ID: 1092098708

View in Genome Browser
Species Human (GRCh38)
Location 12:5865113-5865135
Sequence GTCACTGCTAAGAGAAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092098708 Original CRISPR GTCACTGCTAAGAGAAGGCA GGG (reversed) Intronic
900266149 1:1758219-1758241 GTCACTGCTGGGAAGAGGCATGG - Intronic
903173926 1:21569660-21569682 GTCATTGCTAAGAGAAGGCAGGG + Intronic
904830920 1:33306457-33306479 CTCACTGCTAAGCTAAGGGAAGG + Intergenic
905174576 1:36127498-36127520 GGCACTGCCCAGAGAAGGGAGGG + Intergenic
909156302 1:72081843-72081865 GTCATTGCTAAGAGGTGTCAGGG - Intronic
912878642 1:113388166-113388188 GTCACTGCACAGAGCAGGAACGG - Intergenic
913402207 1:118448811-118448833 GTCACAGCTAAAAGAGGACAAGG + Intergenic
913557054 1:119978091-119978113 GTAACTTTTAAGAGAAGGCCTGG + Intronic
914325331 1:146609261-146609283 ATCAATACTAAGAGAAGTCAAGG - Intergenic
914992907 1:152514225-152514247 GTGTATGCTAAGAGAGGGCATGG - Intronic
917751283 1:178055923-178055945 GTCACTGCTAAGACACAGGAAGG - Intergenic
919468292 1:197948567-197948589 GTCACTTCCAAGCGAATGCAAGG - Intergenic
919550914 1:198986262-198986284 GTCACTGACCACAGAAGGCATGG + Intergenic
920231816 1:204475711-204475733 GTCACAGGAAAGAGAAGGAAAGG + Intronic
921544666 1:216460389-216460411 GCCAGGGCTCAGAGAAGGCATGG - Intergenic
921829217 1:219708543-219708565 ATCACTGCTAAGCGAAAACATGG - Intronic
924422363 1:243921505-243921527 GTCACTGCACTGAGAAAGCAGGG + Intergenic
1063999878 10:11654739-11654761 CTCTGTGCTGAGAGAAGGCAGGG - Intergenic
1064391167 10:14943338-14943360 GTCACTGTTAAAAGGAGCCATGG - Intronic
1064401526 10:15025361-15025383 GTCACTGTTAAAAGGAGCCATGG - Intergenic
1066046673 10:31601290-31601312 GTAAATGCTAAGGGAAGCCAAGG - Intergenic
1068350845 10:55843127-55843149 GTCACAGCCAAGAGAAGCCTAGG - Intergenic
1068563718 10:58547256-58547278 GTCACAGCCAAGAGGAGCCAAGG - Intronic
1068660314 10:59616448-59616470 TTCTCTGCCAAGAGAAGGCTGGG - Intergenic
1069140121 10:64811826-64811848 GTCATTGCTCAAGGAAGGCAGGG + Intergenic
1070461646 10:76676245-76676267 GGCACAGCTCAGAGAAGACAGGG + Intergenic
1072432282 10:95383864-95383886 GTCACTGCTAATAGGTGACAAGG + Intronic
1072539485 10:96387305-96387327 GGCTCTGCCAAGAGAAGGCCAGG + Intronic
1072727538 10:97823847-97823869 GCCACTGGGCAGAGAAGGCAGGG + Intergenic
1076510774 10:131012353-131012375 GCCACTGCTATGAGTAGGAATGG + Intergenic
1077253346 11:1570397-1570419 GTCACTTCTTGCAGAAGGCAGGG - Intronic
1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG + Intergenic
1079838411 11:25364742-25364764 GTCACATCCAAGACAAGGCAAGG + Intergenic
1080681796 11:34484573-34484595 GTCACTGCTGAATGAAGGAAGGG + Intronic
