ID: 1092108821

View in Genome Browser
Species Human (GRCh38)
Location 12:5944950-5944972
Sequence TTTTAACTCAAGGAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092108821_1092108825 15 Left 1092108821 12:5944950-5944972 CCTTCCCTCTCCTTGAGTTAAAA 0: 1
1: 0
2: 1
3: 30
4: 251
Right 1092108825 12:5944988-5945010 ACAAAAAACAAAAAACGTCTCGG 0: 1
1: 3
2: 22
3: 538
4: 5872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092108821 Original CRISPR TTTTAACTCAAGGAGAGGGA AGG (reversed) Intronic
900718380 1:4159554-4159576 GTATAACTCAGGGAGAGGGTTGG + Intergenic
902745565 1:18471482-18471504 CTATAACTCAATGAGATGGATGG + Intergenic
905197091 1:36288309-36288331 TGGGAACTCAAGGAGAAGGATGG - Intronic
906201423 1:43962934-43962956 TGTTAAATAAAGGAGGGGGAGGG + Intronic
907552770 1:55318431-55318453 ATTTTAGTCAAGGAGAGGAAAGG - Intergenic
907614428 1:55909851-55909873 TTTGAACTCATGGAGATAGAGGG + Intergenic
907726201 1:57023095-57023117 TGCTGACTCAAGGAAAGGGAAGG - Intronic
907867071 1:58408688-58408710 TTTTGACTCTTGGAGATGGAAGG + Intronic
910037351 1:82804226-82804248 ATTTTACTAAAGGAGAGGCAAGG - Intergenic
910038331 1:82816379-82816401 TTCTCACTGAAGGAGAAGGAAGG + Intergenic
911834343 1:102596984-102597006 TTTCATCTCAAGAAAAGGGAAGG + Intergenic
913057237 1:115174005-115174027 TTCTATCTGTAGGAGAGGGATGG + Intergenic
916771223 1:167910546-167910568 TTCTACCTCAAGGAGAAGGTAGG - Intronic
917340441 1:173971510-173971532 TTATAACTCAAGGATAAGGCAGG + Intronic
920788618 1:209066856-209066878 TTGTATTTCAAGGAGAGGGAAGG - Intergenic
921965180 1:221080412-221080434 TTTTAACTCAAGGTGTGGCTGGG - Intergenic
1063075309 10:2710834-2710856 TGTTCACTCCAGTAGAGGGAGGG - Intergenic
1063496727 10:6516362-6516384 TTTTATCTAAAGGAGATGGTTGG + Intronic
1063661776 10:8039233-8039255 TTTGGACCCAAGCAGAGGGAAGG + Intergenic
1063975299 10:11410372-11410394 TTTGAAAGCAAGGAGAGGGAAGG + Intergenic
1064868392 10:19908456-19908478 TTATATCTAAAAGAGAGGGATGG + Intronic
1064920945 10:20517367-20517389 ATTTATCTAAAGGAGAGAGAAGG - Intergenic
1065399163 10:25276803-25276825 TTTTAAGTCAAGAAAAGTGAAGG + Intronic
1065624948 10:27620659-27620681 TGGAAACTCAAGGAGAGGGAAGG - Intergenic
1066205717 10:33187490-33187512 TTCTGGCTCAAGGAGAGGCAAGG + Intronic
1066350708 10:34634409-34634431 TTTTCCCTCCAGGGGAGGGAAGG + Intronic
1066512504 10:36117402-36117424 TTTTATCTCAGGGACAGGGAGGG - Intergenic
1069807351 10:71134218-71134240 TAGAAACTCAAGGAGATGGAAGG - Intergenic
1070144173 10:73761684-73761706 TTCTCACTGAAGGAGGGGGAAGG - Intronic
1070745607 10:78931903-78931925 TTTTGACTCCAGAAGAGGGATGG + Intergenic
1070965735 10:80529204-80529226 TTTTAACTCAAAGGGCGGGAGGG - Exonic
1071478826 10:86047562-86047584 TTTGAAGGCAAGGAGAGGGCAGG - Intronic
1071929598 10:90453448-90453470 CTTTAAGTGAAGGAGAGAGAGGG + Intergenic
1075340103 10:121640297-121640319 TTTAAATTCATGGAGAGAGAAGG + Intergenic
