGG - Intergenic
1109169947 13:59082920-59082942 AAGCAGTGAGGGATAAGAGATGG + Intergenic
1109569753 13:64172217-64172239 CATCAGACATGCATAGAAGAAGG + Intergenic
1110695734 13:78486212-78486234 CAGCAGATGAGAATAGGAGACGG + Intergenic
1110842786 13:80161945-80161967 GAGCAGAGATGGCTATGAGTGGG + Intergenic
1112015501 13:95328062-95328084 CAGCAGAGATGGAAACAATACGG + Intergenic
1112228408 13:97564034-97564056 CAGCCCAGATGGCAAGGAGATGG - Intergenic
1112875430 13:104032498-104032520 GAGGAGAGAGGGATAGAAGAGGG + Intergenic
1113016205 13:105831025-105831047 AAGCTGAGAAGGATAGTAGAAGG - Intergenic
1113033181 13:106017056-106017078 TATCAGAGATGGAGAGGAGGTGG - Intergenic
1114598347 14:23933637-23933659 CAGCAGGGGTGGAAAGGAGATGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115571440 14:34670511-34670533 CAGCAGAGATCAAGAAGAGAGGG + Intergenic
1115785417 14:36820213-36820235 AAGCAGAGCTGAATGGGAGAAGG - Intronic
1116399482 14:44488176-44488198 CATCAGTGATGGATTGGATAAGG - Intergenic
1116994362 14:51306980-51307002 CAGCAGAGAGGGGAGGGAGAAGG - Intergenic
1117081540 14:52157114-52157136 CTGCAGAGATGGTGATGAGATGG - Intergenic
1117093451 14:52272928-52272950 GAGCAGGGATGGATGAGAGAGGG - Intronic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1118731626 14:68670865-68670887 CAGCAGAGATGAGCAGGAGATGG - Intronic
1119929537 14:78531567-78531589 TGGCACAGATGGATAGCAGAAGG - Intronic
1120873628 14:89359829-89359851 GGGCAGAGGTGGATAAGAGAAGG + Intronic
1120901912 14:89582766-89582788 CAGGGGAGATGGCTGGGAGAAGG - Intronic
1121096479 14:91221103-91221125 GAGCAGAGATGGAGCAGAGAGGG - Intronic
1121310534 14:92933035-92933057 CAGCAAAGCTGGCTGGGAGATGG + Intronic
1121741768 14:96257734-96257756 CATCAGAGATAGCTAGGAGAGGG + Intronic
1121828058 14:97026979-97027001 CGGCAGAGATGGGTAGGAAAAGG - Intergenic
1122279182 14:100611068-100611090 CAGCGGAGAGGGCTGGGAGAGGG - Intergenic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125684650 15:41556783-41556805 AAGCAGAGAAGAATAGGAGGAGG + Intergenic
1126302164 15:47209698-47209720 CAGCAGACCTGGAGAGGCGACGG - Intronic
1126335635 15:47583694-47583716 GAGCAGACATGGATAGGAATGGG + Intronic
1127572742 15:60260268-60260290 CAGAAGAGGTGAAGAGGAGAAGG - Intergenic
1127966271 15:63924994-63925016 ATGCAGAGATGGATGGGAGCTGG + Intronic
1128468596 15:67933257-67933279 CAGGAGAGAAGGGTGGGAGAAGG - Intergenic
1129966166 15:79737737-79737759 GAGAAGAGAGGGAAAGGAGAAGG - Intergenic
1130109490 15:80953042-80953064 AGTCAGAGATGGATAAGAGAAGG + Intronic
1130278610 15:82499147-82499169 AAACAGAGATGGGTGGGAGACGG + Intergenic
1130354582 15:83117710-83117732 CAGCTGTGATAGAGAGGAGATGG + Intronic
1130545480 15:84855117-84855139 GAGCAGACAAGGAGAGGAGATGG - Intronic
1131151816 15:90052029-90052051 CAGCAGAGGTGGGGAGGAAATGG - Intronic
1131442142 15:92467270-92467292 CAACAGAGATGGACGAGAGAGGG - Exonic
1132195213 15:99909619-99909641 CAGCACAGGTGGAAAGGAAAAGG - Intergenic
1132209248 15:100008092-100008114 AAGCAGGGATGGATGGGTGAAGG + Intronic
1132271337 15:100528687-100528709 TAACAGAGAGGGAGAGGAGATGG - Intronic
1132426080 15:101718441-101718463 CAGCAGAGGTGGAAGGGATAGGG + Intronic
1132667573 16:1089215-1089237 GAGCAGGGCTGGATGGGAGATGG - Intergenic
1134835380 16:17356568-17356590 AAGCAGAGATGCCAAGGAGAGGG + Intronic
1137571494 16:49569117-49569139 TAGCAGAGGTGGAAAGGAGAGGG - Intronic
