ID: 1092100896

View in Genome Browser
Species Human (GRCh38)
Location 12:5883006-5883028
Sequence GGCTCACTTGGAACCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092100896_1092100904 28 Left 1092100896 12:5883006-5883028 CCTGCCAGGGTTCCAAGTGAGCC 0: 1
1: 0
2: 1
3: 12
4: 223
Right 1092100904 12:5883057-5883079 CCACCCACCACGTGCCCCATTGG 0: 1
1: 0
2: 0
3: 10
4: 132
1092100896_1092100899 -4 Left 1092100896 12:5883006-5883028 CCTGCCAGGGTTCCAAGTGAGCC 0: 1
1: 0
2: 1
3: 12
4: 223
Right 1092100899 12:5883025-5883047 AGCCTGAGCTCCTTATCAGTAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1092100896_1092100900 -3 Left 1092100896 12:5883006-5883028 CCTGCCAGGGTTCCAAGTGAGCC 0: 1
1: 0
2: 1
3: 12
4: 223
Right 1092100900 12:5883026-5883048 GCCTGAGCTCCTTATCAGTAGGG 0: 1
1: 0
2: 2
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092100896 Original CRISPR GGCTCACTTGGAACCCTGGC AGG (reversed) Intronic
900318492 1:2070871-2070893 GTCTCACTTGGAGCAATGGCGGG + Intronic
900600401 1:3500314-3500336 GGCTCACTTGGAGCCGCAGCAGG - Intronic
900601917 1:3506353-3506375 GGCTCACCTAGTGCCCTGGCGGG - Intronic
902278318 1:15355677-15355699 TGCTCACTGGGGACACTGGCAGG - Intronic
902901040 1:19516378-19516400 GGCTGACCAGGAACCATGGCTGG + Intergenic
904720672 1:32505673-32505695 GGATCACTTGAATCCCTGGGAGG - Intronic
906641438 1:47443230-47443252 GGCTCACTAGGCATCCTGGGAGG + Intergenic
909955826 1:81777731-81777753 GTCTCACTTGTCACCCAGGCTGG - Intronic
911014466 1:93317545-93317567 GGCTCAGCTGGAACACTGGGAGG - Intergenic
912435723 1:109659782-109659804 GGAACACTTGGAACACTGGAGGG - Intronic
912773178 1:112484329-112484351 GTCTCACTTGTCACCCAGGCTGG + Intronic
914225055 1:145713289-145713311 AGCACACTTGGAATCCTGGTTGG - Intergenic
914462070 1:147894164-147894186 GTCTCACTTGTCACCCAGGCTGG - Intergenic
916994779 1:170284720-170284742 GGCACACTTGAGACCCTGGGAGG - Intergenic
917319679 1:173766610-173766632 GTCTCACTTTGCACCCAGGCTGG - Intronic
918444183 1:184600194-184600216 GTCTCACTTGTCACCCAGGCTGG + Intronic
919679175 1:200417472-200417494 GTCTCACTTGTCACCCAGGCTGG + Intergenic
919723724 1:200867525-200867547 GGCTCACTCCGTTCCCTGGCTGG - Intergenic
920538788 1:206761442-206761464 GGCCTCCTTGGCACCCTGGCTGG - Intergenic
921106717 1:211988225-211988247 GCCTCACTTTGAGCCCAGGCTGG - Intronic
922797767 1:228349694-228349716 GGCTGACCTGCAACCCTGGAGGG - Intronic
923375551 1:233358316-233358338 GGCTTTCTTGGAAAACTGGCTGG + Intronic
923432429 1:233936198-233936220 GGCTAACCTGCAACCCTGGGGGG - Intronic
923835784 1:237609397-237609419 GTCTCACTTGTCACCCAGGCTGG + Intronic
1064679300 10:17793511-17793533 GTCTCACTTGTCACCCAGGCTGG + Intronic
1069220513 10:65877420-65877442 AGCTCACTGGGAACCCTAGCAGG + Intergenic
1072148160 10:92661920-92661942 GTCTCACTTGTCACCCAGGCTGG + Intergenic
1072608650 10:97002697-97002719 GGCTCACTTGTGGCCATGGCAGG + Exonic
1075480593 10:122778106-122778128 GGCTGACTCTGAACACTGGCAGG - Intergenic
