ID: 1092100990

View in Genome Browser
Species Human (GRCh38)
Location 12:5883614-5883636
Sequence ATGGAGAAGCAGGGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 681}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092100990 Original CRISPR ATGGAGAAGCAGGGTGTGGA GGG Intronic
900142871 1:1145829-1145851 ATGGAGAGGCCGGGAGTGCAGGG + Intergenic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900365911 1:2311931-2311953 ATGCAGAGGTAGGGTGGGGAGGG - Intergenic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
902560920 1:17277012-17277034 CTGGTGAAGCAAGGTGTGCAGGG - Intronic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902838688 1:19062069-19062091 CTGCAGATGCAGGGTGTGGCTGG - Intergenic
903062917 1:20682852-20682874 TTGGAGCAGCAGGTTGTGGGTGG - Exonic
903124683 1:21239639-21239661 CTGGTGCAGCTGGGTGTGGACGG - Intronic
903153798 1:21430714-21430736 AAGGAGAGCCAGGGTGGGGAGGG - Intergenic
903179811 1:21599510-21599532 GAGGAGACGGAGGGTGTGGACGG - Exonic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
903953928 1:27012205-27012227 ATGGAAAAGCCAGGTGGGGAAGG + Intronic
904076891 1:27850087-27850109 CTGTAGAAGAAGCGTGTGGAGGG + Exonic
904983354 1:34524848-34524870 ATGGGGAAGAAAGGTGAGGATGG - Intergenic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905532671 1:38694537-38694559 TTTGGGATGCAGGGTGTGGAGGG - Intergenic
905800596 1:40839894-40839916 GTGAAGAAGTGGGGTGTGGAGGG - Exonic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906228675 1:44141729-44141751 ATGGAGAAGGAGGGTATGTGGGG - Intergenic
906376915 1:45303656-45303678 AGGGCGGAGCAGGGTGGGGAAGG + Intronic
906721181 1:48005930-48005952 AGGGAGGAGCAGGGGTTGGAGGG + Intergenic
906783200 1:48590777-48590799 ACGGGGAGGCAGGGTGTGGGGGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907265411 1:53256960-53256982 CTTGTGAAGCAGGTTGTGGAAGG + Intronic
907311977 1:53543988-53544010 ATGGAGAACCAAGGGGTGGCGGG + Intronic
907407397 1:54262069-54262091 ATGAAGAAATAGGGTTTGGAAGG + Intronic
908234223 1:62134724-62134746 TTGGAGAACCATGGTCTGGAAGG - Intronic
908432383 1:64071816-64071838 ATGGAGAAGCAGGGTTCTGTGGG + Intronic
908438839 1:64133164-64133186 AAGGAGAACGAGGGGGTGGAGGG + Intronic
908562043 1:65316234-65316256 ATGGAGGTGCAGGCTGGGGAGGG - Intronic
912024448 1:105149905-105149927 AAGCAGAAGCAGGGTTTGAAAGG + Intergenic
912989228 1:114467417-114467439 CTGGAGCTGAAGGGTGTGGAGGG + Intronic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
913176277 1:116275960-116275982 ATTGGGAAGCAAGGTGTGGTGGG - Intergenic
913406910 1:118504374-118504396 ATGGGGGAGTAGGGGGTGGAAGG + Intergenic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914319690 1:146547005-146547027 AAGGAGAAGTGGGGTTTGGAAGG + Intergenic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
915107981 1:153546137-153546159 AAGGAGATGCAGGGGGTGGTGGG + Intronic
915605581 1:156948113-156948135 GAGGAGCAGCTGGGTGTGGATGG + Intronic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916692966 1:167208813-167208835 GTTGAGAAGTAGGGTGTGGTGGG - Intergenic
917660822 1:177175276-177175298 ATGGAAAAGCGGGGTGGGGGGGG + Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
919751723 1:201041875-201041897 ATGGAGAAGCAGGGTTCCAAAGG - Intronic
919816446 1:201443829-201443851 CTGGGGAAGCAGGGTTTGCAGGG - Intergenic
919880684 1:201898713-201898735 TTGGAGAAGTAGGGTGTCCAGGG + Intronic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920555127 1:206899039-206899061 ATGGAGAAGGAGGAGGTGCAGGG + Intronic
920740935 1:208580737-208580759 ATGGAAGAGCAGGGTTTTGAAGG - Intergenic
920903146 1:210132363-210132385 ATGTCCAAGCAGGGTGAGGAGGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921333738 1:214065684-214065706 GTGGAGAAGGGGGGTGTGTAGGG - Intergenic
921808010 1:219478094-219478116 CTGGAGAATGAGGGTGGGGAGGG + Intergenic
921843993 1:219859940-219859962 TTGGAGAAGAAAGGTGGGGATGG - Intronic
921907508 1:220510694-220510716 AGGGATAAGAAGGGTTTGGATGG - Intergenic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923093189 1:230754872-230754894 ATGGAGAAGCTGGGTGGGTAGGG + Intronic
923097741 1:230788865-230788887 ATGGAGATCCAGAGTTTGGAAGG + Intronic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
923907023 1:238395947-238395969 ATGGAGAGGTAGTGTGTGCAAGG - Intergenic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
924754956 1:246932127-246932149 AAAGAGAAGCAGGGCCTGGAAGG + Intergenic
924866257 1:247984811-247984833 CTGGAGATGCATGGTGGGGATGG - Intronic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1062982480 10:1736996-1737018 GTGGAGAAGCCGGGGGTGAAGGG + Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1064462767 10:15551029-15551051 TTGGAGAAGAATGGGGTGGATGG + Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1065281523 10:24143695-24143717 ACGGAGAACCAGGGTGTGATTGG + Intronic
