ID: 1092100046

View in Genome Browser
Species Human (GRCh38)
Location 12:5875549-5875571
Sequence AGCCTGGAAGCTCCCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092100046 Original CRISPR AGCCTGGAAGCTCCCACAGA TGG (reversed) Intronic
900582647 1:3416659-3416681 CCCCTGGGAGCTCCCAGAGAAGG - Intronic
901428991 1:9201020-9201042 AGCCTGGGAGCTCCTCCAGCCGG + Intergenic
902386428 1:16078479-16078501 AGACTGAAAGCTCCCAGGGAGGG - Intergenic
905199441 1:36306377-36306399 AGCCTGGCAGCTCCCTCTGACGG - Exonic
905312142 1:37056687-37056709 AGCCTGGAAGCTACCAGAGAAGG + Intergenic
905335341 1:37240932-37240954 AGCCTGCCAGCTCCAACAGATGG + Intergenic
905572275 1:39015139-39015161 AGCCTGGGAGCTCCCACCTTTGG - Intergenic
905580818 1:39081777-39081799 ACCCTGGCAGCGCCCGCAGAGGG - Intronic
905629484 1:39510820-39510842 AGCCTGGAAGCTCCCAGAGGAGG + Intronic
905668276 1:39775373-39775395 AGCCTGGAAGTTCCCAGAGGAGG - Intronic
907496429 1:54848257-54848279 AGCCTGAAATCACCCACAGGGGG - Intergenic
910367382 1:86480756-86480778 AGGATGAAAGCTCTCACAGATGG + Intronic
910713434 1:90204990-90205012 AGCCCCCAAGCTCCCCCAGATGG - Intergenic
911415103 1:97562014-97562036 AGACTGCAAGCTCCTGCAGATGG + Intronic
911545481 1:99211175-99211197 AACCAGGAAGCTCTCACTGAAGG - Intergenic
912553904 1:110502360-110502382 AGCCTCCAAGATCTCACAGAGGG + Intergenic
914350162 1:146833514-146833536 AGCCTGGCAGCCCCCTGAGATGG - Intergenic
917536864 1:175880703-175880725 AGCCTGGAGGCAACCACAGAAGG - Intergenic
920217492 1:204371365-204371387 AGCCTGCAATCTCCCCCAGATGG + Intronic
921148062 1:212378119-212378141 AGCCTGTCAGCTCCCATGGAAGG + Intronic
922514895 1:226199947-226199969 ATCCTGGGAGATCCCACTGAGGG - Intergenic
923340734 1:233004901-233004923 AGCCTGGAATCTTCCAGAAAAGG + Intronic
1063280210 10:4620377-4620399 AGCCTTGAAGCTCCAGCACATGG + Intergenic
1072190274 10:93072489-93072511 AGCCGGGAAGCTCCGGCAGGTGG + Intergenic
1076170136 10:128312314-128312336 AGCCTGACAGATCCCATAGATGG + Intergenic
1076573370 10:131447330-131447352 GGACTGAAAGCTGCCACAGAAGG + Intergenic
1076652506 10:131999490-131999512 AGCCTGGGGGCTTCCACCGAGGG - Intergenic
1078605301 11:12769790-12769812 AGGCTAGAAGCTCCCAAAGCCGG + Intronic
1079333871 11:19554413-19554435 AGCCTGGTGTCTCCCCCAGAGGG - Intronic
1080505874 11:32912833-32912855 AGCCTGGAAGGTCACACCTAGGG + Intronic
1081091056 11:38867008-38867030 AGCCTGGTAGCTCCTATGGATGG - Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082757431 11:57091982-57092004 AGCCTGGATGCTCCTGTAGAAGG + Intergenic
1082771799 11:57213559-57213581 AGCCTGGAAGCTCCAGCCGGTGG - Intergenic
1082996287 11:59257990-59258012 GTCCTGGAAGCTCCAACAGCTGG + Intergenic
1083174143 11:60938857-60938879 ACCCTGGGAGCTCACTCAGATGG - Intronic
1083751660 11:64764217-64764239 TGCCTGGAAGCTGCCACCTAAGG - Intergenic
1084757237 11:71247665-71247687 AGCACGGGAGCTCCCCCAGAGGG - Intronic
1085388191 11:76169126-76169148 AGTCTGGAGGCCACCACAGAGGG + Intergenic
1086468975 11:87086397-87086419 AGCCTGGAAACTGCCAAACATGG - Intronic
1089647476 11:119889694-119889716 AGCCTGGAAGGACTCCCAGAGGG - Intergenic
1090989389 11:131802500-131802522 GGCCTCCAGGCTCCCACAGAGGG - Intronic
1091449956 12:566158-566180 AGCCTGGAAGCTCCGACCCCAGG - Exonic
1091637480 12:2208492-2208514 AGCCTGCCAGCTCCCTCAGCCGG - Intronic
1092100046 12:5875549-5875571 AGCCTGGAAGCTCCCACAGATGG - Intronic
1093116820 12:15221609-15221631 AGCCTCCAGGCTCCCACCGAAGG + Intronic
1093874922 12:24339068-24339090 AGACTGTAAGCTCCAAAAGAGGG - Intergenic
1096203754 12:49705443-49705465 GGCCTGGCAGCTCCCACCTAAGG + Intronic
1096469098 12:51865089-51865111 TGCCTGGAAGTTCTCAAAGAGGG + Intergenic
1096513855 12:52145882-52145904 AGGCTGGGAGCTGACACAGAGGG - Intergenic
1100464731 12:94834916-94834938 AGCGTGAAAGCTCCCTTAGAAGG + Intergenic
1100710878 12:97255656-97255678 AGGCTGGAAGCTCCCACTGCAGG + Intergenic
1102362967 12:112304336-112304358 AGCCTGGAAGGTCGACCAGAAGG - Intronic
1102740126 12:115199609-115199631 AGCCTGGAAGCTCCAAGTCAGGG + Intergenic
1103091808 12:118103460-118103482 AGCCTAGAAGCTGCCCCAGGAGG - Intronic
1103163865 12:118753494-118753516 AGCCTGGAAGATTTCGCAGAGGG + Intergenic
1103408108 12:120690059-120690081 AGCCTGTGTGCTTCCACAGATGG + Intronic
1103871922 12:124098453-124098475 AGGCTGGAAGCACCAACATATGG - Intronic
1104283223 12:127397448-127397470 AGCCTGGAAACTCCCTCAAAGGG - Intergenic
1109076375 13:57841309-57841331 AACCTGGAAGGTCCCTGAGATGG + Intergenic
1122605889 14:102947523-102947545 AGCCAGGAGGCTCCCCGAGACGG + Intronic
1123041826 14:105493400-105493422 AGGCTGGAAGGTGGCACAGAGGG - Intronic
1127834563 15:62780399-62780421 TGCCTGGAAGTTACCACTGAAGG + Intronic
1128663504 15:69521334-69521356 AGTCTGGAGGCTCCTGCAGAAGG + Intergenic
1129331832 15:74831878-74831900 AGCCAGGAAGCTCCCCAAGCAGG + Intergenic
1130686509 15:86042254-86042276 AGCCTGCAAGAGCCCACAGAAGG - Intergenic
1131089792 15:89614957-89614979 AGCCTGTAAGCTGCCACCTATGG - Intronic
1132386510 15:101404478-101404500 AGCCAGGAACCTCCAAGAGAAGG + Intronic
1132469947 16:96993-97015 AGCATGGAAGCTCAGCCAGAGGG + Intronic
1135229495 16:20692363-20692385 AGCCTGGAAGCCCCCACTTTAGG - Intronic
1135405361 16:22193850-22193872 ATCCAGAAAGATCCCACAGAGGG - Intergenic
1135651598 16:24211063-24211085 TGGAGGGAAGCTCCCACAGAAGG - Intronic
1138121126 16:54401825-54401847 AGCCAGGAAGATCCCAGGGAGGG - Intergenic
1138315721 16:56068390-56068412 AGCCTGGAACCTCCTCCTGAGGG + Intergenic
1138445595 16:57061274-57061296 AGACAGGAAGCTCCCAGAGCAGG + Intronic
1139983877 16:70882017-70882039 AGCCTGGCAGCCCCCTGAGATGG + Intronic
1140589633 16:76336372-76336394 AGCTTGAAATCTTCCACAGAAGG + Intronic
1141106975 16:81241958-81241980 AGCCTGGCACCTCCCACATAGGG + Intronic
1141920352 16:87131659-87131681 AGCCTGGCAAATACCACAGAAGG + Intronic
1142795473 17:2303769-2303791 AGCCAGGAAACCACCACAGACGG + Exonic
1143652358 17:8271324-8271346 AGCCTGGAAGGTTCACCAGAGGG - Intergenic
1146255238 17:31388517-31388539 AGCCTGGATGCTCCCAGACTAGG + Intergenic
1146985232 17:37209871-37209893 AGCCTGGAAACCTCCACACAGGG + Intronic
1147572321 17:41579083-41579105 AGCTTGGAGGCTGCCACAAAGGG - Intergenic
1148129635 17:45255080-45255102 AGCCCCGCAGCTCCCATAGAGGG - Intronic
1148355016 17:46969755-46969777 GGCCTGGGAGTCCCCACAGAGGG - Intronic
1149015828 17:51907360-51907382 AGCCGGGAAGGCCCCACTGAAGG - Intronic
1152133018 17:78488600-78488622 ACCCTGAAAACTCCCACACATGG + Intronic
1152739838 17:82014053-82014075 AGCCTGAGAGCTCCAACAAACGG - Intronic
1152810289 17:82378634-82378656 AGCCACGAAGCTCCAAAAGAGGG + Intergenic
1153820437 18:8827144-8827166 AGCCAGGCTGCTCCCGCAGATGG + Intronic
1153961785 18:10146472-10146494 AGCCTGGATGCTCTTCCAGATGG + Intergenic
1155909050 18:31487463-31487485 GGCCTGGAGGCCCCAACAGAAGG - Intergenic
1156494634 18:37517790-37517812 ACCCTCGGAGGTCCCACAGAGGG - Intronic
1157709904 18:49843062-49843084 TGCCTGGCAGTTCCCAGAGAAGG - Intronic
1158052650 18:53241792-53241814 TGCCTGGCAGATCACACAGAGGG - Intronic
1158841662 18:61394546-61394568 GGCCTGGAACATCCCTCAGAAGG + Intronic
1160659661 19:291973-291995 CGCCTGGAAACTCCGACAGCAGG + Intergenic
1162930088 19:13953220-13953242 AGACTGGAAACTCCCAGAGCTGG + Intronic
1163149373 19:15401923-15401945 GGCGTTGCAGCTCCCACAGATGG - Intronic
1163311735 19:16519099-16519121 AGCCAGGAAGGTCCCACAGCCGG + Exonic
1165975249 19:39670736-39670758 AGCCTAGAAACACTCACAGAGGG - Intergenic
1168174021 19:54609645-54609667 AGCGTGGAAGTGCACACAGAGGG + Intronic
1168678373 19:58295489-58295511 AACATGGAAGCACCCACAGAAGG - Exonic
925104503 2:1279143-1279165 AGCCTGGATGCACTGACAGAGGG - Intronic
926044146 2:9697351-9697373 ATCCTGCAAGCTTCCAGAGACGG - Intergenic
927853343 2:26513422-26513444 AGGCTGGAATCTTCCACGGATGG - Intronic
931843390 2:66177651-66177673 AGCCTGGAAGCTCGAACTGGGGG + Intergenic
934163508 2:89273951-89273973 AGCCTGGAAGCATCCAGGGAAGG - Intergenic
934203765 2:89908573-89908595 AGCCTGGAAGCATCCAGGGAAGG + Intergenic
935841995 2:107123550-107123572 AGCAAGGCAGGTCCCACAGAAGG - Intergenic
937968581 2:127533332-127533354 CTCCTGGCAGCTCCCAGAGATGG - Intergenic
942134801 2:172914278-172914300 AGCTAGGAACCTCCCTCAGAGGG - Intronic
942495878 2:176539425-176539447 AGCTTGGAAGATTGCACAGAAGG - Intergenic
948671344 2:239570718-239570740 AGCAGGGAAGCACCCCCAGAAGG - Intergenic
948998555 2:241597688-241597710 AGCCAGGAAGCACACACAGAAGG - Intronic
1168974337 20:1952993-1953015 AGCCTGGGAGCCCTCAAAGATGG + Intergenic
1170142847 20:13142418-13142440 ACCCTGGAAGATGCTACAGATGG - Intronic
1170274606 20:14570754-14570776 AAACTGAAATCTCCCACAGAAGG - Intronic
1170430567 20:16272890-16272912 AGCCTGGGACCTCCCAAAGTGGG - Intronic
1172775385 20:37403896-37403918 AGCCTGGAAGCAGCGGCAGAGGG - Exonic
1173001643 20:39109714-39109736 ACCCTGGAGGCTCCCGCAGCTGG - Intergenic
1173001681 20:39109811-39109833 ACCCTGGAGGCTCCCCCAGCTGG - Intergenic
1175893156 20:62324157-62324179 AGCCTGGCAGCGCTCACAGTGGG + Exonic
1175899604 20:62354812-62354834 AGCCTGGAGGCTCCAAGGGAGGG + Intronic
1176849512 21:13902003-13902025 AGGGTTGAAGCCCCCACAGAGGG - Intergenic
1177372101 21:20217940-20217962 AGCCTGGCAGGTCCCAGACAAGG - Intergenic
1178850500 21:36208774-36208796 GGCCAGGACGCTCCCCCAGAGGG - Exonic
1179800576 21:43809901-43809923 AGCCCGGAAGTTCCCCCAGAGGG + Intergenic
1181010050 22:20035007-20035029 GCCCTGGAAGCGCCCACAGGGGG - Intronic
1182512034 22:30826605-30826627 AGGCTGTAAGCTACCAGAGATGG + Intronic
1183562793 22:38589640-38589662 ATCCTAGAAGTTCCCACAGCTGG + Intronic
1185101492 22:48843256-48843278 ATCCTGGAGGCTTCCCCAGAGGG + Intronic
1185131758 22:49043447-49043469 CCCCTGGCATCTCCCACAGAGGG - Intergenic
950196883 3:11015597-11015619 AGGCAGGCAGCTCCTACAGAGGG - Intronic
950563267 3:13748437-13748459 AGCTTGGATGCTCACATAGAGGG - Intergenic
950677949 3:14565800-14565822 AAACTGGAAGCCCACACAGAGGG + Intergenic
951136138 3:19106609-19106631 AACCTGGAAGCTCCCTGAGCTGG - Intergenic
951731699 3:25816470-25816492 AGCCTGGAAGTTCCCACCTTGGG + Intergenic
953234769 3:41096483-41096505 TAGCTGGAAGCACCCACAGAAGG - Intergenic
953383262 3:42490098-42490120 AGCCTGGGAGCTCCCAGGGCAGG + Intronic
954449786 3:50565614-50565636 GACCTGGAACCTGCCACAGATGG - Exonic
960753163 3:120979197-120979219 AGCCGGGAAGCTCCAACTGGGGG - Intronic
961516756 3:127442791-127442813 AGCCAGGAAGCCCCCAGGGAGGG - Intergenic
965132758 3:164723105-164723127 AGCCTGGCAGCTCCCCTAGGTGG - Intergenic
965711832 3:171563454-171563476 AGCCTGGAGGCTCCCCCTGGGGG + Intergenic
966237836 3:177722087-177722109 AGCCTGAAAGCAGCCATAGAAGG + Intergenic
967821538 3:193843387-193843409 AGCATGAAAGCAGCCACAGATGG - Intergenic
967840194 3:193998983-193999005 GGACTGAAAGCTCACACAGAGGG + Intergenic
968531437 4:1094041-1094063 AGCAAGGAAGCTCCCAGAGGAGG + Intronic
969336789 4:6515419-6515441 AGCCTGGAAGTTAACACTGATGG + Intronic
969673425 4:8601986-8602008 GGCCTGGAAGATCACACAGAGGG + Intronic
972691960 4:41407625-41407647 AGCCTGGCACCTTCCGCAGAGGG - Intronic
973298281 4:48551536-48551558 ACAATGGTAGCTCCCACAGATGG - Exonic
973310727 4:48706880-48706902 AGCTTGAAAGCACCCCCAGAAGG + Intronic
978298191 4:107233673-107233695 AGCTTGAAATCTGCCACAGAGGG + Intronic
979510679 4:121550332-121550354 AGCCTGGAAGCTCGAACTGGGGG - Intergenic