1076384016 10:130044471-130044493 GGCTCCCTGGCAGCCCTGGCTGG - Intergenic
1080740220 11:35057082-35057104 AGCTCACTTTGAACTCTAGCAGG + Intergenic
1080759538 11:35235172-35235194 CTCTTACTTGGAACCCTGTCAGG - Intergenic
1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG + Exonic
1084882943 11:72184952-72184974 ATCTCACTTGGCACCCAGGCTGG - Intergenic
1090777657 11:129979495-129979517 GTCTCCCTTGCAACCCTGGAAGG - Intronic
1090924140 11:131234845-131234867 TGCACACTTTGAACCCTGTCAGG - Intergenic
1092100896 12:5883006-5883028 GGCTCACTTGGAACCCTGGCAGG - Intronic
1094468755 12:30782645-30782667 GCCTCACTTGGATGTCTGGCAGG + Intergenic
1095463525 12:42466904-42466926 GTCTCACTTGTAGCCCAGGCTGG + Intronic
1096260751 12:50089199-50089221 GGTTCACTTGGAGTGCTGGCTGG - Intronic
1096342443 12:50812793-50812815 GTCTCACTTGTCACCCAGGCTGG - Intronic
1096391061 12:51229440-51229462 GTCTCACTTGTCACCCAGGCTGG + Intergenic
1096540881 12:52306312-52306334 AGCACACTGAGAACCCTGGCAGG - Intronic
1096849255 12:54425141-54425163 GGGACACTTGGAACCTTTGCAGG - Intergenic
1098258339 12:68641039-68641061 GTCTCACTTGTCACCCAGGCTGG + Intronic
1098589240 12:72190314-72190336 GGCTTACATGGAGCCCTGCCTGG + Intronic
1099241405 12:80143416-80143438 GGATCACTTTGAACACAGGCAGG - Intergenic
1099421737 12:82470236-82470258 GGTTCACTGGGAACCCTTGCAGG - Intronic
1100727805 12:97427508-97427530 GGCTCACTTTGTGCCCAGGCTGG + Intergenic
1102145548 12:110652359-110652381 GTCTCACTTGTCACCCAGGCTGG - Intronic
1103851433 12:123936133-123936155 GGCTGGCCTGGAGCCCTGGCTGG + Exonic
1104039588 12:125121185-125121207 GTGTGACTTGGCACCCTGGCAGG + Intronic
1107393963 13:39996226-39996248 GGCTGACTTGGAACTCTCGATGG - Intergenic
1107646811 13:42502625-42502647 TTCTCACATGGAACCCTGGTTGG + Intergenic
1110171136 13:72501869-72501891 GGCTCATTTGGAAGCCTGGCTGG - Intergenic
1112054554 13:95677667-95677689 GCCTCGCTTGGGACCCTCGCTGG + Intronic
1114662032 14:24353087-24353109 GGCTCACGTGGATCCCAGGTTGG + Intergenic
1114703744 14:24705398-24705420 GGTTCTCTTGGAACACTTGCAGG + Intergenic
1118567382 14:67156940-67156962 GTCTCACTTGTCACCCAGGCTGG - Intronic
1119095303 14:71824435-71824457 GGCTCTCCTGGAATCCAGGCAGG - Intergenic
1121250091 14:92493032-92493054 GGCTCCTATGGACCCCTGGCTGG - Intronic
1121953712 14:98195251-98195273 GGCACACTTAGCACACTGGCTGG + Intergenic
1122136143 14:99633983-99634005 GGGACACGTGGAAGCCTGGCGGG + Intergenic
1122756209 14:103982382-103982404 AGGTCACTAGGGACCCTGGCAGG - Intronic
1123927110 15:25126266-25126288 GTCTCACTTTGCACCCAGGCTGG + Intergenic
1124175251 15:27418173-27418195 GGCTCACAGGGTCCCCTGGCCGG - Intronic
1124220208 15:27844537-27844559 GTCTCACTTGTCACCCAGGCTGG + Intronic
1125582049 15:40792922-40792944 GTCTCACTTGTCACCCAGGCTGG + Intronic
1125736719 15:41932279-41932301 CACTCACGTGGAGCCCTGGCGGG - Intronic
1126914443 15:53449996-53450018 GGCTCACTTAGCACTGTGGCTGG + Intergenic