1137744030 16:50807820-50807842 AAGCAGAGGTGGATGGGAGGGGG - Intergenic
1138391104 16:56670342-56670364 CAGCATGAATGGAGAGGAGATGG + Intronic
1138738611 16:59280813-59280835 CAGCAGTGATGGACAGGCCAAGG - Intergenic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1140769651 16:78191600-78191622 CAGCAATCATGTATAGGAGAGGG - Intronic
1141346032 16:83246940-83246962 CAGTAGAGATGGATACGCAAAGG - Intronic
1141430909 16:83969694-83969716 CAGCAGAGAGTGCTAGGAGGAGG + Intronic
1141630351 16:85284280-85284302 CAGCAGAGAAGGATCAGACAGGG + Intergenic
1141842860 16:86585313-86585335 TGGAAGAGGTGGATAGGAGATGG - Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1141921419 16:87138230-87138252 CAGCAGCCATGGATGGGAGTTGG - Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143130041 17:4672317-4672339 CAGCAGTGATGAAGAGGAGGAGG - Exonic
1143175249 17:4951389-4951411 CAGCAGGGATGGATAGAAAAGGG + Intronic
1144211202 17:13017291-13017313 TAGCAGAGGTGGAGAGGAGTGGG + Intronic
1144362110 17:14505424-14505446 CAGCAGAGAAGGGTAAGACATGG - Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1146457511 17:33018976-33018998 CAACAGAGATGGTGGGGAGAAGG + Intronic
1146706148 17:35002094-35002116 CAGCAAAGATGGTAAGGATAGGG + Exonic
1146932304 17:36786075-36786097 AAGAAGAAATGGATATGAGAAGG + Intergenic
1147586248 17:41655359-41655381 CAGCAGAGAAAGAGAGCAGAGGG - Intergenic
1148806478 17:50266557-50266579 CAGCAGGGATGGGGATGAGATGG - Intergenic
1150042109 17:61874215-61874237 CAGGAAAGATGCAGAGGAGATGG - Intronic
1150983377 17:70169037-70169059 CGGCAGAGAGGGAGTGGAGAGGG + Intronic
1151328774 17:73394600-73394622 CAGCAGAGAGGGCTGGCAGAGGG + Intronic
1153404572 18:4722221-4722243 CAGGAGTGATGGAAAGGTGAGGG + Intergenic
1153442790 18:5139451-5139473 CAACAATAATGGATAGGAGATGG - Intergenic
1154026865 18:10716191-10716213 CAGCAGAGGTGGAGGAGAGAAGG - Intronic
1155049709 18:22135925-22135947 CAGCAGAGATAGAGATGGGATGG + Intergenic
1155236200 18:23821866-23821888 CAGAAGAGAAGGAAAGGAGAGGG - Intronic
1155844457 18:30688033-30688055 TAGCTGAGATGGAAAGAAGATGG - Intergenic
1156457350 18:37302246-37302268 CAGCAGGAGAGGATAGGAGAAGG - Intronic
1156635504 18:39023597-39023619 TTGCACAGATGGAGAGGAGAAGG + Intergenic
1157473612 18:48008023-48008045 CGGCCGAGATGGACTGGAGAGGG - Intergenic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1158049710 18:53201937-53201959 CAGTAGAGATGGATTGGAATGGG + Intronic
1158862080 18:61602543-61602565 CAGAAGAGAAGGGTAGGAGAAGG - Intergenic
1159619257 18:70618772-70618794 AAGCAGAGATGGATTGGGGAAGG + Intergenic
1159995548 18:74960766-74960788 CTGCATGGAGGGATAGGAGAAGG + Intronic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1161347207 19:3774356-3774378 CCCTAGAGATGGAAAGGAGAGGG + Intergenic
1161470793 19:4455998-4456020 CTGCAGTGGTGGACAGGAGAAGG - Intronic
1161597382 19:5157527-5157549 CAGCAGACATGGAGAAGAGGAGG - Intergenic
1163071312 19:14844468-14844490 AAGAAGAGAGGGATGGGAGATGG + Intergenic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163560953 19:18019133-18019155 CAGAACAGAGAGATAGGAGAGGG - Intergenic
1163831307 19:19548351-19548373 CAGCAGGGATGGGGAGGAGCTGG - Intergenic
1164004328 19:21134883-21134905 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
1164292272 19:23879381-23879403 GAGGAGAGAAGGAGAGGAGATGG + Intergenic
