ID: 1092103991

View in Genome Browser
Species Human (GRCh38)
Location 12:5908000-5908022
Sequence ACTGCTCTCACGGTGCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092103991_1092103993 13 Left 1092103991 12:5908000-5908022 CCACAATGCACCGTGAGAGCAGT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1092103993 12:5908036-5908058 CACAAACTCGTAACCACGCACGG 0: 1
1: 0
2: 0
3: 3
4: 60
1092103991_1092103997 28 Left 1092103991 12:5908000-5908022 CCACAATGCACCGTGAGAGCAGT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1092103997 12:5908051-5908073 ACGCACGGGCAGCGTGTGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 57
1092103991_1092103994 14 Left 1092103991 12:5908000-5908022 CCACAATGCACCGTGAGAGCAGT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1092103994 12:5908037-5908059 ACAAACTCGTAACCACGCACGGG 0: 1
1: 0
2: 0
3: 0
4: 32
1092103991_1092103996 27 Left 1092103991 12:5908000-5908022 CCACAATGCACCGTGAGAGCAGT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1092103996 12:5908050-5908072 CACGCACGGGCAGCGTGTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092103991 Original CRISPR ACTGCTCTCACGGTGCATTG TGG (reversed) Intronic
902467212 1:16625799-16625821 ACTGAGCTCATGGTGCAGTGTGG + Intergenic
906500645 1:46339911-46339933 CTTGCTCTCACTTTGCATTGCGG - Intergenic
922563341 1:226585208-226585230 CCTGCTCTCACGTTGACTTGTGG - Intronic
924954042 1:248910425-248910447 ACTGTTTTCACAGTGCAGTGAGG + Intronic
1067093078 10:43280981-43281003 ACTGCTCTCTCTCTGCAGTGGGG + Intergenic
1068534565 10:58227468-58227490 CCTCCTCTCAGGGTGCATGGAGG - Intronic
1069813353 10:71178630-71178652 GCTGCTCTCAGGGTACATAGAGG + Intergenic
1072984877 10:100130707-100130729 ACTCCTCTCACTGTGAATTTGGG + Intergenic
1074103976 10:110375250-110375272 ACAGCTCTCACTGAGCATGGAGG - Intergenic
1074340751 10:112626733-112626755 ACTGCTCTTCAGGTACATTGGGG + Intronic
1078020159 11:7650395-7650417 AGTGCTCTCACGTAGCACTGTGG - Intronic
1078180595 11:9006717-9006739 ACTGCCCTCAAGGTTCAGTGTGG + Intergenic
1081301051 11:41451910-41451932 ACTGCTGTCACTATGCATGGTGG + Intronic
1084946562 11:72641976-72641998 ACAGCTCTCAGTGTGCACTGCGG + Intronic
1090962032 11:131565555-131565577 ACTGCTCTCACAATGCCCTGCGG - Intronic
1092103991 12:5908000-5908022 ACTGCTCTCACGGTGCATTGTGG - Intronic
1096189799 12:49609037-49609059 CCTGCTCTCGAGGTGCATAGAGG + Intronic
1111079689 13:83286972-83286994 ACTGCTCTCTGTGTGGATTGTGG + Intergenic
1116553971 14:46279480-46279502 AATGCTCTCACGGTGCCTGGTGG + Intergenic
1121260514 14:92562655-92562677 ACTGCCCTCACTGTGCATGTGGG + Intronic
1122888170 14:104719762-104719784 AATGCTCACACGGTGCCTGGGGG - Intronic
1124200416 15:27674414-27674436 CCTGCTGCCACGGTGGATTGTGG + Intergenic
1126692763 15:51300627-51300649 ACTGCTCACATGCTGCATTCAGG - Intronic
1132595946 16:749984-750006 ACTTGTCTCACGGGGCATGGTGG - Intronic
1150171120 17:62995895-62995917 AGTGCTATCACTGTTCATTGTGG - Intergenic
1155057993 18:22202170-22202192 ACTACTCTCCATGTGCATTGGGG + Exonic
1162903926 19:13812235-13812257 ACTCCTCTCAAGGTGTTTTGGGG - Intronic
1164082744 19:21874850-21874872 ACTGCTCCCAGAGTGGATTGTGG + Intergenic
1164190714 19:22914894-22914916 ACTGCTCCCAGAGTGGATTGTGG + Intergenic
1166228780 19:41413541-41413563 ATTGCTCTCAGGCTGCAGTGAGG - Intronic
1166900172 19:46055084-46055106 ACTGCTCCCATGGTTCATAGGGG - Intronic
928452602 2:31389736-31389758 ACTGCCCTCAAGGTCTATTGAGG + Intronic
930019471 2:46992667-46992689 ACTGCTCCCACTGCGCCTTGGGG - Intronic
939139529 2:138336766-138336788 AATGCTCTCAAGATGCAATGAGG + Intergenic
945934733 2:215891674-215891696 TCTGCTCTCACAGTGAATTAGGG - Intergenic
1172185363 20:33028059-33028081 ACTGCAGTCAAGGTGCACTGGGG + Intergenic
1172197962 20:33104862-33104884 CCCGCTCTCACCGTTCATTGCGG - Exonic
1172855059 20:37995360-37995382 GCTGCTCTGACTGTGCAGTGAGG - Intronic
1176012742 20:62908358-62908380 ACTGCAGTCACGGTGCAGCGGGG - Intronic
1178821631 21:35980852-35980874 ATTTATGTCACGGTGCATTGGGG - Intronic
949928056 3:9057637-9057659 ACTGCTCCCTCGGGGCATTGGGG - Intronic
961236966 3:125375358-125375380 ACTGCCGGCCCGGTGCATTGTGG + Intergenic
962277736 3:134029009-134029031 ACAGCTCTCACGGTTCAGTAAGG - Intronic
976595830 4:86893818-86893840 ACTGGTCTCACAGTCCATTGAGG - Intronic
981021867 4:140037956-140037978 ACTTCTCTCACATTGCATTTAGG - Intronic
983188523 4:164728847-164728869 ACTGCCCTCACTATGCCTTGTGG + Intergenic
990311097 5:54539619-54539641 CCTGCCCTGACGGTGCTTTGTGG + Intronic
991050480 5:62267464-62267486 ACTGGTCTTAAGGTGCTTTGGGG - Intergenic
995836620 5:116405919-116405941 AATGCTCTCTCCCTGCATTGGGG - Intronic
998410914 5:141910490-141910512 GCTGCTTTCACGGTGCCTTAGGG + Intergenic
999699393 5:154214364-154214386 TCTGCTCTGCCGGTTCATTGTGG + Intronic
1001198063 5:169691481-169691503 AGTGCTTTCATGGTGCAGTGGGG + Intronic
1011363650 6:86555449-86555471 ACTGTTCTCACTGTGGATTTTGG - Intergenic
1012686509 6:102257659-102257681 ACTCCTCTCACGGGCAATTGGGG - Intergenic
1022393651 7:29965458-29965480 ACAGCTGTCCCTGTGCATTGGGG + Intronic
1023868106 7:44248437-44248459 GCTGCTATCACCCTGCATTGTGG - Intronic
1036646437 8:10613465-10613487 ACAGCTGTCACCGTGCATTTTGG - Intronic
1037643820 8:20772305-20772327 ATAGTTCTCACGGTGCAATGTGG - Intergenic
1043463776 8:80486185-80486207 ACTGCTACCCCGGTGCATTGTGG + Intronic
1045530778 8:102983343-102983365 CCTGTTCTCAGGGTGGATTGAGG - Intergenic
1045703987 8:104898936-104898958 AATGCTCCCAGGCTGCATTGAGG - Intronic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1062512703 9:136916163-136916185 ACTGCTCACCCGGTGCGTGGTGG - Intronic
1187137328 X:16560858-16560880 ACTCCTCACACTGTACATTGGGG - Intergenic