1065359090 10:24872267-24872289 AGGGAGAGGCTGGGTGTGCAGGG + Intronic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065875062 10:29990512-29990534 GTGCAGAAGCAAGGGGTGGAGGG - Intergenic
1066436861 10:35403662-35403684 ATGGTGATGCAGGATATGGAAGG + Intronic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1066954946 10:42157050-42157072 ATGGAGATGGATGGTGGGGATGG + Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067082295 10:43218564-43218586 ATGGAGAGGCAGGGGCTGCAGGG - Intronic
1067201117 10:44172859-44172881 ATGAAGAAGCAGGGGCTGGCGGG - Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1069377562 10:67809269-67809291 AAAGAGACCCAGGGTGTGGATGG - Intronic
1069531086 10:69220160-69220182 AGGGGGAAGCAGGGTATTGATGG - Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071379256 10:85041475-85041497 ATGGAGAGGGATGGTGGGGATGG + Intergenic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072541992 10:96405641-96405663 ATGGAGACGGAGGATTTGGAAGG + Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1074290808 10:112136950-112136972 CTGGGGATGCTGGGTGTGGAGGG - Intergenic
1074552173 10:114454469-114454491 ATGAGAAAGGAGGGTGTGGAAGG + Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075304126 10:121352489-121352511 AAGGAGAAGGAGGGTCTTGATGG + Intergenic
1075561621 10:123472664-123472686 AGGGAGAAGCAAGGAGGGGATGG + Intergenic
1075661841 10:124202695-124202717 CTGGAGAGGCAGGGTCTGCATGG + Intergenic
1076493346 10:130879148-130879170 ATGGAGCAGAAGGGAGTGGAAGG + Intergenic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1077707150 11:4497661-4497683 ATGGAAAACTAGGCTGTGGAGGG + Intergenic
1078019143 11:7640862-7640884 ATGGAGAAGGAGGGGGTGAGTGG - Intronic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078829076 11:14961771-14961793 GTGGAAAAGCAGTGTGTAGAGGG + Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080582687 11:33656950-33656972 ATAGAGAAACAGGGGCTGGAGGG - Intronic
1080772562 11:35355344-35355366 ATGCAGTAGGAGGGTGTGAAGGG - Intronic
1080878890 11:36301115-36301137 ATGGAAAAGCATGGTGTGCTTGG + Intronic
1081693777 11:45095297-45095319 AAGGAGGAGGTGGGTGTGGAGGG - Intergenic
1081810020 11:45909356-45909378 ATGGAGGACCAAGGTGTAGATGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1082937774 11:58672276-58672298 AAGGTGAAGCAGGGACTGGAAGG - Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084468452 11:69341066-69341088 ATGGAGAAGCACGTTGGAGAAGG + Intronic
1084489955 11:69472819-69472841 AAGGAGCAGCAGGCTGTGAAAGG + Intergenic
1084680706 11:70664648-70664670 TTGGAGATGCAAGGTTTGGATGG - Intronic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1084870903 11:72098002-72098024 ATGGAGAAGGAGGGAATGAAGGG + Intronic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085312923 11:75526445-75526467 AGGGAGAAGCAAGGTGTCGGTGG - Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086944951 11:92835909-92835931 ATGGGGAAGGATGGTGAGGAGGG - Intronic
1086971233 11:93083285-93083307 ATGGAGGAGGAGTGCGTGGAAGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1090414099 11:126528850-126528872 ATGGAGAGGGAGGGGGTGGGTGG + Intronic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1091180864 11:133603350-133603372 GAGGAGGAGCAGGGGGTGGAGGG + Intergenic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1091792312 12:3278922-3278944 GAGGACAAGGAGGGTGTGGAAGG - Intronic
1091936690 12:4440451-4440473 ATGGAGAAGGATGGGGTGGAAGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1093502584 12:19828955-19828977 ATGGATGAGGATGGTGTGGAAGG + Intergenic
1093950926 12:25164414-25164436 AGGGAGAAGAAGGGAATGGAGGG - Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1097188048 12:57206086-57206108 ATGGAGCACGAGGGTGTGCATGG - Intronic
1097284060 12:57864370-57864392 ATGGAAAGGCAGGGTGGAGAAGG - Intergenic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1098450208 12:70610406-70610428 GGGGAGACGCTGGGTGTGGAGGG - Intronic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1099247324 12:80208692-80208714 ATGGAAAAACAGGGTGTGAAGGG + Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099709100 12:86197041-86197063 ATGTAGAAGCACAGTGTTGAAGG - Intronic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100825057 12:98467325-98467347 ATGGACAAGAAGGCTTTGGAGGG + Intergenic
1101780771 12:107832938-107832960 ATGGATAAACAGTGAGTGGACGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103273763 12:119694884-119694906 ATGGAGAAACAGGTTGTGAGAGG - Intronic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1105260626 13:18776674-18776696 ATGGAGAAGCATGGGGTTGGAGG - Intergenic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1105889533 13:24672607-24672629 ATGGAGGAGCAGGGCCTGGCTGG - Intergenic