1164990555 19:32679492-32679514 GGGCAGAGGTGGATAGCAGAAGG + Intergenic
1165070851 19:33254137-33254159 CAGCAGCGGTGGCTGGGAGAGGG + Intergenic
1165422986 19:35731661-35731683 CAGCAGAGGCAGAGAGGAGATGG + Intronic
1166142966 19:40815232-40815254 GAGAAGAGATGGAGAGGAAAAGG - Intronic
1167224158 19:48225708-48225730 GAGAAGAGAGTGATAGGAGATGG + Intronic
1167250840 19:48397703-48397725 CAGCAGAGACGGGGAGAAGACGG - Intronic
925159728 2:1675682-1675704 TAGAAGAGATGGACAGGAGCAGG - Intronic
925641113 2:5986661-5986683 CAGCAGACACGGGTGGGAGAGGG - Intergenic
925884992 2:8387731-8387753 CTGCAGTGATGGATAGGGGTTGG + Intergenic
925988279 2:9233521-9233543 ATGCAGAGATGGATAAGAAATGG + Intronic
926634126 2:15162658-15162680 CAGCAGCGGTAGATACGAGAAGG - Intergenic
928198278 2:29230344-29230366 CAGAACTGATGGATAGGAAAGGG + Intronic
929284839 2:40124029-40124051 GAGGAGATTTGGATAGGAGATGG - Intronic
929301176 2:40305132-40305154 CAGCAAAGATGAATAGGACAAGG - Intronic
929912645 2:46103876-46103898 TGGCAGAGATGGAAAGGAGGAGG + Intronic
930109730 2:47668245-47668267 CAGCAGAGTTGGCTAGAAGGTGG + Intergenic
931429368 2:62196603-62196625 CAGCCCAGAGGGAGAGGAGAGGG + Intronic
933288454 2:80409508-80409530 CAGCAGAAAGTGAGAGGAGATGG + Intronic
933608869 2:84413531-84413553 CAGCAAAGAAGGCTAGGAGCAGG + Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933811154 2:86033532-86033554 AAGCTGAGATAGGTAGGAGATGG + Intronic
934656955 2:96121378-96121400 CTACAGAGATGGACAGGAGCAGG - Intergenic
935705105 2:105849797-105849819 AAGCAGAGATGGGTAGAACATGG + Intronic
936339951 2:111622383-111622405 CCCCACAGGTGGATAGGAGAAGG + Intergenic
937243943 2:120480262-120480284 CAGCAGAGAGGAAAAGGGGACGG - Intergenic
937472635 2:122187196-122187218 CCACAGAGATTGATAAGAGATGG - Intergenic
937758102 2:125565354-125565376 TAGCAGAGATAGTTTGGAGAAGG + Intergenic
937789629 2:125944528-125944550 AAGGTGAGATGGATAGCAGAAGG + Intergenic
939450478 2:142367192-142367214 CAGCAGAGAAAGAAAGGAGGAGG - Intergenic
940246846 2:151628300-151628322 CAGCAGAGCTGGATTTGGGAAGG - Intronic
940274702 2:151927143-151927165 AGGCAGAAATGGATAGGAGAAGG + Intronic
941018911 2:160387607-160387629 CAGCAGAGAGGGTGAGGAAAAGG + Intronic
941563384 2:167077551-167077573 CTGCAGAGATGGGTGGAAGATGG + Intronic
942033071 2:171982420-171982442 CAGCAGAGATGGAGAGGACAGGG - Intronic
942862026 2:180625682-180625704 CAGCAGAGAATGGTAGGAGGAGG - Intergenic
943567578 2:189534650-189534672 CAGAAGAGATTGATATGACAGGG + Intergenic
943635038 2:190297287-190297309 AAGCAAAGATGAATAAGAGAGGG + Intronic
943648658 2:190433347-190433369 CCGCTGAGCTGGATAGGTGAAGG + Intronic
945298903 2:208197780-208197802 CAGGGGAGAAGGGTAGGAGAAGG + Intergenic
945861925 2:215133563-215133585 CAGCAGAGATGGTTAGCAATAGG - Intronic
946521895 2:220474871-220474893 CAGCAGAGATGGCCATGAGGAGG - Intergenic
946540069 2:220674783-220674805 CAGTACAGATGAAAAGGAGAGGG + Intergenic
946636262 2:221730865-221730887 CAGCAAAGATGAAAAGCAGAAGG + Intergenic
947836733 2:233181117-233181139 CAGGAGAGAAGGATGGGAGTGGG - Intronic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
1169041689 20:2500715-2500737 CAGCAGGCAGGGATTGGAGAAGG + Exonic
1169811178 20:9610889-9610911 CAGAAGAGATGGAGGGGAAATGG - Intronic
1170418143 20:16166381-16166403 CAGCACAGATGGAGAAGATAGGG - Intergenic