1082764046 11:57152468-57152490 GTCACAGCTAAGGCAAGGAAAGG + Intergenic
1082942710 11:58725429-58725451 GTAACTTCTAAGTGAAGGTAGGG + Intronic
1084746464 11:71173042-71173064 TTCCCTGCTAAGAGACGACAGGG - Intronic
1086366720 11:86114382-86114404 GACACAGCTATGAGAAGGCCTGG - Intergenic
1086611142 11:88757515-88757537 GTGGCTGCTCAGAGCAGGCAGGG - Intronic
1087895788 11:103584295-103584317 TTCTCTGCAAAGAGAAGGCAAGG + Intergenic
1089126886 11:116182677-116182699 GGCACTACAAAGAGAAGGAAAGG + Intergenic
1090639680 11:128719712-128719734 GTCAGTGCTGTGAGAAAGCAAGG + Intronic
1091347099 11:134862862-134862884 GTCACAGCCAAGAGGAGGCTGGG - Intergenic
1091708526 12:2718594-2718616 GTCACTGCAATGAAAAGTCATGG + Intergenic
1092098708 12:5865113-5865135 GTCACTGCTAAGAGAAGGCAGGG - Intronic
1092208818 12:6633200-6633222 GTCAGTCCCAAGAGAAGCCACGG + Intronic
1093623207 12:21316631-21316653 GTCTATGTTAAGAGAAGGAATGG - Intronic
1093843251 12:23932291-23932313 GTCAAGGCAAAGAGATGGCAGGG + Intronic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1098285183 12:68899658-68899680 GTCAATGCCAAAAAAAGGCAGGG + Intronic
1098974307 12:76886580-76886602 GCCTCTGCTGAGAGAAGGTAGGG + Intergenic
1099051737 12:77789308-77789330 GTCATTGGTAAGGGAAGGAAGGG - Intergenic
1101026163 12:100608978-100609000 GCCACTGCTAACAGAACCCAAGG + Intronic
1101198449 12:102409567-102409589 GTCACTTGTATGAGATGGCAGGG - Intronic
1101833945 12:108281930-108281952 GTCCCTGCTCAGAGTATGCAGGG - Intergenic
1102151535 12:110691717-110691739 GACCCTGCTAAGGCAAGGCAAGG + Intronic
1102319905 12:111923844-111923866 GACACTGTTAAGAGAATGAAAGG + Intergenic
1102594012 12:113978558-113978580 TTCACTGCCAAGAGAAGGAGGGG - Intergenic
1102974118 12:117193868-117193890 GGAACTACTAAGAGAAGACAAGG - Intergenic
1103341692 12:120224374-120224396 GCGTCTGCAAAGAGAAGGCACGG + Exonic
1105312788 13:19228334-19228356 CTCACTGCCAAGACCAGGCATGG + Intergenic
1106984585 13:35330518-35330540 ATCATTGAAAAGAGAAGGCAGGG - Intronic
1107377761 13:39822821-39822843 CTCAATGCCAAGAGATGGCACGG + Intergenic
1108325764 13:49329463-49329485 GTGGCTGCTCAGGGAAGGCATGG + Intronic
1108355301 13:49624574-49624596 AGCACAGCTAAGGGAAGGCAGGG - Intergenic
1108623037 13:52202714-52202736 GGCCCTGCTAAGAGAGTGCAGGG - Intergenic
1108914675 13:55591951-55591973 TTCACTGCTTATAAAAGGCAAGG - Intergenic
1110294014 13:73841098-73841120 GTCACTGCTACTAGAATGTAAGG + Intronic
1110955756 13:81550266-81550288 GCCATTGCTAAGAGGAGCCAAGG - Intergenic
1111081002 13:83307632-83307654 GGCAGTGCTAAGAGCAGGAAGGG + Intergenic
1111660574 13:91205108-91205130 CTCACTTCGAAGAGAAGCCATGG + Intergenic
1114377961 14:22169597-22169619 CTCAATGAGAAGAGAAGGCAAGG - Intergenic