1106591688 13:31103949-31103971 ATGGAGGGGCAGGGTGTTGGTGG + Intergenic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1107045079 13:35985183-35985205 GTGGAGAAGGATGATGTGGAAGG - Intronic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108468272 13:50740997-50741019 ATGGGGAAGCAGGTGGTGGTAGG - Intronic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1111233782 13:85380891-85380913 AAGCAGCAGCAGGGTTTGGAAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113539349 13:111094085-111094107 ATGCAGAAAAAGGGTATGGAAGG + Intergenic
1113596439 13:111537375-111537397 TTGCAGAGGCAGGGTCTGGAAGG + Intergenic
1116435082 14:44887339-44887361 GTGTGGACGCAGGGTGTGGATGG + Intergenic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119888215 14:78162260-78162282 CTGGAGAAGGAGGGTGCAGATGG + Intergenic
1119944503 14:78678433-78678455 CTGGAGTAGCTGGGTGTGGTGGG - Intronic
1120309459 14:82811186-82811208 ATGTAGAAGGAGGATATGGAGGG - Intergenic
1120541258 14:85753647-85753669 ATGGAGGAGCAAGTTGTGGTTGG + Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1120993393 14:90397645-90397667 GCGGAGAAGCGGGGTGGGGAGGG - Intronic
1121404773 14:93712982-93713004 GTGGGGATGCAGGGTGTGGGGGG + Intergenic
1121414199 14:93767747-93767769 ATGGAGAGGGGGGGTGTGTAGGG - Intronic
1121898132 14:97667896-97667918 GTGGAGTAGCAGGGGGTAGAGGG - Intergenic
1122362200 14:101174185-101174207 ATGGAGGCCCAGGGTGGGGATGG - Intergenic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1122916028 14:104859391-104859413 GTGGAGATGCAGGGTGGTGATGG - Intergenic
1122916136 14:104859827-104859849 ATGGAGATGGAGGGTGGAGATGG - Intergenic
1122916212 14:104860187-104860209 ATGGAGATGGAGGGTGGTGATGG - Intergenic
1123415044 15:20089173-20089195 AGGGAGAAGTGGGGTTTGGATGG + Intergenic
1123524386 15:21096287-21096309 AGGGAGAAGTGGGGTTTGGATGG + Intergenic
1123834619 15:24176800-24176822 GTGGAGATGCAGGGAGTGAAAGG + Intergenic
1123854319 15:24392472-24392494 GTGGAGATGCAGGGAGTGAAAGG + Intergenic
1123870337 15:24565649-24565671 GTGGAGATGCAGGGAGTGAAAGG + Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127660434 15:61095581-61095603 ATGGAGAATGAGGTTGTGCAAGG + Intronic
1128241080 15:66101366-66101388 CTGGAGATGCAGGTTGTAGATGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1131340857 15:91599260-91599282 ATGGAAGGGCAGGGGGTGGAGGG + Intergenic
1131868820 15:96740514-96740536 ATGGAGTAGAAGGGTGTGGAAGG - Intergenic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132663878 16:1073030-1073052 ATGGAGCTGCTGGGAGTGGATGG - Intergenic
1132855480 16:2042872-2042894 ATGGGGGAGGAGGGTGGGGAGGG - Intronic
1133024489 16:2982043-2982065 ATGGAGCAGCAGTGTGGGGGAGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133581150 16:7145811-7145833 ATGGAGAAGTAGTGTGTGTGCGG - Intronic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1134491852 16:14701594-14701616 ATGGAGAGGCTGGGTGTGTGTGG + Intergenic
1134497233 16:14740712-14740734 ATGGAGAGGCTGGGTGTGTGTGG + Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135591299 16:23706765-23706787 ATGTAGAGGCGGGGGGTGGAGGG + Exonic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1135979372 16:27135403-27135425 AAGGAAAAGCAGGGGGTGGTGGG - Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136568608 16:31084077-31084099 CTGGAGAGGCAGGGTTTGGCAGG + Exonic
1137625036 16:49902273-49902295 ATGGAGAAGAATGTTGTAGATGG + Intergenic
1137639254 16:50013928-50013950 ATGGTGAAGCAGGGGAGGGAAGG - Intergenic
1137655489 16:50154450-50154472 CAGGAGACGGAGGGTGTGGACGG - Intronic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140013837 16:71163070-71163092 AAGGAGAACTAGGGTTTGGAAGG - Intronic
1140151940 16:72376302-72376324 AAGGAGAAGCAGGGTGCTAAGGG + Intergenic
1141000450 16:80302666-80302688 ATGGACAAGCAGGCTGGGCATGG - Intergenic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141392732 16:83678230-83678252 TTTGATCAGCAGGGTGTGGAAGG - Exonic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141879644 16:86849310-86849332 AAGGTGAGGCAGGGTGTGAAAGG - Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143161500 17:4874687-4874709 ATGGAGCATCTGGGTGGGGAGGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1145791829 17:27632258-27632280 GTGGGGAGGCAGGGTGGGGAGGG + Intronic
1146289753 17:31598742-31598764 GTGGAGTCGCAGGGTGTGGGGGG + Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146552368 17:33792346-33792368 AAAGAGAAGCCGGGAGTGGAGGG - Intronic
1146801216 17:35824635-35824657 ATGGAGTAGAAAGGTGGGGATGG + Intronic
1146827240 17:36033434-36033456 ATGGAGCAGCATGGTGGGGAAGG - Intergenic
1146919737 17:36702681-36702703 ATGGAGCAGCAGGGTTGGGCAGG + Intergenic
1147146899 17:38490686-38490708 ATGTAGGAGCGGGGTGGGGACGG - Intronic
1147162056 17:38574056-38574078 TGGGGGAAGCAGGGTGTGTAAGG + Intronic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147597586 17:41726908-41726930 ATAGAGAAGCAATGAGTGGAGGG + Intronic