1170602804 20:17854504-17854526 CAGCAGAGAAGGATGAGGGATGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171436960 20:25131392-25131414 CAGAAGAGAGGGAAAGGAGGAGG + Intergenic
1172164966 20:32893455-32893477 CAGCACAGAGGGAGAGGCGATGG + Intronic
1172350909 20:34239805-34239827 CAGAAGAGTGGGATAGGGGATGG - Intronic
1172736908 20:37133410-37133432 CTTCAGAGATGGAGAGGAGGAGG - Intronic
1173113548 20:40218558-40218580 AAGCAGAGAGGGAGGGGAGAAGG - Intergenic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173565449 20:44035277-44035299 CAGCAGGGATGGACAGCAAAAGG - Intronic
1173633720 20:44536445-44536467 CAGCGGAAAGGGAAAGGAGAGGG + Intronic
1173908655 20:46647612-46647634 CAGCAGGGATGAAAAGGAGTGGG - Intronic
1174539073 20:51275141-51275163 GAGAAGAGAAGGATGGGAGAGGG - Intergenic
1175311970 20:58018511-58018533 CAGCAAATATGGAAGGGAGAGGG + Intergenic
1175357148 20:58377334-58377356 CAGCAGAGATGGATCAGTCATGG + Intergenic
1175631471 20:60541574-60541596 CAGCAGAAATGCAAAAGAGATGG - Intergenic
1175768274 20:61606189-61606211 CAGCAGATGTGGATAGAAGGTGG + Intronic
1175925389 20:62468822-62468844 CAGCAGAGCTGGGAGGGAGATGG + Intronic
1176669783 21:9722473-9722495 CAGGGGAGAGGGATGGGAGAAGG - Intergenic
1177968909 21:27763324-27763346 AAGCAGAGAGGGCTATGAGAGGG + Intergenic
1179459364 21:41523349-41523371 CAGCCGAGGTGGATAACAGAGGG - Intronic
1179464061 21:41559789-41559811 CAGAAGAAATGAAGAGGAGAAGG + Intergenic
1179489868 21:41734294-41734316 CAGGAAAGATGGAAAGGAAAAGG + Intergenic
1179504394 21:41831201-41831223 CAGCAGAGAGGGACAGGCGCAGG - Intronic
1181864107 22:25841655-25841677 CAGCAGAGAGTGCTAGGAGCCGG + Intronic
1182672249 22:32006079-32006101 CAGGTGAGTTGGGTAGGAGATGG - Intergenic
1182994587 22:34800813-34800835 CAACAGTGAGGGAGAGGAGAAGG + Intergenic
1183294781 22:37023047-37023069 CAGGAAAGATAGAGAGGAGAGGG + Exonic
1183647529 22:39135013-39135035 CAGCAGAGAAGCATACAAGAAGG + Intronic
1184041891 22:41949282-41949304 CAGAAGAGATGGATGGGAGGAGG + Intergenic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
949152069 3:781362-781384 CAGGGGAGAAGGATGGGAGAAGG - Intergenic
950151980 3:10694838-10694860 CAGCAGAGAGGGAGGGGGGAAGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950636140 3:14316308-14316330 CAGCATAGATGTAGAGGGGATGG + Intergenic
951775587 3:26307073-26307095 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
951844775 3:27073493-27073515 CAGCAGACCAGGAAAGGAGAAGG + Intergenic
952655244 3:35778269-35778291 CAGGAGAGATGGATAGAGAATGG - Intronic
952873092 3:37919689-37919711 CAGCAGAGATGGAATGGGAAAGG + Intronic
954938949 3:54353423-54353445 CAGCAGATATGGGTATAAGAAGG + Intronic
956160384 3:66345441-66345463 GGGCAGAGAAGGAAAGGAGAGGG - Intronic
956324570 3:68037152-68037174 AGGCAGAGAAGGGTAGGAGAAGG + Intronic
956487286 3:69736333-69736355 CTTCAGAGATGGATAGGCAAGGG - Intergenic
956506731 3:69948594-69948616 AAGAAGAGGTGGATACGAGAAGG + Intronic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
958833510 3:99117355-99117377 GGGCAGAGATGGGTAAGAGAGGG - Intergenic
961033996 3:123629647-123629669 CAGCAGGTGTGGCTAGGAGAGGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961636234 3:128334888-128334910 CAGCAGAGAAGGCTGGGAGGTGG - Intronic
963135249 3:141897211-141897233 CACCAAAGATGGAGAGGAGGAGG - Intronic
963836997 3:150067898-150067920 CGGCAGAGGTGGAAAGGAGTGGG + Intergenic