1115253601 14:31374987-31375009 GTCACTTGTAAGAGAATCCAAGG + Intronic
1117266472 14:54093207-54093229 TTCACTGCTAGGAGGAGGGAGGG - Intergenic
1117268780 14:54119195-54119217 CTCAGTGCTATTAGAAGGCAAGG - Intergenic
1118474917 14:66107737-66107759 CTCACTACAAAGAGCAGGCATGG + Intergenic
1120013500 14:79444306-79444328 GTCACTCATAAGAGAAGGGAGGG - Intronic
1121584120 14:95051249-95051271 GTCACTGAATAGACAAGGCAGGG + Intergenic
1121996310 14:98606241-98606263 GTCAGAGCCAAGAGAAGGCCAGG + Intergenic
1122575105 14:102737149-102737171 GTCACTGGTAAGTGGAGGGAAGG + Intergenic
1124465886 15:29939568-29939590 GTGAGTCATAAGAGAAGGCAAGG + Intronic
1124834102 15:33178818-33178840 TTCATTGCCAATAGAAGGCAGGG - Intronic
1127286074 15:57534812-57534834 GGCACTGAAAAGAGAATGCATGG + Intronic
1127440847 15:59006075-59006097 GTCATTGTCAAGAGAAGGAAAGG + Intronic
1127775244 15:62259641-62259663 GCCACAGCCAAGTGAAGGCAGGG + Intergenic
1128539442 15:68516026-68516048 GGCACTGCTATGTGGAGGCAAGG + Intergenic
1128655071 15:69454650-69454672 TTCACTGTTAAGAGGAGACATGG + Intronic
1128760714 15:70214458-70214480 GTCATTGCTAAGTGAAGCCAAGG + Intergenic
1130164890 15:81444392-81444414 GTCTCTGCTTAAAGAAGTCAAGG - Intergenic
1132672293 16:1106779-1106801 GTCAGGGCTGGGAGAAGGCATGG - Intergenic
1132951388 16:2564291-2564313 GCCACTGCTCAGGGCAGGCAAGG + Intronic
1132962962 16:2635879-2635901 GCCACTGCTCAGGGCAGGCAAGG - Intergenic
1134231318 16:12432688-12432710 GTCACTGTCAAGTGAAGGCATGG - Intronic
1134278015 16:12793695-12793717 GTCTCTGCTAAGATAAGGGTAGG - Intronic
1134658194 16:15963670-15963692 GTCATGGCTAAGAGGAGCCAAGG - Intronic
1138923458 16:61561590-61561612 GTCACTTCCAAAAGTAGGCACGG + Intergenic
1139146815 16:64335105-64335127 GACACTTCTCAAAGAAGGCATGG + Intergenic
1140008231 16:71101686-71101708 ATCAATACTAAGAGAAGTCAAGG + Intronic
1140117572 16:72056142-72056164 GGCACTGCAGAGAGAAGACAAGG - Exonic
1140213484 16:72989056-72989078 GTCTCAGCTAAGAGAGGCCAAGG + Intronic
1140734429 16:77885417-77885439 GCCCTTGCTAGGAGAAGGCAGGG + Intronic
1140995893 16:80259369-80259391 TGCACTGCTGAAAGAAGGCAAGG - Intergenic
1143498039 17:7323557-7323579 GTCACTCCTGGGAGGAGGCAGGG + Exonic
1146004836 17:29154670-29154692 GTGCCTGCTGAGAGGAGGCAGGG + Intronic
1146005263 17:29156731-29156753 GTGAATGCTATGAGAAGGCTGGG + Intronic
1146219080 17:31002763-31002785 GTCACTGCTTAGACAACTCAAGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150353439 17:64463580-64463602 GTCACAACTCAGAGAAGTCAGGG + Intronic
1151768229 17:76143092-76143114 ATGACAGCCAAGAGAAGGCAGGG + Exonic
1151985474 17:77540597-77540619 GTCACTGCCAGGATGAGGCATGG - Intergenic