1128261595 15:66236678-66236700 GGCTCACTGGGGACCCTTCCTGG - Intronic
1128450500 15:67803497-67803519 GGCTCCCCTGGGACCCTGGCAGG - Intronic
1128884306 15:71272366-71272388 GTCTCACTTTGTCCCCTGGCTGG - Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1129855323 15:78820081-78820103 GTCTCACTTGTCACCCAGGCTGG - Intronic
1130352587 15:83105603-83105625 GGCTGGCTTGGGAGCCTGGCTGG + Intergenic
1131034021 15:89209413-89209435 GTCTCACTTGTCACCCAGGCTGG - Intergenic
1131150760 15:90046038-90046060 GGGCCCCTGGGAACCCTGGCTGG - Intronic
1132762304 16:1515590-1515612 GTCTCACTTGTTACCCAGGCTGG + Intronic
1134536541 16:15030979-15031001 GTCTCATTTGTCACCCTGGCTGG + Intronic
1135544326 16:23355565-23355587 GGCAGGATTGGAACCCTGGCAGG - Intronic
1140613746 16:76634174-76634196 GTCTCACTTGTCACCCAGGCTGG - Intronic
1140960028 16:79902813-79902835 GGCTCACTGGGGACTCTGCCTGG + Intergenic
1141663604 16:85454412-85454434 GGCCCACTGGCAAGCCTGGCTGG - Intergenic
1141689558 16:85588509-85588531 GCCTCATTTGGAGCACTGGCCGG - Intergenic
1141832154 16:86515853-86515875 CACTCACTTGGCGCCCTGGCTGG + Intergenic
1203138991 16_KI270728v1_random:1747781-1747803 GGCTGTCTTGGGTCCCTGGCTGG - Intergenic
1203144508 16_KI270728v1_random:1791519-1791541 GGCTGGCTTGGATCGCTGGCTGG + Intergenic
1142638649 17:1272287-1272309 GGCCGACTTGGAACCCAGGAAGG + Intergenic
1142975469 17:3641135-3641157 GGGTCAGTTGGAACACAGGCTGG + Intronic
1143004100 17:3816086-3816108 TCCTCACTTGGATTCCTGGCTGG - Intronic
1144645582 17:16971533-16971555 GGTACAGTTTGAACCCTGGCGGG + Intronic
1144997340 17:19279289-19279311 GGCTCATTGGGAGCCCTGGCTGG + Intronic
1146677766 17:34785233-34785255 ACCTCACTGGGAAGCCTGGCAGG + Intergenic
1147332294 17:39706111-39706133 GGCCCACTTGGACCCCAGCCTGG - Intronic
1147634619 17:41956075-41956097 GTCTCACTTGTCACCCAGGCTGG + Intronic
1148436560 17:47690285-47690307 GACTCAAATGGAACCCTGGCGGG - Intergenic
1149786914 17:59443554-59443576 GTCTCACTTGTCACCCAGGCTGG + Intergenic
1154205480 18:12333385-12333407 GTCTCACTTGTCACCCAGGCTGG + Intronic
1157815032 18:50724039-50724061 GTCTCACTTGTCACCCAGGCTGG + Intronic
1161217856 19:3103559-3103581 GTCTCACTTGTCACCCAGGCTGG + Intronic
1161469830 19:4451380-4451402 GTCTCACTTGTCACCCAGGCTGG + Intronic
1162777539 19:12989030-12989052 GTCTCACTTGTCACCCGGGCTGG - Intergenic
1163771036 19:19191601-19191623 GTCTCACTTGTCACCCAGGCTGG + Intronic
1165178647 19:33948835-33948857 GGCTCAGCAGGAACCCAGGCAGG - Intergenic
1165256326 19:34579006-34579028 GCCTCACCTGGGACTCTGGCTGG + Intergenic
1165259049 19:34597495-34597517 GCCTCACCTGGGACTCTGGCTGG + Intronic
1165266237 19:34665332-34665354 GCCTCACTTGGGACTCTGGCTGG - Intronic
1166322377 19:42026596-42026618 GTCTCACTTGTCACCCAGGCTGG + Intronic
1167363228 19:49041314-49041336 GTCTCACTTGTCACCCAGGCTGG - Intergenic
1167385177 19:49158683-49158705 GGGGAAATTGGAACCCTGGCAGG - Intronic
1168228619 19:55014637-55014659 GGATGACATGGTACCCTGGCTGG - Exonic
1202686789 1_KI270712v1_random:56226-56248 GGCTGACTTGGCTGCCTGGCTGG + Intergenic
925339749 2:3127875-3127897 GGAACACCTGGAGCCCTGGCTGG + Intergenic
927137371 2:20106820-20106842 CGCTCACCTGGAACCCGCGCAGG + Intergenic
927981787 2:27378934-27378956 GCCTCCCCTGGACCCCTGGCTGG + Exonic
932073687 2:68644334-68644356 GGCAGGCTTGGAACCCAGGCGGG - Intronic
932996331 2:76858398-76858420 GTTTCAGTTGGAAGCCTGGCAGG - Intronic
933961130 2:87408476-87408498 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
933961141 2:87408528-87408550 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
933961348 2:87409461-87409483 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
933962001 2:87412552-87412574 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
933962369 2:87414227-87414249 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
933962529 2:87414884-87414906 GGCTGACTTGGCTGCCTGGCTGG - Intergenic
933964336 2:87423022-87423044 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
933964347 2:87423074-87423096 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
933964595 2:87424219-87424241 GGCTGGCTTGGCTCCCTGGCTGG - Intergenic
934244717 2:90296957-90296979 GGCTGACTTGGCTGCCTGGCTGG - Intergenic
934270228 2:91528527-91528549 GGCTTGCTTGGCTCCCTGGCTGG + Intergenic
937291800 2:120786253-120786275 GGCTGACCTGGGACCCTGTCTGG - Intronic
938804612 2:134794817-134794839 GTCTCACTTGTTACCCAGGCTGG + Intergenic
939178583 2:138780101-138780123 GGCTGACTTGGAGCCCAGCCTGG - Intronic
939623941 2:144453350-144453372 GGCCCACTTGGACCCAGGGCAGG + Intronic
940453808 2:153872161-153872183 CGCTCACCTGGAACCCGCGCCGG - Exonic
944040795 2:195351891-195351913 AGCTCACTTAAAACCATGGCAGG + Intergenic
944654187 2:201861588-201861610 GTCTCACTTGTCACCCAGGCTGG + Intronic
944953295 2:204777737-204777759 GGCTCACTTTGACACCAGGCTGG - Intronic
948572940 2:238928702-238928724 GGCTCACCTTGACCCCTGCCAGG + Intergenic
1169753892 20:9023394-9023416 GTCTCACATGTCACCCTGGCTGG - Intergenic
1170881880 20:20304054-20304076 GGCTCACTTGGAACCATATGGGG + Intronic
1172373017 20:34410343-34410365 GTTTCACTTGTCACCCTGGCTGG - Intronic
1172996162 20:39071980-39072002 GGCTGAGTTGGAACTCTGACAGG + Intergenic
1173628571 20:44492232-44492254 GGCTCACTGTGCTCCCTGGCTGG - Exonic
1175221137 20:57417156-57417178 GCCTCTCATTGAACCCTGGCAGG + Intergenic
1178177872 21:30125820-30125842 GGCTCACATGGAAGCTTGGTGGG - Intergenic
1179248133 21:39650653-39650675 GGCTCAGCTGGGACCCTTGCTGG - Intronic
1179622694 21:42627787-42627809 GGCCCACCTGGAGCCATGGCTGG - Intergenic
1180553739 22:16560169-16560191 GGCTGACTTGGGAGGCTGGCTGG - Intergenic
1180555166 22:16566694-16566716 GGCTGGCTTGGATGCCTGGCTGG - Intergenic
1182240456 22:28911954-28911976 GGCTCATTTGGCTCACTGGCTGG - Intronic
1182278587 22:29205737-29205759 GGCTCAGGTGGACACCTGGCGGG + Intergenic
1183673284 22:39285482-39285504 GGCTGACTTGTGGCCCTGGCTGG - Intergenic
1183740704 22:39667011-39667033 GGCTCTCCTGGAACCCTGCGTGG + Intronic
950274791 3:11650634-11650656 AGCTTACTTGAAACCCTGGGAGG - Intronic
951499784 3:23372086-23372108 GTCTCACTCGTAACCCAGGCTGG - Intronic
951569409 3:24046381-24046403 GGCTGACTTGGCACAGTGGCAGG - Intergenic
952961536 3:38594365-38594387 GGATCACTTGGATCCCCAGCGGG - Intronic
953336097 3:42095193-42095215 GCCACACTTGGAAACCTGCCAGG - Intronic
953740719 3:45536533-45536555 GGAGCACTCGGAGCCCTGGCTGG + Intronic
953761653 3:45692351-45692373 GTCTCACTTGTCACCCAGGCTGG + Intronic
956495369 3:69819933-69819955 GTCTCACTTGTCACCCAGGCTGG - Intronic
957964891 3:87309785-87309807 GACTCACCTGGCATCCTGGCAGG - Intergenic
958705994 3:97656130-97656152 GGCTACCTTGGAACTCTGCCAGG - Intronic
961376133 3:126467271-126467293 GGCTGAACTGGAACCCAGGCTGG - Intronic
961787656 3:129357318-129357340 GGTTCACAGGGGACCCTGGCAGG - Intergenic
962117224 3:132523627-132523649 GGCTTTCTTAGAACCCAGGCTGG - Exonic
966796591 3:183720456-183720478 GGCTCACTGGGAACCAGGGAAGG + Intronic
967002428 3:185348990-185349012 GGAGCACTTGGTACTCTGGCCGG + Intronic
972652065 4:41027824-41027846 GGTTCTCTTGGATTCCTGGCAGG + Intronic
977236708 4:94516551-94516573 GTCTCACTTGTTACCCAGGCTGG + Intronic
978000278 4:103548803-103548825 GGCTGATCTGGAACTCTGGCTGG + Intergenic
980435377 4:132764973-132764995 GTCTCACTTGTCACCCAGGCTGG - Intergenic
987287468 5:16471460-16471482 GGCTCAGTTGAAACACAGGCAGG + Intergenic
988759377 5:34297030-34297052 GGGCCCCTTTGAACCCTGGCTGG - Intergenic
988991753 5:36678325-36678347 GGCTCCTTTGAAACCCTGGCAGG + Intronic
989179762 5:38564801-38564823 GTCTCACTTGTCACCCAGGCTGG + Intronic
990470292 5:56109005-56109027 GTCTCACTTGTCACCCAGGCTGG - Intronic
995660215 5:114473748-114473770 GGCACACTTGGAACAGTGCCTGG - Intronic
997953581 5:138260989-138261011 GTCTCACTTGTCACCCAGGCTGG - Intronic
1000808508 5:165829577-165829599 GGATCACTTGGAGCCCGGGAGGG - Intergenic
1001721569 5:173861046-173861068 AGCTTTCTTGGAACCCTGCCTGG - Intergenic
1003216314 6:4116319-4116341 GTCTCACTTGTCACCCAGGCTGG - Intronic
1004720023 6:18260954-18260976 GTCTCACTTGTCACCCAGGCTGG - Intronic
1005160649 6:22858798-22858820 GTCTCACTTGTTACCCAGGCTGG + Intergenic
1005299430 6:24456365-24456387 GTCTCACTTGTCACCCAGGCTGG - Intronic
1006706342 6:36024497-36024519 GGCTCACCTGGCTCCTTGGCGGG + Exonic
1007268049 6:40612061-40612083 GGCTCCTTAGGGACCCTGGCAGG - Intergenic
1012475294 6:99609854-99609876 GTCTCACTTGTCACCCAGGCTGG - Intronic
1013050428 6:106529031-106529053 GGATCACTTGAACCCCTGGGAGG - Intronic
1015596978 6:134875250-134875272 GGCTCTGATGGAAACCTGGCTGG - Intergenic
1018523409 6:164679075-164679097 GTCTCACTTGTCACCCAGGCTGG - Intergenic
1019716762 7:2542752-2542774 AGCCCACCTGGAACACTGGCAGG + Intronic
1020108618 7:5435134-5435156 GTCTCACTTGTCACCCAGGCTGG + Intronic
1022445435 7:30466635-30466657 GTCTCACTTGTCACCCAGGCTGG - Intronic
1023425725 7:40033959-40033981 GGCTCTGGTGGAACCCTGGTAGG + Intronic
1026467779 7:70669211-70669233 GGCTCACATCTAAGCCTGGCAGG + Intronic
1028258285 7:88628493-88628515 GGATCACTATGAACCCTGACTGG + Intergenic
1028989475 7:97034386-97034408 GGCCCACCTGGAACTCTAGCTGG - Intergenic
1029203808 7:98856341-98856363 AGCTGACCTGGAGCCCTGGCTGG - Intronic
1029297533 7:99553240-99553262 CGATGACTTGGAACCCTGGAAGG - Intronic
1030571311 7:111228270-111228292 GGAGCACTTGGAACACAGGCTGG + Intronic
1030944279 7:115696899-115696921 GTCTCCCTTGGCACCCAGGCTGG + Intergenic
1032394160 7:131577143-131577165 GTCTCGCTTGTAACCCAGGCTGG + Intergenic
1032586009 7:133147148-133147170 GTCTCACTTGTCACCCAGGCTGG + Intergenic
1032947652 7:136870794-136870816 GGCAGACTTGGAGCCCTGGGTGG - Intronic
1034489930 7:151387666-151387688 GGCTCCCTTGGAGCCCGGGGAGG - Intronic
1034839837 7:154385609-154385631 GGTTCAGCTGCAACCCTGGCTGG + Intronic
1035363384 7:158328894-158328916 GCCTCACTGGGATCCCTGGGTGG - Intronic
1035363413 7:158329053-158329075 GCCTCACTGGGATCCCTGGGTGG - Intronic
1040600569 8:48879642-48879664 GTCTCACTTGTCACCCAGGCTGG - Intergenic
1042141861 8:65687373-65687395 GTCTCACTTGTCACCCAGGCTGG + Intronic
1043033781 8:75171424-75171446 GTCTCACTTTGCACCCAGGCTGG + Intergenic
1043464604 8:80492506-80492528 GTCTCACTTGTCACCCAGGCTGG + Intronic
1045504242 8:102767380-102767402 GGCCCACGTGGACCACTGGCTGG - Intergenic
1048602010 8:135928661-135928683 GGCTCACTAGGACCTGTGGCAGG + Intergenic
1048995801 8:139793049-139793071 GGCCGCCTTGGACCCCTGGCTGG - Intronic
1050984778 9:12068313-12068335 GTCTCACTTGTCACCCAGGCTGG - Intergenic
1052293677 9:26873210-26873232 TGCTCACTTGTCACCCTGGCTGG - Intronic
1057046602 9:91891286-91891308 GTCTCACTTGTCACCCAGGCTGG + Intronic
1057408808 9:94798103-94798125 GGCTCACTTGTGACCAAGGCAGG - Intronic
1061083570 9:128386339-128386361 AGCTCACTTGGACTCCTGGCTGG - Intronic
1061874225 9:133535901-133535923 GGCTTGCTTTGACCCCTGGCAGG + Intronic
1062010519 9:134264418-134264440 TGCTCACTTGGAAAACTGCCAGG - Intergenic
1188568234 X:31551148-31551170 GTCTCACTCTGCACCCTGGCTGG - Intronic
1191105316 X:56768748-56768770 GGTTCACTGGGAACCCTGCCCGG - Intergenic
1191106309 X:56774150-56774172 GGTTCACTGGGAACCCTGCCCGG - Intergenic
1191107302 X:56779552-56779574 GGTTCACTGGGAACCCTGCCCGG - Intergenic
1192166579 X:68830612-68830634 GGCTCCATTGGACCCCTGACGGG - Intronic
1192335758 X:70217904-70217926 GTCTCACTTGTCACCCAGGCTGG - Intergenic
1192698572 X:73444394-73444416 GTCTCACTTGTCACCCAGGCTGG - Intergenic
1192796697 X:74429440-74429462 GTCTCACTTGTCACCCAGGCTGG - Intronic
1193698330 X:84736389-84736411 GGCTAACTTGTAAGCCTTGCAGG + Intergenic
1197809787 X:130430869-130430891 GTCTCTCTTGGCACTCTGGCTGG - Intergenic
1199673521 X:150165984-150166006 GGCCCCCTTGGAACCCCAGCTGG + Intergenic
1199766721 X:150946800-150946822 GGCCCACCTGGAGCCCAGGCTGG + Intergenic
1200210768 X:154345749-154345771 GTGTCTCTGGGAACCCTGGCTGG + Intergenic
1200220084 X:154386343-154386365 GTGTCTCTGGGAACCCTGGCTGG - Intergenic