1147836748 17:43338306-43338328 ATGGATAACCAGGCTGTGGAGGG + Intergenic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149363828 17:55920843-55920865 TTGGGGAAGTAGGGTCTGGAAGG - Intergenic
1149387557 17:56156966-56156988 AGGGAGAAGAATGGTGTAGATGG - Intronic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151355833 17:73558015-73558037 ATAGAGCAACAGGGTGAGGAGGG - Intronic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1151569823 17:74920720-74920742 ATGGAGGTGGAGGGAGTGGAGGG + Intronic
1152859107 17:82685269-82685291 AGGGAAAAGGAGGGTGGGGAGGG + Intronic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153633847 18:7097224-7097246 ATAAAGAAGCCTGGTGTGGATGG - Intronic
1153712381 18:7812776-7812798 ATGGAGAAATTGGGTCTGGATGG + Intronic
1153772336 18:8426002-8426024 ATGGAGATGCAGGGTTTTGTGGG + Intergenic
1153891902 18:9524770-9524792 ATGCAGAGGCAGGCTGTGGCAGG - Intronic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1154073747 18:11179002-11179024 ATGGAGCGGGAGGGTGTGGGTGG + Intergenic
1155064669 18:22258074-22258096 ATGCAGAAGCCAGGTGTGCACGG + Intergenic
1155181913 18:23355360-23355382 ATGGGCAAGCAGGGTGTAGAGGG - Intronic
1156453323 18:37279022-37279044 ATGGAGGAGGAGGGTGGGCACGG - Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1157175364 18:45446927-45446949 GATGAGAAGCAGGGTGGGGAGGG - Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158545040 18:58389042-58389064 ATGTAAAAGCAGGATGTGAAAGG - Intronic
1158621743 18:59038617-59038639 GAGGAGAAGCAGGGTCTGGAGGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159196192 18:65118911-65118933 ATGGAGATTTAGGATGTGGAGGG - Intergenic
1159938152 18:74384951-74384973 TTAGAGAAGCACAGTGTGGAAGG - Intergenic
1160393885 18:78558281-78558303 CTGGAGATGTAGGGTGGGGAGGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160689854 19:456477-456499 AGGGAGGAGGAGGGTCTGGAAGG - Intronic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1160986332 19:1840682-1840704 TTGGAGTTGCAGGGAGTGGAGGG - Intronic
1161305710 19:3566417-3566439 AGGGAGAGTCAGGGTGTGGTTGG - Intronic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161473843 19:4473819-4473841 ATGTAGAAGCTGGTTTTGGAGGG + Intronic
1161770837 19:6229999-6230021 ATGGAGGAGGGGGGCGTGGAGGG - Intronic
1162125201 19:8495850-8495872 AGGGACATGCAGGGAGTGGAGGG + Intronic
1162273851 19:9637713-9637735 ATGGTGATGTAGGATGTGGAAGG + Intronic
1162473799 19:10887964-10887986 AATGAGAGCCAGGGTGTGGAGGG + Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163440376 19:17319759-17319781 GTGTGGACGCAGGGTGTGGATGG - Exonic
1164081136 19:21862346-21862368 ATGGAGGTGAAGGATGTGGAAGG - Intergenic
1164207512 19:23070851-23070873 CTGGGGAAGCATGGTATGGATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166379962 19:42350693-42350715 AAGAGGAAGCAGGGTGTCGAGGG - Intronic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1167347182 19:48953955-48953977 ATAGATCAGCAGGGTATGGAGGG - Intergenic
1168405943 19:56110790-56110812 GTGGAGAGGAGGGGTGTGGAGGG - Intronic
1168479450 19:56706787-56706809 ATGAAGACTCAGGGTGTGGAGGG - Intergenic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
925572992 2:5331523-5331545 CTGGGGAGGCAGGGTGTGTAGGG + Intergenic
925894416 2:8460322-8460344 ATGGAGCAGCGGGGGGTGGAGGG - Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926329111 2:11810329-11810351 ATGGAGGAGCAGGGTTTCAAAGG + Intronic
927640439 2:24842204-24842226 ATGGCAGAGCAGGCTGTGGAGGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
927886703 2:26723272-26723294 AGGGAGATGCGGGGTGGGGATGG - Intronic
928079838 2:28301092-28301114 ACAAAGAAACAGGGTGTGGAAGG - Intronic
929011508 2:37449839-37449861 AAGGGGAGGCAGGGCGTGGATGG - Intergenic
929383888 2:41382492-41382514 ATGGTGATGCAGGATATGGAAGG - Intergenic
929836549 2:45406229-45406251 ATGGAGGAGCAGTGTAGGGAAGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
931830492 2:66045916-66045938 ATCCGGCAGCAGGGTGTGGATGG + Intergenic
932282951 2:70510400-70510422 TTGGAGAGCCAGGGTGGGGAGGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933043588 2:77503318-77503340 ATGGAGTATGAGGGTGAGGATGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933987463 2:87603766-87603788 ATGGAGCTCCAGGGTTTGGAAGG + Intergenic
935248594 2:101240900-101240922 ATGGAAAGGCAGGGTATGTAGGG + Intronic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936306376 2:111347042-111347064 ATGGAGCTCCAGGGTTTGGAAGG - Intergenic
936467470 2:112766036-112766058 CTGGAGAAGTCGTGTGTGGAGGG + Intergenic
937098722 2:119252367-119252389 AGGGGGTGGCAGGGTGTGGAAGG - Intronic
937209849 2:120261373-120261395 AAGGAGAAGAAGGGCGTGGAAGG + Intronic