1154476616 18:14766029-14766051 GTCACTGGAAAGATAAAGCAAGG + Intronic
1156266350 18:35491542-35491564 GTCTCTGGTTAGAGAAGGAAGGG - Intronic
1156693512 18:39737268-39737290 GTTACTGCTATGATAAGGGAAGG - Intergenic
1158045675 18:53152771-53152793 GTTACTGTTGAGAGAAAGCATGG + Intronic
1158718160 18:59899392-59899414 GTCACTGCAAACAGAAGCCCTGG - Intergenic
1159282935 18:66310566-66310588 GCCACGGCTAAAAGAAGCCAAGG - Intergenic
1161905038 19:7150213-7150235 GTGGCTGCAAACAGAAGGCAGGG + Intronic
1162593237 19:11606865-11606887 GCCATTGCTAAAAGGAGGCAAGG - Intronic
1165164364 19:33841029-33841051 GTCATTGCCATGAAAAGGCAGGG - Intergenic
1165698683 19:37920823-37920845 TTCGCTGCTCAGAGAAGCCAGGG - Intronic
927056900 2:19373661-19373683 GTCAATGCTTAGTGAAGCCATGG - Intergenic
931990764 2:67787934-67787956 GTGATTTCTAAGTGAAGGCAGGG - Intergenic
932895559 2:75636332-75636354 GTCAATGTTTAGAGAAGGCAAGG - Intergenic
934992670 2:98932645-98932667 GTCAGGGCTGGGAGAAGGCAAGG - Intronic
935325507 2:101932764-101932786 TTCATTGCTATTAGAAGGCATGG + Intergenic
935627593 2:105184214-105184236 GTCACTGCAAAGAGAATGTCAGG + Intergenic
937819678 2:126295368-126295390 GTCACTGTTAAGAGAAGAAAAGG + Intergenic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
941294577 2:163720335-163720357 GACAAGGCTAAAAGAAGGCATGG + Intronic
942556293 2:177175521-177175543 GTCCCTGCTTGGTGAAGGCAGGG - Intergenic
943437542 2:187885438-187885460 TTCACTACCAAGAGAAAGCATGG + Intergenic
945112624 2:206377360-206377382 GTAACTTCTAGGAAAAGGCACGG - Intergenic
946168131 2:217877799-217877821 CTCACTGCCAGGAGAGGGCAAGG + Intronic
946401448 2:219470607-219470629 ATAACTGCAAAGAGAAGGGAAGG + Intronic
948123200 2:235546012-235546034 CTCACTCCTCACAGAAGGCAAGG - Intronic
949011468 2:241681733-241681755 GACACTGTCAAGAGAAGGAAAGG + Intronic
1170434353 20:16310221-16310243 GTCACAGCCAAGGGAAGGAAGGG + Intronic
1171094792 20:22321426-22321448 TTCATTCCTAAGAGAAGCCAGGG - Intergenic
1171170693 20:23012655-23012677 GTCTCTGCTCAGAGAATTCAAGG + Intergenic
1171248141 20:23629689-23629711 GCCACGGCGAAGAGCAGGCAGGG + Intronic
1175102848 20:56592149-56592171 GTAACTGTTAAGAGGAGGCACGG - Intergenic
1175537825 20:59727437-59727459 GCCACAGCTTAGAGAAGGGATGG + Intronic
1178300206 21:31446543-31446565 GACACTACTGAGAGAAGGCCAGG + Intronic
1179089996 21:38256027-38256049 GTCAATCCTAAGAGATGGAATGG - Intronic
1181285453 22:21748660-21748682 GTCACTGCTGAAAGAACCCAAGG + Intergenic
1184456066 22:44609984-44610006 GTCACTGAGTAGAGTAGGCAGGG - Intergenic
1184831441 22:46991305-46991327 GTCTCTGCCAAGAGGAGGGAAGG - Intronic
953583845 3:44181699-44181721 TTCACAGGAAAGAGAAGGCAGGG + Intergenic