983357427 4:166681521-166681543 AGCCTGGAAGTTTTCCCAGAAGG + Intergenic
984599231 4:181706957-181706979 GTCCTGGAAGTTCCCACATAAGG + Intergenic
984642009 4:182177096-182177118 AGCCTGTAAGCACCCACATGGGG + Intronic
984693812 4:182758703-182758725 AGCCTGTAAGTTCACAAAGAAGG + Intronic
985789973 5:1920916-1920938 AGAGTGGAAACTCCCACAGTGGG - Intergenic
986328577 5:6700963-6700985 AGCCTGGAAGCTACCAGAGCTGG - Intergenic
987142511 5:14960317-14960339 AGGCTGCAAGCTCCCGCAGGAGG + Intergenic
990511892 5:56497177-56497199 AGCCAGGGAGCACCCACAGCAGG + Intergenic
992512349 5:77449840-77449862 AGGTTGGTAGCACCCACAGAAGG - Exonic
993201762 5:84825715-84825737 AGCTTGGAAGATCCCCCAGCAGG - Intergenic
993896953 5:93547031-93547053 AGGCTGGAAACTCACACAGCAGG - Intergenic
993904787 5:93610825-93610847 CACCTGGAAGCTCCCCCAAAGGG + Intergenic
994270622 5:97772127-97772149 AGCCTGGAAGCTCAAACTGGGGG - Intergenic
994563295 5:101406290-101406312 TGCCTGGAACATCTCACAGAAGG - Intergenic
996037988 5:118780197-118780219 AGCCTCAAAGCTACCACAAAAGG + Intergenic
997849296 5:137316534-137316556 GGCCTGGAAGCTAGCAGAGAGGG - Intronic
999401794 5:151269974-151269996 AGGCTGGAAGATCCAACAGAGGG - Exonic
1000158647 5:158577517-158577539 AGCCGGGAAGCTCCAACTGGGGG - Intergenic
1001565174 5:172695486-172695508 CTCTTGGAAGCTCCCACACAGGG + Intergenic
1002018713 5:176347692-176347714 AGCCTTGAAGCCCCCCAAGATGG - Exonic
1002105862 5:176879223-176879245 AGTCTGGGAGCTCCCCCAGCAGG + Intronic
1003157432 6:3608396-3608418 AGCCTGTAAGCTTCCCCAGCAGG + Intergenic
1003849299 6:10205421-10205443 AGCCAGGATCCTCCCACAGTTGG - Intronic
1006210277 6:32387470-32387492 AGGATGGAAAATCCCACAGAAGG - Intergenic
1006848241 6:37078118-37078140 AGCCTGGCTGCTCCCTCACAGGG - Intergenic
1007348194 6:41249080-41249102 AGACTGAAAGCTCCCTGAGAGGG + Intergenic
1007418351 6:41705200-41705222 AGTGTGGAGGCTCCCACAGCAGG + Intronic
1011214211 6:84987688-84987710 AGCCTGGATGCTCCTATAGGAGG - Intergenic
1017132527 6:151120017-151120039 AGCCTGTAAGCTCTCATAAATGG - Intergenic
1017859143 6:158379077-158379099 AGCCTGGACTCTCTCCCAGACGG - Intronic
1017962993 6:159238455-159238477 ACCCCTGAAGCTTCCACAGAAGG - Intronic
1019442160 7:1052860-1052882 ATTCTGGAGGCTCCCTCAGAAGG - Intronic
1020009818 7:4801819-4801841 AGCCTGGGAGCCCCCACGGCTGG + Exonic
1023035514 7:36128113-36128135 AGTCTGGAATCCCCCAAAGAAGG + Intergenic
1023141711 7:37108822-37108844 AGGCTGGCAGTGCCCACAGAAGG + Intronic
1024210090 7:47195802-47195824 AGCCTGGAAGCTTCCTGGGAAGG + Intergenic
1024256889 7:47546064-47546086 AGCCTGGAGCCTCCCCCAGGAGG + Intronic
1024412697 7:49064121-49064143 AATCTGCAAGCTCCAACAGATGG - Intergenic
1026131819 7:67627246-67627268 AGCCTGGAAGCTACCTGAGAGGG + Intergenic
1029276921 7:99411111-99411133 AGCCGGAAAGCACCCCCAGATGG + Exonic
1029371924 7:100155692-100155714 AGCCTGGAAGGCCACACTGAAGG + Exonic
1031190255 7:118540129-118540151 AGCCTATTAGCTACCACAGACGG - Intergenic
1034832581 7:154322117-154322139 AGCCTGGAAAGGCCCACGGAAGG + Intronic
1035061522 7:156073017-156073039 AGCCTGGCTGCTGGCACAGAGGG + Intergenic
1035232184 7:157471895-157471917 AGCATGGGAGATACCACAGAAGG - Intergenic
1035785487 8:2256700-2256722 AGCCTAGAAGCTCCTCCACATGG - Intergenic
1035807321 8:2465016-2465038 AGCCTAGAAGCTCCTCCACATGG + Intergenic
1039208650 8:35186097-35186119 AGACTGGGAGTTCCCATAGAAGG + Intergenic
1043925298 8:86030157-86030179 AGCCTGTAAGCTCCCACTTCAGG + Intronic
1045769670 8:105721156-105721178 AGCCCTGCAGATCCCACAGATGG + Intronic
1049751678 8:144287432-144287454 AGGGTGGAAGCTCCCACTCAGGG - Intronic
1049867381 8:144947604-144947626 ATCCTGGCAGCACCCACAGCAGG + Intronic
1053061647 9:35036527-35036549 AGCCTGAGAGCGCCCACTGACGG + Intergenic
1058071898 9:100609915-100609937 AGGCTGGAAAGTCCCACAGTAGG + Intergenic
1058378843 9:104356787-104356809 AGCATGGAAGATCTCACTGAAGG + Intergenic
1058795922 9:108498261-108498283 AGCCAGGAAGCTCCAACTGGGGG + Intergenic
1060193803 9:121609923-121609945 AGCCTGCAGGTTCCCAGAGAGGG + Intronic
1061165624 9:128920618-128920640 CCCCTGGGAGCCCCCACAGAAGG - Intergenic
1061295464 9:129674583-129674605 GGACTGGAAACTTCCACAGAGGG + Intronic
1061605251 9:131705244-131705266 AGCCAGGGAGCACTCACAGAGGG + Intronic
1062099705 9:134721690-134721712 TGCCTGGAAGGTGGCACAGAAGG + Intronic
1062344034 9:136106700-136106722 AGGCTCGGAGCTCCCAGAGAGGG + Intergenic
1062462909 9:136669305-136669327 GGCCTGGATGCCCCCACAGTAGG + Intronic
1185939174 X:4295381-4295403 ATCATGTAAGCTTCCACAGAAGG - Intergenic
1186469065 X:9807169-9807191 AGCCTGGATGATCCCCCAGCAGG + Intronic
1187493529 X:19774931-19774953 AGCCTTGATGCTCTCATAGAAGG - Intronic
1188233379 X:27695092-27695114 AGGGTGCAAGCTCACACAGAGGG - Intronic
1189033633 X:37474482-37474504 AGGCTGGAAGCTTGCACTGAGGG + Intronic
1190264414 X:48818952-48818974 AGCCTCCTAGCTCACACAGAGGG - Intronic
1190279339 X:48918959-48918981 GGCCCGGAAGCGCCCGCAGACGG + Exonic
1191914370 X:66186228-66186250 AGCCTGGAAGCTCGAACTGGGGG - Intronic
1196007137 X:110849169-110849191 AGCCTGGAAGAACCCAAGGATGG + Intergenic
1198254859 X:134915494-134915516 AGACTGGAGGCTCTCACAGAGGG + Intergenic
1198397158 X:136231722-136231744 AGCGTGGAAGCAGCCCCAGAGGG - Exonic
1199684437 X:150254081-150254103 AGGTTTGGAGCTCCCACAGAAGG + Intergenic
1200149427 X:153944044-153944066 AGCCTGGAAGCTCAGGCACACGG - Intronic
1202270991 Y:23073795-23073817 TGCCTGGAAGCTACCACTCACGG - Intergenic
1202295035 Y:23346887-23346909 TGCCTGGAAGCTACCACTCACGG + Intergenic
1202423986 Y:24707539-24707561 TGCCTGGAAGCTACCACTCACGG - Intergenic
1202446803 Y:24962546-24962568 TGCCTGGAAGCTACCACTCACGG + Intergenic