937367358 2:121273324-121273346 AGGGATGAGGAGGGTGTGGAGGG - Intronic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937496876 2:122429594-122429616 CTAGAGAAGCAAGGTTTGGAAGG - Intergenic
938063023 2:128266961-128266983 AAGGAGAGCCAGGGTGGGGAGGG + Exonic
938199350 2:129360480-129360502 CTAGAGAAGCAGTGTGGGGAGGG - Intergenic
938258331 2:129877711-129877733 AGGGCGAAGCAGGGAGGGGAGGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938546940 2:132342165-132342187 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
938825139 2:134997189-134997211 ATGGTGAAGCAGTGTTTTGATGG - Intronic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
940945863 2:159616409-159616431 ACGGAGAAGGAGGGAGTCGAAGG - Exonic
941518920 2:166513326-166513348 ATGGAGAGGTGGGGTTTGGAAGG - Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
946412015 2:219520163-219520185 GTGGAGAAGGAGGGTCGGGAGGG - Intronic
946431688 2:219629810-219629832 AAAGAGGAGCAGGGTGTGGGAGG + Intronic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947233886 2:227920031-227920053 ATGGAAAAGTGGGGTGTGGGAGG + Intronic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947598804 2:231431789-231431811 ATGGTGGAGCAGGATATGGAAGG + Intergenic
947722539 2:232378615-232378637 AGGGAGTGGCAGGGTGTGGCTGG - Exonic
947726876 2:232406708-232406730 AGGGAGTGGCAGGGTGTGGCTGG - Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948882234 2:240865470-240865492 TTGGAGTAGCAGGTTGTGGACGG - Intergenic
948962396 2:241350121-241350143 ATGCAGATGCAGGGCGGGGATGG + Exonic
1168805099 20:667964-667986 TTGGAGGAGCTGGGAGTGGAGGG - Intronic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1168888355 20:1276087-1276109 AGGGAACAGGAGGGTGTGGAGGG - Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170117584 20:12877124-12877146 ATGGAAAAGCAGGGGATGGAGGG + Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170680588 20:18522075-18522097 AGGGAGAAGAAGGGAATGGAGGG + Intronic
1171138460 20:22719555-22719577 AGGGAAAAGCAGGGTGGGGTGGG + Intergenic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1171752280 20:29062955-29062977 ATGGAAGGGCAGCGTGTGGAAGG - Intergenic
1171875805 20:30574898-30574920 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
1172572427 20:35981091-35981113 AAGGAGAATCAGGGTGTGATTGG + Intronic
1173005358 20:39135857-39135879 TTGGGGATGCAGGGTGTGGCAGG + Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1174478098 20:50811531-50811553 ATGGAGTGGCAGGGAGAGGAGGG - Intronic
1174607190 20:51769168-51769190 ATAGAGAATGAGGGTGAGGATGG - Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175433735 20:58927768-58927790 TTGGTGTAGCAGGGAGTGGAAGG - Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1176122019 20:63458257-63458279 GTGGAGAAGCTGGGTGGGAATGG + Intronic
1176304050 21:5114224-5114246 ATGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176945270 21:14972717-14972739 ATGGAGTAGCGGGGTGGAGATGG + Intronic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1179022330 21:37651539-37651561 ATGCAGAGGAAGGGAGTGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1180870549 22:19144379-19144401 GTGGAGGAGCCGGGTGTGGACGG - Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1182404667 22:30115797-30115819 ATGAAGAAGGAGGGATTGGATGG + Intronic
1182545064 22:31070375-31070397 AGGGAGAAGTGGGGTTTGGATGG - Intronic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1182790961 22:32952312-32952334 GTGGACAGGCAGGGTGGGGAGGG + Intronic
1182959396 22:34457939-34457961 ATGGAGATGAAAGGTGTGGTTGG + Intergenic
1183029861 22:35095479-35095501 ATGGAGAAGGAGGTTGGGAATGG + Intergenic
1183153088 22:36053514-36053536 AGGGAGAAGCAGGGAAGGGAAGG - Intergenic
1183324520 22:37184118-37184140 CTGGGGAAGCTGGGTGGGGAGGG + Intronic
1183519012 22:38285505-38285527 ATGGGGGAGCGGGGTGTGGAAGG + Intergenic
1183733080 22:39629188-39629210 GTGGAGCACCAGGGTGAGGACGG - Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1203308925 22_KI270736v1_random:128916-128938 ATGGAGAGGAGGGGAGTGGATGG + Intergenic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950670315 3:14521877-14521899 ATGAAGAAGCAGGGAATGGGTGG + Intronic
950764136 3:15260748-15260770 CTGGAGAGGCAGGGTGGGCATGG + Intronic
950843044 3:15986596-15986618 ATGGAGGAGCATGGTGTATATGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
952343296 3:32462990-32463012 ATGGAGGTGCAGGATATGGAAGG + Intronic
952830204 3:37558451-37558473 ATAGAGAAGCAAGGGGTGGGAGG - Intronic
952841538 3:37650734-37650756 ATGGTGGGGCTGGGTGTGGATGG - Intronic
953059312 3:39414128-39414150 ATGGAGAGGCTGGGTTTGCATGG - Intergenic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953926757 3:46986458-46986480 CTGGAGAAGCAGGTTCTGGTTGG + Intronic
954384447 3:50236905-50236927 AAGGAGAAGGAGGGAGTGGGTGG - Intronic
954415905 3:50393246-50393268 AGGGAGGAGCAGGGTGGGGGTGG - Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