954299371 3:49691241-49691263 GTCACAGGTAAGAGCTGGCAGGG + Exonic
954883180 3:53849580-53849602 GTCACTGAGAGGAGATGGCATGG + Intronic
956346004 3:68279562-68279584 GTCACTACTATGGGAAGTCAGGG + Intronic
959440913 3:106374506-106374528 GTCCCTGCTTTGAGAAGACATGG + Intergenic
959935017 3:112020328-112020350 GTCACTCATAAGAAAAGCCAGGG + Intergenic
960821368 3:121736573-121736595 GTCACAGATTAGAGAAGACAAGG + Intronic
962384289 3:134920511-134920533 GGCACTGCTCAGAAAAGGCCTGG + Intronic
963945224 3:151138563-151138585 GTCACAGCCAAGAGAAGCCTAGG - Intronic
964923415 3:161926369-161926391 GCCACAGCTAAAAGAAGTCAAGG + Intergenic
964949715 3:162275193-162275215 AACACTGCTAAAAGAAGTCATGG - Intergenic
968086508 3:195876364-195876386 GCCACGGCGAAGAGAAGGCCAGG + Intronic
968439056 4:612428-612450 TTAACTGCTCAGCGAAGGCAGGG + Intergenic
969532114 4:7735872-7735894 GTCACAGCTAGGAGGTGGCAGGG + Intronic
970468696 4:16353474-16353496 GTCATTGCTGAGATGAGGCATGG - Intergenic
973595499 4:52484594-52484616 CTCAGAGCTAAGAGATGGCAAGG - Intergenic
975415590 4:74100466-74100488 GCCACTGCTATGAGAAGGGCTGG + Intergenic
976097238 4:81521922-81521944 GTGAATGCTAAGAGAAAGAAGGG - Intronic
976202496 4:82593669-82593691 GTCAGTGCTAAGACAGAGCATGG + Intergenic
977220662 4:94333965-94333987 GTCTCTGCTAAGAAAAAGAATGG + Intronic
978481938 4:109202662-109202684 GACACTGTTAAGAGAATGAAGGG + Intronic
980084480 4:128377360-128377382 GCCACTGCTAAAAGAGGTCAAGG - Intergenic
980262314 4:130466927-130466949 GTCACTGATATCAGAAGGAATGG + Intergenic
980707900 4:136523575-136523597 GTCAGAGCTAAGAGAGAGCATGG - Intergenic
982983342 4:162170058-162170080 GTCACAGCTATGAGAAAGGATGG + Intergenic
983169904 4:164523585-164523607 CTGACTGCTATGAGAAGGAAGGG + Intergenic
984400758 4:179261118-179261140 TTCACTGCTAATGAAAGGCAAGG + Intergenic
987432800 5:17857029-17857051 GGCACTGCTAAGAAAATGAAAGG - Intergenic
988136039 5:27173257-27173279 GTCTCTGCTAAAAGAAGCCCTGG - Intergenic
988979354 5:36550921-36550943 GACACTGCTAAGAAAACGAAAGG + Intergenic
995761399 5:115565795-115565817 GGCACTGCTTAGTGAAGCCATGG + Intergenic
996630126 5:125621307-125621329 GTCACTCCTAAGTCAAAGCATGG + Intergenic
997262666 5:132476506-132476528 GTCACTGGTCAGAGAAGGGAGGG + Intergenic
997336869 5:133114799-133114821 GTGACTGCAAAAAGAAGGCGGGG - Intergenic
999163721 5:149529318-149529340 GATAATGCCAAGAGAAGGCAAGG + Intronic
1001112146 5:168905473-168905495 GTATCTGCAAAGAAAAGGCAAGG + Intronic
1001516348 5:172357887-172357909 TTGACTGTTAAGAGAAAGCATGG - Intronic
1002041803 5:176520244-176520266 GGCACTGGAAAGAGAGGGCAGGG + Intergenic
1002901573 6:1414438-1414460 GTCATTGCTACGGGAAGGGATGG - Intergenic
1003205720 6:4009102-4009124 GTCTCTTCTAAGAGAAATCATGG - Intergenic
1003682494 6:8269703-8269725 GTCATTGCTGGGAAAAGGCAGGG + Intergenic
1003817498 6:9858551-9858573 CACACTGCAAAGAGATGGCAGGG + Intronic
1004699959 6:18069596-18069618 GGAAGTGCTAAGGGAAGGCAAGG + Intergenic
1004749155 6:18543140-18543162 GCAACTTCCAAGAGAAGGCATGG + Intergenic
1006115611 6:31774623-31774645 GCCACTGGGAAGAGAGGGCAGGG + Exonic
1006495127 6:34417285-34417307 GGCACTGCCTAGAGAAAGCAGGG + Intronic
1006626999 6:35404663-35404685 GTCTCTGCTAGGAGTAGGGAGGG - Intronic
1006631100 6:35430491-35430513 GTCACAGCTAGGAAGAGGCATGG + Intergenic
1006831493 6:36970832-36970854 GTCACTGCCCAGAGAAGGCCTGG + Intronic
1008018761 6:46551771-46551793 GGCTCTTCTAGGAGAAGGCAGGG - Intronic
1008764645 6:54896526-54896548 CACACTGATAAGAGAAGGAAGGG + Intronic
1010608767 6:77926778-77926800 TTGACTGCTAAGAGAAAGCTTGG - Exonic
1013618245 6:111864722-111864744 GTAACTGCAAAGCAAAGGCAAGG + Intronic
1014107315 6:117581996-117582018 GACAATGCCAAGTGAAGGCAAGG - Intronic
1016042101 6:139442042-139442064 TTCATTGCTAAGAGCAGGAAAGG + Intergenic
1016382322 6:143497606-143497628 GTCACCACTAATAGAAGGGAAGG + Intronic
1019019364 6:168904633-168904655 TTAACCGCTAAGAAAAGGCATGG - Intergenic
1019971471 7:4544338-4544360 GGCAGTGCTCAGAGCAGGCAGGG - Intergenic
1020849337 7:13331039-13331061 GTCACAACTAAAAGCAGGCATGG - Intergenic
1021196745 7:17682218-17682240 GTCACTGTTGAGAGAACGGAAGG + Intergenic
1021621903 7:22557192-22557214 GTCTCTGATAAGACCAGGCAGGG + Intronic
1022277153 7:28866583-28866605 GTCACAGTCAAGAGAAGGCAGGG + Intergenic
1022420710 7:30220448-30220470 GACACTGCTAAGAGAATAAAAGG + Intergenic
1023521081 7:41050551-41050573 TTCACTGCAAGGAGCAGGCATGG - Intergenic
1024148524 7:46542719-46542741 GTCATTTCTAAGACTAGGCAGGG + Intergenic
1024673586 7:51618136-51618158 GTCAACTCTAAGAGAAGGCAGGG - Intergenic
1024963227 7:54999824-54999846 GGCACGGCAAAGAGATGGCAGGG + Intergenic
1026873859 7:73868994-73869016 GTCCCCGCTCAGAGCAGGCATGG + Intergenic
1026916183 7:74121458-74121480 GCCACGGCAGAGAGAAGGCAGGG - Exonic
1029345419 7:99975384-99975406 GTCACTCCTAGGATAAGGGAAGG - Intronic
1030258625 7:107539966-107539988 GCCACAGCAAAGGGAAGGCAAGG + Intronic
1031794180 7:126150476-126150498 ATCACTGCTGAGGGAAGGCCAGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033118517 7:138647032-138647054 GACATTGCTTAGAGAAGGAAAGG + Intronic
1034516445 7:151584356-151584378 GTGACTGCTAACAGTTGGCATGG - Intronic
1035164921 7:156981361-156981383 GGGACTGCTAGGAGAAGGGAAGG - Intergenic
1035385793 7:158471906-158471928 GTCAGGGCAAAGAGAAGACATGG + Intronic
1036224872 8:6949335-6949357 GTCACTGGTAAGATGATGCAAGG - Intergenic
1036721175 8:11176932-11176954 GCCAATGCTAAGAGAAGGTGGGG + Intronic
1037434629 8:18849670-18849692 GTCACTTCCAATAGATGGCATGG - Intronic
1038011628 8:23480876-23480898 GTCACTGCCACCAGCAGGCAGGG + Intergenic
1038464135 8:27744351-27744373 GTCACCTCTAAGGGGAGGCAAGG + Intronic
1039431664 8:37529662-37529684 GTCACTGCTTGGCGGAGGCACGG + Intergenic
1042071284 8:64937825-64937847 GTCACTGTCAAGTGAAGGCTAGG - Intergenic
1043286369 8:78536990-78537012 GACACTTCTTAGAGAAGGAAAGG - Intronic
1046118712 8:109817928-109817950 GTAACTGTGAAGAGAAGGAATGG - Intergenic
1047344632 8:124015163-124015185 GTCACTTCCAAGACTAGGCATGG - Intronic
1047364530 8:124200141-124200163 GTGACTGCTACGTGAAGGCCTGG - Intergenic
1047387906 8:124426532-124426554 ATGACTGCTAAGATATGGCAGGG + Intergenic
1047675419 8:127196627-127196649 GTCTCTACTAATAGAAGTCATGG - Intergenic
1049504693 8:142989789-142989811 GTCCCAGCTCAGAGACGGCAAGG - Intergenic
1049581464 8:143413048-143413070 GTCATTGCTAAGAGAAGGAGGGG - Intergenic
1052003627 9:23319322-23319344 ATGACTACTAAGAGATGGCATGG - Intergenic
1052211378 9:25907604-25907626 GGGACTGCTAAGAAATGGCAAGG + Intergenic
1055123165 9:72686316-72686338 GGGACTGCTGAGAGAAGGAATGG + Intronic
1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG + Intergenic
1056779348 9:89537930-89537952 TTCACGTCTAGGAGAAGGCAAGG - Intergenic
1056826262 9:89878338-89878360 GTCTCTGCCCAGAGAAGGCAGGG + Intergenic
1058011547 9:99983069-99983091 GTGACTGCTAAGAGAATTAATGG + Intronic
1058089846 9:100793053-100793075 GGCATTGTTAAGAGAATGCAAGG - Intergenic
1058503949 9:105649927-105649949 GTGTCTGCTGACAGAAGGCAGGG + Intergenic
1059100613 9:111468489-111468511 GTTACTGCCGAGAGAAGGAAAGG + Intronic
1059732810 9:117073675-117073697 GTCACTCCTGAGAGAAGGAGTGG - Intronic
1060480431 9:124013962-124013984 GTCACTGCTGATGGACGGCATGG - Exonic
1061156073 9:128862580-128862602 GGCAGTGCCCAGAGAAGGCAAGG - Intronic
1062107690 9:134764688-134764710 GGCACTGCATAGAGGAGGCAGGG + Intronic
1203654245 Un_KI270752v1:7956-7978 TTCACTGCTAAGAGATGTCCAGG - Intergenic
1186356018 X:8790932-8790954 GACACTTCTGTGAGAAGGCAGGG - Exonic
1188567410 X:31542848-31542870 GCCACTGCGAATAGAGGGCAGGG + Intronic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1192131907 X:68559499-68559521 GTCATGGCTAAGAGAGGCCAAGG - Intergenic
1192202176 X:69073378-69073400 CTCACTGCTAGGGGAAGGCTTGG + Intergenic
1192894801 X:75430961-75430983 GCCACAGCTAAGAGAAGCTAAGG + Intronic
1196858851 X:120008629-120008651 GTCACTGGGAAGGGAGGGCATGG + Intergenic
1197443219 X:126515222-126515244 GGCACGTCTAAGAGAGGGCATGG - Intergenic
1199566070 X:149217052-149217074 GTCATGGCTAAAAGAAGCCAGGG + Intergenic