964300766 3:155282879-155282901 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
965333217 3:167402981-167403003 AAGAACAGAAGGATAGGAGAGGG + Intergenic
965653526 3:170959390-170959412 CACCAGCCATGGAAAGGAGAAGG - Intergenic
967815818 3:193797356-193797378 CAGCAAGAATGGAGAGGAGATGG + Intergenic
968356137 3:198109052-198109074 CAGCAGAGGGGGAGACGAGAAGG + Intergenic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969424852 4:7118201-7118223 ATGGAGAGATGGATGGGAGATGG + Intergenic
969664478 4:8549242-8549264 CATCAGGGCTGGACAGGAGAAGG + Intergenic
971502124 4:27328726-27328748 AAACTGATATGGATAGGAGACGG - Intergenic
971787858 4:31128447-31128469 TAGAAGAGATGAATAGCAGAAGG - Intronic
973636251 4:52863680-52863702 CAGCAGAGAAGGAGAGGGGTGGG - Intronic
973916244 4:55636974-55636996 CAGCAGAAATGCATAGAAAAAGG - Intergenic
975473869 4:74799331-74799353 CAGCAAAGCTGGAGAAGAGAGGG + Intergenic
975910513 4:79260587-79260609 CAGCAGAGATGGAAATCAGCTGG - Intronic
976073135 4:81264921-81264943 AAGTAGAGTTAGATAGGAGAGGG - Intergenic
976590424 4:86844415-86844437 CAGCGGACATGGATAAGGGAGGG - Intronic
976668498 4:87626229-87626251 CAGCAGGGAAAGACAGGAGATGG - Intergenic
978079762 4:104577954-104577976 GATCAGAGATGGATCAGAGATGG - Intergenic
978191201 4:105914693-105914715 CAGCAGTGATGGAGTGGTGATGG + Intronic
978255577 4:106688960-106688982 AAGCAGAGATAGCTAGGAGGAGG - Intergenic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978742457 4:112152605-112152627 CAACAGAGACAGAAAGGAGATGG - Intronic
980501326 4:133657987-133658009 CAGCAGAAATGGAAAAGAAATGG + Intergenic
981230421 4:142347799-142347821 CAGCAGAGGTGGTTCAGAGAAGG + Intronic
981682381 4:147414528-147414550 CAGCAGAGATTGTGAGGGGATGG - Intergenic
982144249 4:152365485-152365507 AAACAGAGATGCATAGGAGTGGG + Intronic
982252290 4:153419548-153419570 CAACAGTGATGGACAGGAGCAGG - Intergenic
982412551 4:155095189-155095211 ATGCAGAGCTGGCTAGGAGACGG - Intergenic
982435812 4:155383025-155383047 CTGCAGAGAGGGAGAGGAGGAGG - Intergenic
984190218 4:176596614-176596636 CTGGAGAGAGGGATAGGGGAAGG - Intergenic
984425528 4:179580494-179580516 CAGCAGAGATGGATTGAATTAGG + Intergenic
984789885 4:183605769-183605791 CAGAAGAGATGCATAGGTCAAGG + Intergenic
986324503 5:6662002-6662024 CAGCAGAGAGGGAGGGCAGAAGG - Intronic
987083730 5:14449284-14449306 CAGCAGAGATGGGGCCGAGAGGG - Intronic
987601712 5:20080456-20080478 CAACATAGATGGATATGTGAAGG + Intronic
988640182 5:33033174-33033196 TAGAAGAGATGGTTAGGAGAAGG - Intergenic
988907315 5:35802749-35802771 CAGCAGAGCTGGAGAGGACCAGG + Intronic
991289848 5:65023078-65023100 CAGCAGATGTGGAAAAGAGAGGG - Intergenic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
992233923 5:74688857-74688879 GAGCAGAGATGGAAAGAATATGG - Intronic
992344993 5:75867450-75867472 AAGGAGAGAAGGAAAGGAGAAGG + Intergenic
992546752 5:77821071-77821093 CTGCAGAGATGGATAAGGAATGG - Intronic
993062480 5:83055339-83055361 CAGCAGAGCTGGACAACAGATGG + Exonic
993959994 5:94286334-94286356 GAGCAAAGATGAATAGGAGGTGG - Intronic
994179707 5:96750731-96750753 CAGCAGAGAGTGACAGGAGGAGG - Intronic
995123917 5:108561432-108561454 CAGGAGAAAGTGATAGGAGAGGG - Intergenic
995350695 5:111172144-111172166 CAGAAAAGAGGGTTAGGAGAAGG - Intergenic
995832055 5:116364155-116364177 TAGCAGATATGGATGGCAGATGG + Intronic
996558316 5:124801296-124801318 CAGAAGAGAAGGGTGGGAGACGG + Intergenic
997551861 5:134760257-134760279 CACCAGAGAGGTAAAGGAGAAGG - Intronic
997821590 5:137070820-137070842 CACCAGGGCTGGACAGGAGAGGG - Intronic
997953928 5:138263953-138263975 CAGCGGGTATGGACAGGAGATGG - Intronic
998702727 5:144722616-144722638 CAGAATAGATGAAAAGGAGAAGG - Intergenic
999194304 5:149771529-149771551 CAGCAGAGGTGGGCAGGGGATGG + Intronic
999264709 5:150258852-150258874 CACCAGAGATGGAGAGGGAAGGG + Intronic
999783285 5:154868664-154868686 CAGCATAAATGGAAAGGAGTGGG - Intronic
999844633 5:155465762-155465784 GAGCAGAGCTGGATAAGAGATGG - Intergenic
1000961876 5:167610161-167610183 CAGAAGAGAAGCATAGGACAAGG + Intronic
1001237394 5:170041891-170041913 GAGGAGAGATGGAAAGGACAGGG + Intronic
1001277396 5:170360594-170360616 CAGCACATCTGGATAGGAGCTGG - Intronic
1001989240 5:176102562-176102584 CTGCACAGCTGGATTGGAGAGGG + Intronic
1002227630 5:177735576-177735598 CTGCACAGCTGGATTGGAGAGGG - Intronic
1002290193 5:178195113-178195135 CAGCAGAGATGGAAAAGAAGGGG - Intergenic
1002641622 5:180633222-180633244 CAGGAGAGAGGGATAGAAGAAGG - Intronic
1003149980 6:3540325-3540347 CAGCAGAAATGGGGAGGGGAAGG - Intergenic
1003425813 6:5997477-5997499 CAGCTGAAATGGCGAGGAGACGG - Intergenic
1003668221 6:8131407-8131429 CAGCTTAGATGGAGAGGAAATGG - Intergenic
1006129306 6:31859811-31859833 CAGCATGGATGGAGAGGAGCAGG - Exonic
1006831840 6:36972811-36972833 AAGCAGAGATGAGCAGGAGAGGG + Intronic
1006948066 6:37798672-37798694 CAGGACAGATGGAAAGGAGTGGG - Intergenic
1007084098 6:39130872-39130894 CAACAGAGCTGAATGGGAGAAGG + Intergenic
1007715940 6:43856229-43856251 GAGCAGGGATGGAGATGAGAGGG + Intergenic
1007769498 6:44181211-44181233 CAGCAGAGAAGGAGTGAAGAAGG - Intronic
1007872314 6:45054224-45054246 CAGGGGAGAAGGGTAGGAGAAGG - Intronic
1008907612 6:56696901-56696923 GAGCACAGATGGAGAAGAGATGG - Intronic
1010024249 6:71197298-71197320 CAGAGGAGACGGAAAGGAGAGGG + Intergenic
1011191815 6:84737519-84737541 CTACAGAGATGAAAAGGAGATGG + Intronic
1013103825 6:107009800-107009822 CTGCAGAGAGTGATAGGTGATGG + Intergenic
1013580021 6:111524493-111524515 AAGCAGAGATGGGGAGGAGGTGG - Intergenic
1013848123 6:114479280-114479302 TAGCAGATATGGATAGGGGTAGG - Intergenic
1014900450 6:126957441-126957463 CATCAGAGATGTATTGGAGAGGG - Intergenic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1016063597 6:139655748-139655770 CAACAGAGAGGGAAAGGAGAAGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016894616 6:149039910-149039932 AAGGAGAGAAGGATGGGAGAAGG - Intronic
1017304398 6:152899498-152899520 CAACAGAGATGAATTTGAGATGG - Intergenic
1018067708 6:160135111-160135133 CAGCAGAGAGGAAGAGAAGAGGG - Intronic
1018536204 6:164822741-164822763 CCACAGAGATGGAGAGTAGAAGG + Intergenic
1018956825 6:168415876-168415898 CACCAGGGATGGAAAGGAGTCGG + Intergenic
1019653115 7:2171477-2171499 CAGCAGAGAAGGACAGCAGCCGG + Intronic
1019875340 7:3805997-3806019 CAACAGAGATCTATAGGAGGAGG - Intronic
1020045212 7:5035448-5035470 CAGGTGAGGTGGATGGGAGAGGG + Intronic
1020051875 7:5087020-5087042 CAGCTGAGAAGTAAAGGAGAGGG + Intergenic
1020106777 7:5425861-5425883 GAGCAAAGACGGAGAGGAGAGGG + Intergenic
1020778594 7:12489808-12489830 CAGCAGTGATGTGTAGAAGATGG + Intergenic
1020832289 7:13107966-13107988 CAGCAGAGGTGGAGAAGACAAGG + Intergenic
1021333701 7:19371613-19371635 CACCAGAGATGGATGGGGGTGGG - Intergenic
1022479704 7:30734732-30734754 CAGCAGAGGGAGCTAGGAGAGGG - Intronic
1024585347 7:50837086-50837108 ATGCAGAGAGGGATAGGAGATGG - Intergenic
1025195224 7:56927372-56927394 AAGCAGTGCTGGATAGGAGCTGG + Intergenic
1025676728 7:63649571-63649593 AAGCAGTGCTGGATAGGAGCTGG - Intergenic
1025945145 7:66099378-66099400 GAGGAGAGAAGGAGAGGAGAAGG + Intronic
1026055460 7:66979868-66979890 CAGAAGAGATGGAGAGTGGATGG - Intergenic
1026722239 7:72841958-72841980 CAGAAGAGATGGAGAGTGGATGG + Intergenic
1027357227 7:77369733-77369755 CAGCAAAATAGGATAGGAGAAGG - Intronic
1027969758 7:85063893-85063915 CTGCATAGATAGATAGGGGAGGG - Intronic
1028139043 7:87252144-87252166 AAGCAGACATGGAAAGGAGTGGG + Intergenic
1028303944 7:89238144-89238166 AAGCAGACATGGAAAGGAGGAGG + Intronic
1028639354 7:93026005-93026027 CAGCAGAGAAGAGTAAGAGATGG + Intergenic
1029477304 7:100792579-100792601 CAGCAGAGGTGGACGGCAGAGGG - Intronic
1030162024 7:106518647-106518669 AAGGAGAGAAGGAGAGGAGAGGG - Intergenic
1031258071 7:119482076-119482098 AAGCAGAGCTGGAGAGGGGATGG - Intergenic
1032552039 7:132793101-132793123 CAGGAGAAATGGAAAGGAGCGGG - Intronic
1032751452 7:134845987-134846009 GAGCAAAGGTGGGTAGGAGAAGG - Intronic
1032956294 7:136975418-136975440 CAGTAGAGAAGGACAGGGGAAGG + Intronic
1033086780 7:138350065-138350087 TTGCACAGATGGATTGGAGATGG + Intergenic
1033899197 7:146115817-146115839 GAGGAGAGAAGGAAAGGAGAAGG + Intergenic
1033993814 7:147320546-147320568 CATCAGAGATGGATTTGAGATGG - Intronic
1034015597 7:147581664-147581686 CACCAGATTTGGATGGGAGAAGG - Intronic
1034219612 7:149433571-149433593 AGGCAGACATGGAGAGGAGAGGG - Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035987407 8:4449987-4450009 CAGGAGAGATGGCTAGGACAGGG - Intronic
1036428700 8:8669823-8669845 TGGCAGAGATGGGCAGGAGAGGG - Intergenic
1037813133 8:22098318-22098340 CAGCAGAGATGGAGAGGTTGGGG + Intronic
1038999753 8:32966747-32966769 CAGCAGAGAGCGAAATGAGAAGG - Intergenic
1039442717 8:37606466-37606488 CAACATAGATGGATGAGAGAGGG + Intergenic
1040577292 8:48664923-48664945 TGGCAGAGCTGGAGAGGAGAGGG - Intergenic
1040639703 8:49319190-49319212 CAGCAGAAATGCATGGGAGGTGG - Intergenic
1040956783 8:52987977-52987999 CCTCAGAGATGGAGAGGACAGGG + Intergenic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041419388 8:57649196-57649218 CAGCAGAGAGGGATAATGGATGG + Intergenic
1041648056 8:60273821-60273843 CAGCAGAGAGGGATGGGGGCAGG + Intronic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042388470 8:68204576-68204598 CAGCAGAGATGGGTAACAGCTGG - Intronic
1042631306 8:70820091-70820113 CAGGAGTGAAGGACAGGAGAAGG - Intergenic
1043489559 8:80735327-80735349 CAGAAAAGATGTGTAGGAGAAGG - Intronic
1044606990 8:94056585-94056607 CAGCAGGCAAGGATTGGAGACGG - Intergenic
1045683503 8:104687826-104687848 CACCAGAGATGGAAAGGACTTGG - Intronic
1046067505 8:109214092-109214114 AGGCAGAGAGGGAGAGGAGACGG - Intergenic
1047284147 8:123472066-123472088 CAGCCTTGATGGATAGGAGTGGG - Intergenic
1048493823 8:134919185-134919207 CAGCACAGATAGATAGGCCAGGG + Intergenic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049701053 8:144012829-144012851 GAGCAGAGAGGGCAAGGAGAAGG - Intronic
1052750471 9:32484622-32484644 CAGTAGAGATGGATTGGAGAAGG - Intronic
1053061586 9:35036235-35036257 CAGGAGAGAGGAATAGCAGAAGG + Intergenic
1053281120 9:36820306-36820328 CAGCAGAGGAGGAGAGGAGCTGG - Intergenic
1054815227 9:69468042-69468064 CAGCAGTGAGGCATGGGAGAGGG - Intronic
1055080643 9:72265081-72265103 CAGGGGAGATGGGTGGGAGAAGG + Intergenic
1056253382 9:84773397-84773419 CAGCAGTGATGGAGGGGTGAGGG + Intronic
1056545846 9:87612772-87612794 GAGCAGAGAAGGATTGGAGCGGG + Intronic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1056681647 9:88724638-88724660 CAGCAGAGACGGCCAGGGGAGGG + Intergenic
1056766597 9:89447942-89447964 AAGCAGAGAAGGAGATGAGACGG - Intronic
1056804709 9:89719643-89719665 CAGCTGCGGTGGCTAGGAGATGG - Intergenic
1057147861 9:92770514-92770536 CAGCAGAGGTGGGAGGGAGAGGG + Intergenic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058616692 9:106837080-106837102 CTGCAGTGATGGGTAAGAGATGG - Intergenic
1059070583 9:111131821-111131843 CAGCAGAAGTGGAGAGGAGGAGG + Intergenic
1059171654 9:112130468-112130490 CAGAGGAGAGGGAAAGGAGAGGG + Intronic
1059583472 9:115578377-115578399 CAGCAGAGGAGGTTAGGAAAAGG - Intergenic
1059971373 9:119672325-119672347 CAGGAGAGGAGGAGAGGAGAAGG - Intergenic
1060439416 9:123625289-123625311 CATCACAGATGTAAAGGAGATGG + Intronic
1060517945 9:124277490-124277512 CAGCAGGAAAGGGTAGGAGAAGG - Intronic
1060797188 9:126520673-126520695 CAGCTGGCATGGAAAGGAGATGG + Intergenic
1060927956 9:127468376-127468398 CAGGAGAGATGCACAGCAGAAGG + Intronic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061650148 9:132041055-132041077 CAGCAGAGAAGAAGAGCAGAAGG + Intronic
1061792994 9:133068329-133068351 CAGCAAAGAGAGAGAGGAGAGGG + Intronic
1061795598 9:133084113-133084135 CAGCAAAGAGAGAGAGGAGAGGG + Intronic
1061804591 9:133131024-133131046 CAGCAGAGGCGGGGAGGAGAGGG + Intronic
1062621512 9:137424272-137424294 CAGCAGTGATTTAAAGGAGAGGG + Intronic
1185701463 X:2233995-2234017 TAGCAGGGAAGGAGAGGAGAAGG + Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186800563 X:13088339-13088361 GAGCAGAGTTGGAGAAGAGATGG - Intergenic
1188513154 X:30958335-30958357 CAGAAGAGATGGAAGGGAAAAGG - Intronic
1188911358 X:35851664-35851686 CAGAAGGGAAGGGTAGGAGATGG + Intergenic
1189033439 X:37472299-37472321 GAACAGAAATGGATAGGAGATGG - Intronic
1189431046 X:40947581-40947603 CGGCAGAAATGGATGGGAAAGGG + Intergenic
1189999724 X:46674327-46674349 CAGCAGATATGAACGGGAGATGG - Intronic
1190705106 X:53020950-53020972 CAGCAGTGAGGGATGGGAGATGG - Intergenic
1190712743 X:53081753-53081775 CAGCAGTGGGGGATGGGAGAAGG + Intergenic
1191743649 X:64463400-64463422 CAGCAGATATGGATCCCAGAGGG - Intergenic
1195384085 X:104297211-104297233 CAGCTGAGATGGGGTGGAGATGG + Intergenic
1195411066 X:104567937-104567959 CGGCACAGATGGAGAGGGGATGG - Intronic
1195443432 X:104922452-104922474 CAACAGAGATGGAGAGGTGGAGG - Intronic
1195455736 X:105067289-105067311 CAGCATAGGTGGAAAGGAGATGG - Intronic
1195455774 X:105067858-105067880 CAGCGTAGGTGGAAAGGAGATGG - Intronic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1198635829 X:138699282-138699304 CAGAAGAGATGGAAGGGTGATGG - Intronic
1199146328 X:144372471-144372493 CAGCAGAGAGAGAGAGCAGAAGG - Intergenic
1199595757 X:149504795-149504817 AAGCACGGAGGGATAGGAGATGG + Intronic
1200008091 X:153101140-153101162 CAGCAAAGGAAGATAGGAGAGGG + Intergenic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic