ID: 1092105216

View in Genome Browser
Species Human (GRCh38)
Location 12:5916984-5917006
Sequence AAGTCTGATGACAGGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092105213_1092105216 -7 Left 1092105213 12:5916968-5916990 CCACAATGAGAGGTGGAAGTCTG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1092105216 12:5916984-5917006 AAGTCTGATGACAGGGACGCTGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092105216 Original CRISPR AAGTCTGATGACAGGGACGC TGG Intronic
901393414 1:8963207-8963229 AAGTCAGAGGACTGGGAGGCTGG - Intronic
903682782 1:25108276-25108298 AAGTCTGGGGACAGGGACAGTGG + Intergenic
905031902 1:34890065-34890087 CAGGCTGATGACAAGGAAGCTGG + Intronic
907553532 1:55324958-55324980 AAGTCTGATGTGAGGGCCACTGG + Intergenic
910677904 1:89833382-89833404 AAGTCTGGTGCCAAGGATGCGGG - Intronic
915033230 1:152901867-152901889 AAGTCAGAAGACAGGTGCGCTGG - Intergenic
919767902 1:201139159-201139181 AAGCCTGATGACAAGGAGACAGG + Intronic
920261945 1:204694192-204694214 ATCTCTGATGGCAGGGCCGCGGG - Intergenic
922353707 1:224756596-224756618 AAGTCTGATGCCAGGGGTGTTGG + Intergenic
922551004 1:226494472-226494494 AAGTTTGGTGACAGGGTAGCTGG + Intergenic
923167205 1:231377279-231377301 AAGTCACATGACAGGGAATCTGG + Intronic
923560368 1:235035533-235035555 GATTCAGATGACAGGGACGGTGG + Intergenic
1064453297 10:15463567-15463589 AAGTATGATGACAATGACTCAGG - Intergenic
1067027486 10:42857152-42857174 GACTCTGGTGACAGGAACGCTGG + Intergenic
1067436378 10:46282184-46282206 AAGTCTGATGAGGGGGAAGTTGG - Intergenic
1068232427 10:54186288-54186310 AAGTCTGATGTCAAGGACTGAGG + Intronic
1070114378 10:73514750-73514772 AAGTCTTAGGACAGGCACGGTGG + Intronic
1070192298 10:74122818-74122840 AAGACTGATGACTGTGAGGCAGG + Exonic
1073349876 10:102812163-102812185 AAGTCTGAAGTTAGGGACCCTGG + Intronic
1077209179 11:1360531-1360553 AAGGTTGATGACAAGGAGGCTGG - Intergenic
1077547425 11:3180986-3181008 AAGTCCCATGACAGGCAAGCTGG + Intergenic
1079566224 11:21886452-21886474 AATTCAGATGACAGGGACAGAGG + Intergenic
1082980330 11:59115079-59115101 AAGTCTAATGGAAGGGACACAGG - Intronic
1083717206 11:64584247-64584269 AAGTTTGAAGACAGAGAGGCGGG - Intergenic
1085084552 11:73658074-73658096 AAGTCTGATGGGAGAGACACAGG + Intronic
1091331913 11:134737090-134737112 AGGAGTGGTGACAGGGACGCAGG - Intergenic
1092105216 12:5916984-5917006 AAGTCTGATGACAGGGACGCTGG + Intronic
1095286360 12:40415686-40415708 AAATCTGATGTCAGTGGCGCAGG + Intronic
1101823466 12:108202164-108202186 AACTCTGAGGACAGGGACCATGG + Intronic
1103043150 12:117712320-117712342 AAGTCTGGGGACAGGGTCTCAGG + Intronic
1107460899 13:40601110-40601132 TAGTCTGATGAAAGGGAAGATGG - Intronic
1109204303 13:59464936-59464958 AAGTCTGTGGACAGGGAAGAGGG + Intergenic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1114267281 14:21080436-21080458 AAGGCAGATGAGAGGGAAGCTGG - Intronic
1114600781 14:23953989-23954011 AGGTCTGAGGACAGGGGCACCGG - Intronic
1114605010 14:23989148-23989170 AGGTCTGAGGACAGGGGCACTGG - Intronic
1114610460 14:24036701-24036723 AGGTCTGAGGACAGGGGCACTGG - Intergenic