955528311 3:59844005-59844027 AAAGAGAAGGAGGGTGTGGGAGG - Intronic
955864918 3:63372258-63372280 GGTGAGAAGCAGGGGGTGGAAGG - Intronic
955876533 3:63495786-63495808 AGGGAGATGTGGGGTGTGGAAGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957451729 3:80389044-80389066 ATGGTGGTGCAGGGTATGGAAGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
959366123 3:105459896-105459918 ATGGGACAGCAGGCTGTGGAAGG + Intronic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
962377840 3:134873654-134873676 CTAGAGAAGCAGGGTTTGCACGG + Intronic
963292198 3:143503473-143503495 GTGGCGAAGCAGGCTTTGGAGGG - Intronic
963320084 3:143801844-143801866 ATGGTGGTGCAGGATGTGGAAGG - Intronic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964217042 3:154297108-154297130 GAGGAAAAGCAGGGAGTGGAGGG + Intronic
964810398 3:160657263-160657285 ATGGAGAAGGGGGGCTTGGAAGG - Intergenic
965275746 3:166679634-166679656 ATGGAGAAGGACGGTGTGGTTGG - Intergenic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968914216 4:3490146-3490168 ATGAATGAGCAGGGTGGGGAAGG - Intronic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969136484 4:5033313-5033335 AGGGAGAAGCAGGGTTTCCACGG - Intergenic
969226494 4:5801866-5801888 ATGGGGAGGCAGGGACTGGATGG + Intronic
969474841 4:7416006-7416028 ATGTAGCAGCCTGGTGTGGAGGG + Intronic
969496551 4:7529630-7529652 ATGGCTCAGCAGGGTGGGGAAGG + Intronic
969592540 4:8130216-8130238 ATGGAGACGCAGGGTGGCCAGGG + Intronic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970538988 4:17058718-17058740 ATGGGGCAGAAGGGTGTGGGTGG - Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971810790 4:31424097-31424119 AAGAAGAAACAAGGTGTGGAAGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972629711 4:40832761-40832783 ATGGAGCTGCAGAGTGTTGAGGG - Intronic
972732930 4:41813044-41813066 ATAGAGAGCAAGGGTGTGGAAGG - Intergenic
972783209 4:42303767-42303789 GTGGTGAAGCAGGGCGTGTAAGG - Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
975357986 4:73430694-73430716 ATCTAGAAGCTGGGTCTGGATGG + Intergenic
975826565 4:78326008-78326030 CTGGAGATGCAGGGTGTGTGTGG + Intronic
975927119 4:79470536-79470558 CTGGAGATGCATGGTGAGGATGG - Intergenic
976739615 4:88344914-88344936 ATGGTGATGCAGGATATGGAAGG + Intergenic
977063423 4:92284223-92284245 ATGGAGAAGTAGGGGGTGGTAGG - Intergenic
977600724 4:98931330-98931352 AGGGAGAGGAAGGGTGGGGAAGG - Intergenic
977660905 4:99584853-99584875 TTGGGGAAGGAGGGAGTGGAAGG - Intronic
978937417 4:114395010-114395032 CTGGAGAAGCTGTGTCTGGATGG - Intergenic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
980714740 4:136614819-136614841 ATGGTGATGTAGGATGTGGAAGG - Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982413247 4:155103347-155103369 ATGTAAAAGCAGGGATTGGAGGG - Intergenic
983450663 4:167907014-167907036 ATGCAGAAGCAATGTGTGGGGGG - Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
983798664 4:171899902-171899924 AGAGGGAAGTAGGGTGTGGAAGG - Intronic
984622252 4:181967097-181967119 GTAGACAAGCAGGGAGTGGAAGG - Intergenic
984797461 4:183676635-183676657 AAGGAGAAGCATGGTGAGAAAGG - Intronic
985275257 4:188232236-188232258 AAGAAGAGGCAGGGTGTGGGTGG - Intergenic
985648746 5:1097702-1097724 ACAGAAAAGCAGGGTGTGGCTGG + Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985926924 5:3026265-3026287 AGGGAGAGGCAGGGTGGGCAGGG - Intergenic
985965065 5:3333263-3333285 ATGGAGGAGCAGGACGTGCATGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987211415 5:15687419-15687441 ATGGAGAACAAAGGTGTGAAAGG - Intronic
987373907 5:17217445-17217467 ATGGAGCTGGAGGGGGTGGAGGG + Intronic
987480362 5:18448367-18448389 ATGGAGATGTATGGTGTTGATGG - Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992106638 5:73453465-73453487 CTGAAGAAGCAGGGTGGGGGAGG - Intergenic
992178212 5:74171886-74171908 CTAGAGGAGAAGGGTGTGGAGGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992834795 5:80629751-80629773 GTGGAGAAGCTGGGTTTGGAAGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
992977030 5:82131061-82131083 ATGGACTAGTAGGGGGTGGAAGG + Intronic
993272653 5:85815004-85815026 AAGGGGAAGTATGGTGTGGAGGG - Intergenic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
996408929 5:123135593-123135615 AGGGAGTTGCAGGGGGTGGAGGG - Intronic
996970135 5:129357167-129357189 ATGGAGAATCAGTGTGTATAAGG - Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997421003 5:133766667-133766689 CTGGAAGAGCTGGGTGTGGAGGG + Intergenic
997606141 5:135176993-135177015 CTGAAGAAGCAGGGAATGGAGGG + Intronic
998830492 5:146152586-146152608 ATGGACCAGCAGGGTGTGGTAGG - Intronic
999320981 5:150614923-150614945 ATGGCAAAGCAGGATGTGAATGG - Intronic