1077851522 11:6078093-6078115 TTTTAACATAAGGAGAAGTAGGG - Intergenic
1078467246 11:11559498-11559520 GTTTAAGGCATGGAGAGGGATGG + Intronic
1078606853 11:12784753-12784775 CTTTGACTTAAGGAAAGGGAAGG - Intronic
1080448872 11:32362383-32362405 TAATAACTCAAAGAGAGGGCCGG + Intergenic
1080774049 11:35369273-35369295 ATGTAACTCGAGGTGAGGGAAGG + Intronic
1080952166 11:37046995-37047017 TTAAAACTCAAGCAGAAGGAGGG - Intergenic
1081635470 11:44718654-44718676 TCATAACAGAAGGAGAGGGAAGG + Intergenic
1081930803 11:46869641-46869663 TTCTCAATCAAGGGGAGGGAGGG + Intronic
1082884627 11:58069187-58069209 TGTTAACTCCAGGTGAGGCATGG - Intronic
1082989050 11:59191712-59191734 TTTTAACTGTACCAGAGGGACGG - Intronic
1084690258 11:70721103-70721125 TGTTAACTGGAGGAAAGGGAGGG - Intronic
1085688167 11:78644486-78644508 TTTCACCTCGAGGAGTGGGAAGG - Intergenic
1086064471 11:82732031-82732053 AATGCACTCAAGGAGAGGGAAGG + Exonic
1089683364 11:120131829-120131851 CTTCAACACTAGGAGAGGGAAGG + Intronic
1089782193 11:120881551-120881573 TTCTAACCCAAGGAGGAGGATGG + Intronic
1090485612 11:127109537-127109559 TTGCTACTCAAGGAAAGGGAAGG - Intergenic
1091577079 12:1747905-1747927 TTTTAACTCAGAGAAAGGCAAGG - Intronic
1091875834 12:3932048-3932070 TTTTAACTGAAGGGTGGGGAGGG + Intergenic
1092108821 12:5944950-5944972 TTTTAACTCAAGGAGAGGGAAGG - Intronic
1092518643 12:9242379-9242401 TCTTAAATAAAGGAAAGGGAAGG - Intergenic
1093659552 12:21737813-21737835 TTTTTACTTAAGGAAAAGGAAGG - Intronic
1095830287 12:46578483-46578505 TTTTACCAAAAGGAGAAGGAGGG - Intergenic
1097723330 12:63047690-63047712 CTTTGACTCAAACAGAGGGAAGG - Intergenic
1098724898 12:73951600-73951622 CTTTATCTCAAGGAGAGAGATGG + Intergenic
1100409302 12:94299278-94299300 TTTTACCTTAAGGACAGGCAAGG + Intronic
1101448895 12:104758410-104758432 TTTTAACCCAAGGAGAAAGTTGG + Exonic
1103836754 12:123827722-123827744 TGTGAACTCAAGGATAGGAAGGG - Intronic
1104637097 12:130444701-130444723 CTTGAAGTCAAGGAGATGGATGG + Intronic
1104752117 12:131246316-131246338 TGTGGACTCAAGCAGAGGGAAGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1107858356 13:44637216-44637238 TGTTCACTCAAGGAGAGGATGGG + Intergenic
1111043991 13:82790588-82790610 TTTTAACACAAGAACAGGAAAGG + Intergenic
1111085863 13:83374266-83374288 TTTTAACTTAAAGAGAGGAGAGG - Intergenic
1113250935 13:108451447-108451469 TTTTGATTCTAGGAGAGGGCAGG - Intergenic
1113740390 13:112708823-112708845 TTTGAACTCATGGAGGGGGAGGG + Intronic
1115466668 14:33722345-33722367 TTTTAACTTAAGGAAAGGGGGGG + Intronic
1116458501 14:45145232-45145254 TTTTTCCTCAAGCAGAAGGAAGG + Intronic
1116491029 14:45503356-45503378 ATGTGACTCAAGGAGAAGGAAGG - Intergenic
1117654996 14:57946295-57946317 TTTTTACACAAGGTGAGAGATGG + Intronic
1118096868 14:62546778-62546800 TTTCCCCTCAAGCAGAGGGAAGG - Intergenic
1118143467 14:63110609-63110631 TTATAACTCAAGGTGAGGTTTGG + Intergenic
1120093720 14:80364197-80364219 TTTTTATTCATGGAGAGGTATGG - Intronic
1120266334 14:82255578-82255600 TTTTAAGACAAAGAGAGAGATGG + Intergenic
1121718333 14:96091762-96091784 TGGTCACTCACGGAGAGGGATGG + Exonic
1121949300 14:98156466-98156488 TGTTAACTGAGGGAGAGGCAGGG - Intergenic
1124707974 15:31981294-31981316 TTATTGATCAAGGAGAGGGAGGG + Intergenic
1126783254 15:52156299-52156321 TTTTAGAGCAAGGACAGGGAAGG - Intronic
1128983496 15:72202678-72202700 TTGTCACAAAAGGAGAGGGAGGG + Intronic
1130272775 15:82460972-82460994 TTTTCACTCAAGGAAAGAGGAGG + Intergenic
1130587416 15:85192938-85192960 TTTTCACTCAAGGAAAGAGGAGG + Intergenic
1131242121 15:90755318-90755340 TATTTAGTCAAGGAGGGGGAGGG - Intronic
1131461294 15:92619454-92619476 TTTTACCTAAAAGAAAGGGAAGG + Exonic
1131601022 15:93848971-93848993 GTCTAATTCATGGAGAGGGAGGG + Intergenic
1131971769 15:97900724-97900746 TTTTAAATGCAGGAGAGGGAGGG + Intergenic
1132249522 15:100324711-100324733 TATTAAGTCAGGGAGAGAGAGGG - Intronic
1133336462 16:5009726-5009748 CATTAACTCAAGCAGGGGGAAGG + Intronic
1136075499 16:27814424-27814446 TTTCAACTCAGAGAGAAGGATGG + Intronic
1138045095 16:53714038-53714060 TTTTAACATAAGGGGAGGCATGG - Intronic
1138599823 16:58047722-58047744 TTTCAACACAAAGAGAGGAAGGG - Intergenic
1140353144 16:74281593-74281615 TTTGAACTAAAGGAGAGCCAAGG - Intergenic
1141394668 16:83694159-83694181 ATAGAACTCAAGGGGAGGGAAGG + Intronic
1141916695 16:87102493-87102515 TTTGCACTCATGGAAAGGGACGG + Intronic
1142804488 17:2364230-2364252 TTTGACCTCAGGCAGAGGGATGG + Intronic
1143933973 17:10462683-10462705 TTTTAACACATGTAGGGGGAGGG + Intronic
1144257444 17:13483212-13483234 TTTTAATTTAAGGAAAGGCAGGG + Intergenic
1145802038 17:27693721-27693743 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1147950722 17:44106259-44106281 TTTTAGCCCAAGGAGAGGAGGGG - Intronic
1148453600 17:47798046-47798068 TTTGACCTCAGGGAAAGGGAAGG - Intergenic
1149140911 17:53431998-53432020 TGTGAACTTAGGGAGAGGGAAGG + Intergenic
1150163143 17:62916192-62916214 TCATAATCCAAGGAGAGGGAGGG - Intergenic
1150662065 17:67090900-67090922 ATTCAAATCAAGCAGAGGGAAGG - Intronic
1155108461 18:22690038-22690060 TTGTAACTCTGGGGGAGGGAGGG - Intergenic
1155698589 18:28714976-28714998 CTTGAAGTCTAGGAGAGGGAGGG + Intergenic
1156023564 18:32626733-32626755 TTTAACCTCTAGGAAAGGGAAGG + Intergenic
1156319090 18:36001324-36001346 TTTCAAATCAAGCAGAGAGAAGG + Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1159092084 18:63860905-63860927 TTTCTCCTCAAGCAGAGGGAAGG + Intergenic
1159269520 18:66130595-66130617 TTTTAACTGAAGGAGAGGTCAGG + Intergenic
1160903874 19:1443006-1443028 GTCCAGCTCAAGGAGAGGGAGGG + Intergenic
1161681944 19:5684568-5684590 TTTTCAGTCCAGGAGAGGCAAGG + Intronic
1162051517 19:8036743-8036765 TTTGAAGACCAGGAGAGGGACGG + Intronic
1164360956 19:27509324-27509346 TTTTAACTCTATGAGATGAATGG - Intergenic
1167091716 19:47349018-47349040 TTTTAACCCAAAGAGAGAGCTGG - Intergenic
1167180485 19:47899453-47899475 TTTTAAATAAAGGAGATGAATGG + Intergenic
1168443524 19:56392124-56392146 TGTTACCTCAAGGACAAGGAGGG + Intronic
926004050 2:9358066-9358088 TTTGAACTCAGGTAGAGGCAGGG + Intronic
927828857 2:26330697-26330719 GTCTGGCTCAAGGAGAGGGAAGG - Intronic
928222446 2:29415822-29415844 TTTTAGTTCAAGAAGAGAGAAGG - Intronic
928682998 2:33721935-33721957 TTCTAATTCAATGAGAGGTAGGG + Intergenic
928948610 2:36793959-36793981 TTTTCTTTCAAGGAGAGGAATGG + Intronic
929993496 2:46810242-46810264 TGTTACCTCTAGGAGAAGGAAGG + Intergenic
931823838 2:65979046-65979068 TTTTAAATCAATTAAAGGGAAGG + Intergenic
932457472 2:71858582-71858604 TTTCCACTCAAGAAGAGGCAGGG - Intergenic
934574454 2:95391404-95391426 TTTTATCTCAGGCAGAGGGATGG - Intergenic
934977992 2:98818936-98818958 TTTTAACACAGAGAGAGGGAAGG - Intronic
935204040 2:100882292-100882314 TTTTAAGTCAAGGAAAGAAATGG - Intronic
935437911 2:103056489-103056511 TTTCTACTTAAGGAGAGGAAAGG - Intergenic
935942498 2:108255550-108255572 TCTGAAATCAAGGAGAGGGAAGG - Exonic
936045685 2:109186092-109186114 TTTTAACTTCAGGAGAGGGCAGG + Intronic
939670723 2:145008453-145008475 TTTTAACTAATGTAGAGTGAAGG + Intergenic
939725912 2:145721433-145721455 TTTTAACTAGAGGAAAGAGAAGG - Intergenic
940129237 2:150362681-150362703 CTTTAACACATGGAGAGGAAGGG - Intergenic
940377992 2:152978960-152978982 GTTTAAATACAGGAGAGGGAGGG - Intergenic
940660478 2:156539122-156539144 TCTTAACAAAAGGAGAAGGAAGG + Intronic
940781770 2:157940909-157940931 TGCTAACTCTTGGAGAGGGATGG - Intronic
942497160 2:176551910-176551932 TTTCAGCTCAAAGAGAGAGAGGG - Intergenic
942598838 2:177619249-177619271 TTTTAATAAAAGGAGCGGGATGG + Intergenic
943045348 2:182854539-182854561 TTCTAACTCAAGAAGTGGAAAGG + Intronic
943230666 2:185246224-185246246 TTTTATCCCAAGGATAAGGATGG + Intergenic
946367773 2:219260659-219260681 TTTTAACTCAAGCACTTGGAAGG - Intronic
948308848 2:236970095-236970117 TTTTCACTCCAGGAGAGTCAAGG - Intergenic
948586471 2:239023179-239023201 TTTAAAATAAAGGACAGGGAGGG - Intergenic
1169114872 20:3057729-3057751 TTTTTACTCAAGAAAAGTGAAGG + Intergenic
1172529385 20:35619420-35619442 GTTTAACTCAAGGAGAGACCTGG + Intronic
1172792144 20:37513233-37513255 TTATAAGTCAAGGAGGGGGCTGG - Intronic
1173296186 20:41760306-41760328 TTATAACTCCAGGATGGGGAAGG - Intergenic
1180129288 21:45816521-45816543 TTTTAACAAAAGGGGAGGGGAGG - Intronic
1182787844 22:32922638-32922660 TGTTCACTCAAGGAGAGAGATGG + Intronic
1184627267 22:45745439-45745461 TTTTAAATCAGGGAGGAGGAAGG - Intronic
949539595 3:5021542-5021564 TTTTCAGGCATGGAGAGGGAAGG + Intergenic
950014726 3:9747546-9747568 GTTCAGCGCAAGGAGAGGGAGGG + Exonic
950726570 3:14920963-14920985 TTTTATCACAAGGAGAGGTGAGG - Intronic
951461708 3:22958160-22958182 TTTTTAATCAAGGAGCAGGATGG - Intergenic
955709720 3:61765616-61765638 TTTTCACTAAAGGAGTGGAAAGG + Intronic
956090571 3:65662204-65662226 TGTTAATTGAAGGAGAGAGAGGG - Intronic
956486127 3:69723714-69723736 TTTTAAATTAAGGAAAAGGAAGG - Intergenic
956531955 3:70230745-70230767 TTAAAACTCAAGGAGGGTGAAGG - Intergenic
957895776 3:86420001-86420023 TTTTAAATCCAGAAGATGGAGGG - Intergenic
958019088 3:87976915-87976937 TTATTACTCAAGGAGAGGGAAGG + Intergenic
959653582 3:108775656-108775678 TTTTAAATCAAGGAGAGGATTGG - Intergenic
959855380 3:111148937-111148959 TTCTAGTTCAAGGAGAGAGAAGG - Intronic
960515933 3:118602764-118602786 ACTTAACTCCAAGAGAGGGAAGG + Intergenic
960659843 3:120045486-120045508 TTTTAAATAAGGAAGAGGGAAGG - Intronic
961192113 3:124970635-124970657 TTTTAAGTCCAGGAGAGAGAGGG - Exonic
963802175 3:149687103-149687125 GTAGAACTCAATGAGAGGGAAGG - Intronic
963811374 3:149780014-149780036 TTGTAAGGCCAGGAGAGGGAGGG + Intronic
964397879 3:156266272-156266294 TGTAAAATCAAGTAGAGGGAAGG + Intronic
965018908 3:163199887-163199909 TTTTAACTCAAGAAGGCAGAAGG - Intergenic
965317293 3:167208404-167208426 CTTCTCCTCAAGGAGAGGGAAGG - Intergenic
965889016 3:173486644-173486666 ATTTAGCTCAAGGAAATGGAAGG + Intronic
965898696 3:173612404-173612426 TTTAAAATCAAGGAGTGGGAAGG + Intronic
966483989 3:180447230-180447252 TTTTCCCCCAAGGAGAGTGAGGG + Intergenic
966782730 3:183598484-183598506 TTTTAACTCAAAGAGATTGCTGG + Intergenic
967641677 3:191872758-191872780 TTTTCACTGAAGGAGAGAAATGG + Intergenic
972303141 4:37805070-37805092 TTTTCAAACAAGGAGATGGAGGG + Intergenic
972337071 4:38116553-38116575 TGTGAACTTTAGGAGAGGGAAGG + Intronic
972665453 4:41160711-41160733 TTCTAGCTCAAAGAGAGGGAGGG + Intronic
972815077 4:42636025-42636047 TTTTAAGTCAAAGAGGGGCATGG + Intronic
973758206 4:54095241-54095263 TTTTAATGCAAGGCCAGGGAAGG - Intronic
973845303 4:54905877-54905899 TTTCAAATCAAGCAGAAGGAAGG + Intergenic
974187282 4:58460331-58460353 TTTTAAATCAGAGAGAGAGAAGG - Intergenic
975335405 4:73170171-73170193 TTTTCTCTCAAGCAGAAGGAAGG - Intronic
977857382 4:101910364-101910386 TTTTAATTCAAGGACACAGATGG - Intronic
978815887 4:112905010-112905032 ATTTAAATCAAGGGGAAGGAGGG + Intronic
980281666 4:130731314-130731336 ATTTAACTCAAGGGGAGGTACGG - Intergenic
981234638 4:142400882-142400904 TTTTAAATGAAGGAGATTGAAGG + Intronic
982187025 4:152813053-152813075 TTAGAACTCATGGACAGGGAGGG - Intronic
984538424 4:181005608-181005630 TTTTAAATCAAGGCCAGGCATGG + Intergenic
986426756 5:7639425-7639447 ATTTAACCCAAGGAGATGGCTGG + Intronic
988268173 5:28978672-28978694 TATTAAATCAAGGAGAAGAAAGG - Intergenic
988531859 5:32034749-32034771 TTTTAAGTCAAGCAAAGGGGAGG + Intronic
991933893 5:71783031-71783053 ATTTCTGTCAAGGAGAGGGAGGG + Intergenic
992879201 5:81088335-81088357 TTCTAACTGGAGGAGAGGGGAGG - Intronic
993116489 5:83725416-83725438 TTTTAATGCAATGAGGGGGAGGG + Intergenic
993598483 5:89889613-89889635 ATTTACATTAAGGAGAGGGAAGG + Intergenic
994705063 5:103193980-103194002 ATTTAACTAAATGAGAGGAAGGG - Intronic
994713491 5:103294888-103294910 TTTTCACTCAAGGGGAGCCAGGG + Intergenic
994988606 5:106969469-106969491 TTTAATCCCAGGGAGAGGGAGGG + Intergenic
995344773 5:111099564-111099586 TTTTTGCTCAAGTAGAGGGAGGG + Intronic
998161917 5:139817778-139817800 TTGTGACTCTAGGAGAGGAAGGG + Intronic
998268265 5:140683089-140683111 TTTGAACTAAAGGTGAGGAATGG - Exonic
998649421 5:144101314-144101336 TTTTGACTGGTGGAGAGGGATGG + Intergenic
999012009 5:148053139-148053161 CTTTAAATTAAGGAGAGAGAAGG - Intronic
999229080 5:150051066-150051088 TTTTAATAAAAGGAGAGGGTTGG - Intronic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
1003646984 6:7920892-7920914 TAGTAACTAAAGGAGAGAGAGGG + Intronic
1003782324 6:9443675-9443697 ATTTATCTCAAGGAGCGGGTGGG + Intergenic
1004006021 6:11637903-11637925 TTTTGAATCAATGAGAGGGGTGG - Intergenic
1004834404 6:19515074-19515096 TTATAACTCAAGGTGAGAGGTGG - Intergenic
1005695847 6:28352100-28352122 TTTTACCAAAAGGAGTGGGAGGG - Intronic
1008413583 6:51213568-51213590 TATTAACTCCATGAGAGGGAGGG - Intergenic
1008917788 6:56808485-56808507 TTTTAAATCATGGAGAAGAAAGG + Intronic
1010492741 6:76494382-76494404 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1011054023 6:83186261-83186283 ATTTATTTCAAGGAGAGGTAAGG + Intronic
1013826547 6:114217892-114217914 TTTTAATGCAAGGAGAGTGAGGG - Intronic
1014258441 6:119187700-119187722 TTATTCCTCAAGGAGTGGGAGGG - Intronic
1016318881 6:142820339-142820361 TTTAAACTGGAAGAGAGGGAGGG - Intronic
1016653399 6:146488911-146488933 TTATATCTCAAGGAGAGAAACGG - Intergenic
1019850378 7:3549862-3549884 TTTTAGCTCAAGGAAAGAGTCGG - Intronic
1022223788 7:28341943-28341965 TTATAATTTGAGGAGAGGGAAGG + Intronic
1022507359 7:30915373-30915395 TTTGAACTTAAGGGGTGGGAGGG + Intronic
1023304449 7:38809598-38809620 TTTTACCTGAAGGACAGAGATGG - Intronic
1028163294 7:87509893-87509915 TCTTAACTGAAGAAGAAGGAGGG + Intronic
1028410166 7:90522070-90522092 GTTTAGCTTAAGGAGAGGGAGGG + Intronic
1028886082 7:95934739-95934761 TTAAAATTCAAGGAGAGGCAAGG - Intronic
1029956902 7:104649677-104649699 TCTAAATTCAGGGAGAGGGAAGG + Intronic
1031610717 7:123823897-123823919 TTTTCACTTAAGCAGTGGGATGG - Intergenic
1032995256 7:137439018-137439040 TTATTTCTGAAGGAGAGGGAAGG + Intronic
1034381636 7:150701025-150701047 TTTTAAGAGAAGCAGAGGGAAGG - Intergenic
1035620197 8:1030839-1030861 TCTTTCCTCCAGGAGAGGGAAGG - Intergenic
1036616565 8:10392362-10392384 TGTTCAGTCCAGGAGAGGGAAGG + Intronic
1036965144 8:13289169-13289191 TTCTAACTCTATGAGATGGAGGG - Intronic
1037103525 8:15077528-15077550 TTCTAACTGAAGGAGAAGAAGGG + Intronic
1037613456 8:20495818-20495840 TTATAACACATGGAGAGCGAAGG + Intergenic
1038461256 8:27719117-27719139 TATTCACACAAGGAGAGAGAAGG + Intergenic
1038558636 8:28548209-28548231 CTTTATTTCAAGGAGAGAGATGG - Intronic
1039234647 8:35488556-35488578 TTCTAACTCAAGGGGCTGGAAGG + Intronic
1039429315 8:37513240-37513262 ATTGTACTCAAGGTGAGGGAAGG - Intergenic
1039436431 8:37562508-37562530 TTTTTACTGGAGGAGAGGGGAGG + Intergenic
1040032511 8:42838809-42838831 TTCTACCTGAAGTAGAGGGACGG + Intronic
1040848863 8:51877403-51877425 TTTTAAATAAAGAAGAGGAACGG + Intronic
1041631121 8:60088275-60088297 TTTTAACTGTATGAAAGGGAAGG + Intergenic
1043351038 8:79360919-79360941 AGTTAACTCAAGGAGAGGTCTGG - Intergenic
1043497730 8:80821415-80821437 TTTTTGCTCAAGGAGACAGATGG + Exonic
1044307046 8:90649894-90649916 TTTTAAGTGAAGGAAAGGGATGG + Intronic
1044360396 8:91276683-91276705 TTTTAACCCAAGTAGAAAGAGGG - Intronic
1044953768 8:97458944-97458966 TCTTAACTCAAGAAGAATGAAGG + Intergenic
1046654561 8:116878933-116878955 TTTTAATACAAGGAGGTGGATGG - Intergenic
1047888066 8:129274871-129274893 TTGAAACTGAAGGAAAGGGAAGG + Intergenic
1048239812 8:132730246-132730268 TTTTAACTCAAGGCCAGGCATGG - Intronic
1048298895 8:133237300-133237322 TTTCTACTCAAGGCCAGGGAAGG + Exonic
1048380438 8:133860598-133860620 TTTCAACAGAGGGAGAGGGATGG - Intergenic
1048661200 8:136603717-136603739 TTTTAACTCTAGGAGAAAAAAGG + Intergenic
1049179268 8:141212753-141212775 TTCTAGCTCAAGGAGAGGGCAGG + Intronic
1049750073 8:144278941-144278963 TTTTTACTCAGGGAAAAGGAAGG + Intronic
1052735676 9:32340009-32340031 TTTTAATTTTAGGAGAGGAATGG - Intergenic
1053122858 9:35559425-35559447 TTTTAACTCAAGCAGAGGCTGGG - Intronic
1055122708 9:72680965-72680987 TTCTAACTCAAGAAGAAGAATGG - Intronic
1057038445 9:91829899-91829921 TTTTTACTCAAAGAAAGGGCTGG - Intronic
1057173732 9:92978804-92978826 TTCTGTCTCAAGGAAAGGGAAGG - Intronic
1060700096 9:125743653-125743675 TATAAACTCATGGAAAGGGATGG + Intergenic
1185930221 X:4194533-4194555 TTTTAAATAAAGGTGAGGAAGGG - Intergenic
1186446016 X:9629672-9629694 TTTTAAATCAAGGAAAACGATGG - Intronic
1186870602 X:13767414-13767436 TTTTAAGACAAGGAGAGGACAGG - Intronic
1187791785 X:22958303-22958325 TTGTAGATCAGGGAGAGGGAGGG + Intergenic
1189200709 X:39193537-39193559 TTTCAACTTTCGGAGAGGGATGG - Intergenic
1190320055 X:49174791-49174813 TTTTACCTCAAAGAGGGGGTGGG - Exonic
1190843492 X:54168873-54168895 GTTTAAATAAAAGAGAGGGAGGG - Intronic
1191704198 X:64076477-64076499 ATTGAACTCATGGAGATGGAGGG + Intergenic
1193150205 X:78116971-78116993 AACTAAGTCAAGGAGAGGGAAGG + Intronic
1195108980 X:101626500-101626522 TATAAACTGAAGGACAGGGATGG - Exonic
1195704641 X:107729957-107729979 TTTTAACTTAACAAGAGGGCAGG + Intronic
1197460781 X:126737940-126737962 TTTCAGCTCCAGGAGAGGGAGGG - Intergenic
1198033678 X:132780295-132780317 TTTATACTGAAGGAGAGGGTAGG - Intronic
1199343545 X:146710752-146710774 TTTTAACTCAAAGTGAGATACGG + Intergenic
1199505058 X:148552267-148552289 CTTTAACTCACAGAGAGTGATGG + Intronic
1202247256 Y:22832859-22832881 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1202400245 Y:24466607-24466629 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1202470536 Y:25203479-25203501 TTTTAACATAAGGAGAAGTAGGG - Intergenic