1116375514 14:44194657-44194679 AAGCCAGATGACAGTGATGCAGG + Intergenic
1122679345 14:103445831-103445853 AGTTCTGATGACAGGGGAGCAGG - Intronic
1123427145 15:20182012-20182034 GACTCTGGTGACAGGAACGCTGG + Intergenic
1123536374 15:21188521-21188543 GACTCTGGTGACAGGAACGCTGG + Intergenic
1130095447 15:80852185-80852207 AATTCTGATAACTGGGACCCTGG + Intronic
1131075830 15:89494299-89494321 AAGTCTGGGGACAGAGACCCAGG + Intronic
1132982092 16:2743401-2743423 AAGTCCCATGACAGGGTCACAGG - Intergenic
1136857153 16:33667824-33667846 GACTCTGGTGACAGGAACGCTGG - Intergenic
1137250889 16:46740062-46740084 CAGTCTGATGCCAGGGAGCCTGG - Exonic
1137690490 16:50423454-50423476 AGGTCTGATTCCAGGGAAGCAGG - Intergenic
1137694952 16:50455370-50455392 AAGTCTGATCCCAGGGATGTTGG - Intergenic
1203118726 16_KI270728v1_random:1516315-1516337 GACTCTGGTGACAGGAACGCTGG - Intergenic
1146601162 17:34217783-34217805 CACTCTGATGATAGGGAAGCTGG + Intergenic
1148088273 17:45007386-45007408 AAGTCTGATGGCATGGGCTCTGG - Intergenic
1151701258 17:75743773-75743795 ACGCCGGATGACAGGGATGCGGG - Exonic
1156349934 18:36295467-36295489 AAGTGGGATGAAAGGGACCCAGG + Intergenic
1157293437 18:46425622-46425644 AAGTCAGATGCCAGGGACCGTGG - Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157642278 18:49228886-49228908 AATTCTGATGAAAAGGACACAGG + Intronic
1157762589 18:50275408-50275430 ATCTCTGATGACGGCGACGCAGG + Intronic
1165062917 19:33213646-33213668 AGGTCTGGGGACAGGGACCCTGG - Intronic
1165951002 19:39473928-39473950 AAGTCTGTTGACAGCGACTGTGG - Intronic
1166646894 19:44538889-44538911 AAGTATACTGACAGGGAGGCTGG - Intergenic
1167895111 19:52574292-52574314 AAGTGAGATGACAGGGACTGAGG - Intronic
925427224 2:3760092-3760114 AAGTCTGATGACAGAGATCCAGG - Intronic
929048788 2:37816564-37816586 AAGTCTGATCACAGGGAGAAGGG - Intergenic
931303229 2:61001667-61001689 AAGTCGGATGACAGGTACACAGG + Intronic
934772044 2:96913386-96913408 AAGTCTGAGAACAGGCAGGCAGG + Intronic
935672515 2:105567952-105567974 AATTCTGATGCCAGAGACTCAGG + Intergenic
938824819 2:134994329-134994351 ACCTCTGAAGACAGGGATGCAGG + Intronic
938971538 2:136437633-136437655 ATGTCAGATAACAGGGATGCGGG - Intergenic
944438276 2:199715140-199715162 AAGTCTGAAGGCAGGCACCCAGG - Intergenic
944852638 2:203735598-203735620 AAGTCTCATGACAGGGAGTGAGG - Exonic
944869517 2:203895712-203895734 AAGTCTGATGACAGTGAGCCAGG + Intergenic
945507344 2:210657701-210657723 AATTCTGATGGCAGGGTCACTGG - Intronic
946445600 2:219737534-219737556 AAGGGTGATGTCAGGAACGCAGG - Intergenic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
948061345 2:235045037-235045059 ATGGCTGATGGGAGGGACGCAGG - Intronic
1169893171 20:10474950-10474972 AAGTCTGAGGACCAGGAAGCTGG - Intronic
1169950193 20:11035168-11035190 AAGGCTCATGACAGACACGCTGG - Intergenic
1172037160 20:32018673-32018695 AGGTCTGAGGCCAGGGGCGCAGG + Intronic
1172788560 20:37486722-37486744 AAGTGAGATGACAGGGAAGGAGG + Intergenic
1180661006 22:17467242-17467264 AAGTCTGATGTCAGTGATGATGG + Intronic
1181875513 22:25937523-25937545 AAGTCTGATGACAGTGGCCATGG - Intronic
1183238708 22:36639854-36639876 AAGACAGATGACAGGGCCTCAGG - Intronic