999738044 5:154527476-154527498 ATGGTGAAGAGGGGTTTGGATGG - Intergenic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000592726 5:163177935-163177957 TTGGAGAAGCAGTTTGTGGGAGG + Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1001867014 5:175114537-175114559 ATAGAGATGCAGAGTGTGAATGG - Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002398394 5:178976017-178976039 ATGGAGGAGTAGGGTGAGCAGGG - Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1002873973 6:1194310-1194332 ATGTAGAAGAAAGGTGTAGAAGG - Intergenic
1003313288 6:4987558-4987580 GTGGTGGAGCAGGATGTGGAGGG - Intergenic
1003404559 6:5817622-5817644 ATGGTGAAGCAGGTATTGGAGGG - Intergenic
1003534766 6:6967138-6967160 GGGGAGAAGCTGGGTGTGTAAGG - Intergenic
1003598746 6:7499218-7499240 ATGGTGAAGCTTGGTGAGGAAGG - Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1005963696 6:30711666-30711688 CTGGAGAATCAGGGCCTGGAAGG - Exonic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1006986446 6:38178730-38178752 TGGGAGCAGCAGGGTGTGGGGGG + Intronic
1007107738 6:39295235-39295257 ATGGGGAAGCAGGGGGCAGAGGG + Intergenic
1007642683 6:43355236-43355258 CAGGAGAAGGTGGGTGTGGATGG + Exonic
1007700027 6:43761043-43761065 ATGGAGAGGCAGGGGGTTGGTGG + Intergenic
1007727760 6:43926988-43927010 ATGGAGGAGCAGGGATTAGATGG + Intergenic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008869765 6:56259313-56259335 ATGGAGATGGAGGGAGTGGAAGG - Intronic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1012270044 6:97197905-97197927 ATAGAGATGCAGGGTGGGGGAGG - Intronic
1012344287 6:98168054-98168076 ATGGATATTAAGGGTGTGGAAGG + Intergenic
1012861714 6:104568079-104568101 ATGGAGAGGCAGGGTGCAAAGGG + Intergenic
1013971798 6:116029026-116029048 ATGGAGGAGCTTGGTGTGGCTGG - Intronic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1014822798 6:126011532-126011554 ATGAAGAAGCTGGGGGTAGATGG - Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016524886 6:144990455-144990477 GTGGAGAAGCTGGGTGTAGGAGG + Intergenic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1018829556 6:167432932-167432954 ATGGGGTGGCAGAGTGTGGATGG + Intergenic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019164016 6:170087340-170087362 AAGGAAAAGCATGGTGTGGGGGG + Intergenic
1019373184 7:674209-674231 TTGGAGTAGCTGGGTGTGGCTGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019781364 7:2942179-2942201 ATGGTGCAGAAGGGAGTGGAAGG - Intronic
1020015459 7:4829008-4829030 GTGTTGAGGCAGGGTGTGGAGGG - Intronic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1020726012 7:11815828-11815850 TTGGAGAAGAAGGGAATGGATGG - Intronic
1021277583 7:18673128-18673150 ATGTTGAAGCCAGGTGTGGAAGG + Intronic
1021465877 7:20943148-20943170 ATGGAGATGGATGGTGTTGATGG + Intergenic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1022590210 7:31654341-31654363 ATGGAGATGGAGGGAGGGGAAGG + Intronic
1023254826 7:38302461-38302483 CTGGAGTTGCAGGGTCTGGAAGG - Intergenic
1023291486 7:38672726-38672748 AGGGAGATCCAGGGTGTGGCTGG - Intergenic
1023551580 7:41375698-41375720 GTGGGGGAGCAGGGTGTGTATGG - Intergenic
1023795658 7:43789799-43789821 ATGGAGACTCAGGGTGGGAAAGG - Intronic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1024505103 7:50156074-50156096 ATGAAAAAGCATGGTGCGGAGGG + Intronic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1026212722 7:68321159-68321181 GTGGAGCAGCAAGGTGTGGTAGG - Intergenic
1026284282 7:68949570-68949592 ATGGAGAAGGGGGGTATGGGAGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027354639 7:77343404-77343426 ATGGAGGTGCAGGATATGGAAGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1032313095 7:130806670-130806692 ATGGAGAAGAATGGTCTGAAGGG - Intergenic
1032928399 7:136636748-136636770 ATGAAGAGGGAGGGTGTGGGAGG + Intergenic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1034101954 7:148457841-148457863 ATGGGGGAGAAGGGTGTGGTTGG - Intergenic
1034523034 7:151635453-151635475 ATGGTGAAGCGGGCTGTGGTAGG + Intronic
1034593344 7:152163264-152163286 ATGGAGCAGCATGGTATGGTGGG - Exonic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1035620089 8:1029918-1029940 GTGGAAAAGGAGGGTGTGGTTGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1040299236 8:46179428-46179450 ATGGTGCAGCAGGGTGTCGTGGG - Intergenic
1040307843 8:46221444-46221466 ATGGAAAAGCAGGGTGGCGTAGG + Intergenic
1040333166 8:46402641-46402663 ATGGAGCCGCAGGGTGGCGAGGG + Intergenic
1040387487 8:46923365-46923387 ATGGAGAGGAAGGGTGTGCTCGG + Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040568639 8:48589114-48589136 AGGGAGAAGAAGGGTGGTGATGG - Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1040794136 8:51271221-51271243 AAGGAGAGGCGAGGTGTGGAGGG + Intergenic
1041097735 8:54366184-54366206 AGGGAGCAGCAGGGAGTGAAGGG - Intergenic
1041324774 8:56652617-56652639 AGGGACACGCAGGGAGTGGAGGG + Intergenic
1041523426 8:58779201-58779223 AAGGAGCAGCAGGCCGTGGAAGG + Intergenic
1041625873 8:60025942-60025964 AGGAAGAAGCAGGGTGTGTGTGG - Intergenic