1183362772 22:37391228-37391250 AGGTCGCATGACAGGGACACTGG + Intronic
1184822370 22:46918882-46918904 GAGTCAGATGACGGGCACGCGGG - Intronic
950421641 3:12903104-12903126 GAGTCTGTTGAGAGGGACCCTGG + Intronic
956625715 3:71264648-71264670 AAGACAGATGACAAGGATGCTGG - Intronic
959290075 3:104462641-104462663 AAGTCTGAAGAAAAGGAGGCAGG - Intergenic
962893740 3:139695565-139695587 AAGTGTGTTGACGGGGAAGCAGG - Intergenic
965258046 3:166442694-166442716 ACGTCTAATGACTGGGACACAGG - Intergenic
967307359 3:188072020-188072042 AAGTCTGGTGACAGGGGTCCTGG + Intergenic
968434589 4:577774-577796 AAGGCTGGTGACAGGGACGGAGG - Intergenic
982919706 4:161257154-161257176 AAGTTTGGTGACAGGGTAGCTGG + Intergenic
993603561 5:89958790-89958812 AAGGCTGAGGCCAGGGAGGCAGG - Intergenic
995618069 5:113989516-113989538 AAGTCTGAAGAGAGGCACTCTGG - Intergenic
996972295 5:129386186-129386208 AAGTCTGAAGCCAGGCACGGTGG + Intergenic
999328515 5:150657808-150657830 AAGTAGCATGACAGGGACCCGGG - Intronic
1000505981 5:162118724-162118746 AAATCTGATCACAGGAACCCAGG - Intronic
1004606568 6:17200601-17200623 AAGTGTGAAGAGAGAGACGCGGG + Intergenic
1010464351 6:76149666-76149688 AAGTCTGAGGACAGGGTAGTAGG - Intergenic
1016629222 6:146208079-146208101 AAGTCTGATGACAGTGAATCAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1028788048 7:94819386-94819408 AAGTCTGCTGACAGTGACATGGG + Intergenic
1030196680 7:106859644-106859666 AATTCTGAAGGCAGGGACTCAGG + Intergenic
1030639537 7:111988562-111988584 AAGTCTTATGACAGGTGCACTGG - Intronic
1036600408 8:10255531-10255553 AGGTCTGCTGACAGGGGCACTGG - Intronic
1040588406 8:48765725-48765747 CAGTCTGCTGACAGGGGCCCAGG + Intergenic
1041883168 8:62777055-62777077 AAGTCTGCTGCCAGGCACACTGG + Intronic
1041993105 8:64018100-64018122 AAGTATGATGACAGTGTCTCAGG + Intergenic
1043469055 8:80544073-80544095 AAGCCTGAGGCCAGGGACGAAGG - Intergenic
1044863369 8:96545387-96545409 AATTCTGATGTCAGGGAGACAGG + Intronic
1045844427 8:106616991-106617013 AAATGTGATGACAGGGAAGAAGG + Intronic
1046928358 8:119817617-119817639 AAGTGTAATGACAGGGATCCTGG - Intronic
1049381120 8:142316374-142316396 AAGGCAGATGACAGGAACACTGG - Intronic
1050830669 9:10008233-10008255 AAGTCTACTGACAGGGAGGGAGG - Intronic
1051482015 9:17571722-17571744 AAGTCTGATGACAGGTGTGAGGG - Intergenic
1052600740 9:30626714-30626736 AAATCTGAGGACAGGCACGGTGG - Intergenic
1055045798 9:71922687-71922709 AAGTATGATGACAGGAACTGTGG - Intronic
1059872641 9:118595097-118595119 AAGTCAAATGACAGGGACGTGGG - Intergenic
1061227313 9:129288261-129288283 AAGATTGATGACAGGGTGGCTGG - Intergenic
1061573605 9:131492642-131492664 AAGTCTGAGGAAAGAGACGCTGG - Intronic
1187024416 X:15419203-15419225 ATGTCTGATGACAGGCAGCCAGG + Intronic
1189340177 X:40198955-40198977 AAGTCTGAGGCCAGGCACGGTGG - Intergenic
1190257609 X:48775150-48775172 AAGTGTGATGGCAGGGACAGGGG + Intergenic
1192776818 X:74254189-74254211 AAGTTTGGTGACAGGGTAGCTGG - Intergenic
1202328841 Y:23723055-23723077 AAGTGAGATTACAGGGATGCAGG + Intergenic
1202541930 Y:25946999-25947021 AAGTGAGATTACAGGGATGCAGG - Intergenic