1042146990 8:65740339-65740361 GTGGAGAATGAGGGGGTGGATGG - Intronic
1043059523 8:75482358-75482380 ATGGAGCAGAAGGGAGGGGAGGG - Intronic
1043128251 8:76427776-76427798 ATTAGGAAGCAGGGTGTGGAGGG - Intergenic
1043313883 8:78895920-78895942 ATGGTGTAGCATTGTGTGGATGG - Intergenic
1043987330 8:86708969-86708991 ATAGAGAAATAGGGTGTGGCTGG + Intronic
1045601286 8:103720064-103720086 ATTGAAATGAAGGGTGTGGAAGG + Intronic
1045931552 8:107633097-107633119 CTGGAGAAGCAGGCCCTGGAGGG + Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1047448093 8:124937751-124937773 ATGGAGAAGCCGGGCTTGGCTGG - Intergenic
1047682600 8:127269703-127269725 GTGCAGAAGCAGGATTTGGATGG - Intergenic
1048016665 8:130503273-130503295 ATGAAGTCACAGGGTGTGGAGGG + Intergenic
1048122895 8:131601431-131601453 ATGGAGATGCAGGGATTGTAAGG - Intergenic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049436140 8:142587131-142587153 AAGGAGGAGCAGCGTGTAGAAGG + Intergenic
1049627552 8:143632572-143632594 ATGGTGACGCAGGGTGGGGCAGG - Intergenic
1049761749 8:144334775-144334797 ATGGAGGAGCAGGGAGGGCAGGG - Intronic
1049953971 9:674271-674293 AAGGATCAGCAGGGAGTGGATGG + Intronic
1050023220 9:1306690-1306712 ATGAAGAAGGAGGGTCTGCAGGG + Intergenic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051106583 9:13587667-13587689 ATGGAGCAGAAGGGGGTGGATGG - Intergenic
1051628657 9:19122829-19122851 ATGGACCAGCAGGGGGTGGGTGG - Intronic
1051775958 9:20634406-20634428 GTCGAGGAGCAGGGTGTGGTTGG + Intergenic
1052375440 9:27713419-27713441 ATGGAGAGGCAGGTGGTGAAGGG + Intergenic
1052492343 9:29185749-29185771 ATGAAGCAGCAAGATGTGGAAGG - Intergenic
1052962025 9:34306903-34306925 AGGGCGGAGCAGGGTGGGGATGG - Intronic
1053142209 9:35689324-35689346 ATGGAGACGCGGTGTGTGTAGGG + Intronic
1053443640 9:38135596-38135618 CTGGAAAAGCAGGGTGAGGGGGG - Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056262099 9:84859157-84859179 TGGGAGAAGCGGGGTGTGAATGG + Intronic
1056775932 9:89512613-89512635 AAGGAGAAGCTTGGGGTGGAGGG - Intergenic
1056838971 9:89982356-89982378 AGGGAGAAGAAAGGTTTGGAAGG - Intergenic
1056933878 9:90900776-90900798 ATGGAGCAGGAGGGGGTGGGAGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057958073 9:99427572-99427594 TGGGAGAAGAAGGGTGTGAATGG + Intergenic
1058897848 9:109415556-109415578 CTTGTGAAGCATGGTGTGGAAGG + Intronic
1059354238 9:113687101-113687123 AGGGAGGAGGAGGGTGGGGAAGG + Intergenic
1060374310 9:123105030-123105052 ATGGAGTGGTAGGGTGTGGCAGG + Intergenic
1060403231 9:123360447-123360469 AAGGAGGGGCGGGGTGTGGAGGG - Intronic
1060731426 9:126039445-126039467 AAGGAGAAACAGGGTGTTCAGGG - Intergenic
1061026850 9:128055349-128055371 AGGGAGAAGAAGGGAGGGGAAGG + Intergenic
1061134604 9:128726229-128726251 AGGGAGAATGAGGGAGTGGAGGG + Intergenic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1061967579 9:134025050-134025072 ATGGAGGAGGAGGGGCTGGATGG - Intergenic
1062437800 9:136554352-136554374 GAGGAGGAGAAGGGTGTGGACGG - Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203552015 Un_KI270743v1:171503-171525 ATGGCGGAGCATGGTTTGGATGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1186605317 X:11084065-11084087 ATGGGTAAGAAGGGTGTGTATGG - Intergenic
1187882873 X:23862844-23862866 AGGGAGAAGGAGGGAGGGGAGGG + Intronic
1188310461 X:28610878-28610900 ATTGAGCAGCAGGATGTAGAGGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1190066669 X:47246083-47246105 ATGGAGAGGGATGGTGGGGAAGG - Intronic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1192130117 X:68541900-68541922 ATGGAAAAGTGGGGTGTGGAGGG - Intergenic
1192264483 X:69529542-69529564 ATGGATAAGGAAGGTGTGGTGGG - Intronic
1192433369 X:71127309-71127331 ATGAAGAAGCAAGGTTGGGAGGG - Intronic
1192438335 X:71156252-71156274 ATGTGGAAGTAGGGTGTGCAGGG - Intronic
1192764180 X:74125642-74125664 ATGGTGATGTAGGATGTGGAAGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1195633320 X:107084252-107084274 ATGTAGTAGCAAGGTGTGGAAGG + Intronic
1195731281 X:107970355-107970377 GGGAAGAAGCAGGGTGTGGACGG - Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1197907013 X:131436097-131436119 ATGGAGAAGCAGTTTTTGTAGGG + Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198430094 X:136556729-136556751 AGGAGCAAGCAGGGTGTGGATGG - Exonic
1198673111 X:139102835-139102857 ATGGACAAGCAGGGTTTAGAAGG + Intronic
1198710293 X:139494552-139494574 GGGGAGGAGCAGGGTGTGGTAGG - Intergenic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1199600629 X:149539565-149539587 CTGGAGATGCAGGGTGAGCAGGG - Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1201116570 Y:10839722-10839744 ATGGAGTTGAAGGGAGTGGAGGG - Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201233969 Y:11892446-11892468 ATGGTGGTGCAGGATGTGGAAGG + Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic