ID: 1092110189

View in Genome Browser
Species Human (GRCh38)
Location 12:5955194-5955216
Sequence CTGCCTGCTAATTGCAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092110189_1092110191 10 Left 1092110189 12:5955194-5955216 CCAGTATTGCAATTAGCAGGCAG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1092110191 12:5955227-5955249 TTTATTATACTTTAAGTTTTAGG 0: 4143
1: 17745
2: 12044
3: 7139
4: 5709
1092110189_1092110192 11 Left 1092110189 12:5955194-5955216 CCAGTATTGCAATTAGCAGGCAG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1092110192 12:5955228-5955250 TTATTATACTTTAAGTTTTAGGG 0: 13628
1: 11495
2: 6190
3: 3554
4: 2856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092110189 Original CRISPR CTGCCTGCTAATTGCAATAC TGG (reversed) Intronic
906135105 1:43493667-43493689 TTGCCTGCTAATTCCAACACTGG + Intergenic
907513372 1:54978794-54978816 CTGGGTGCTAATTGAAATCCAGG - Intergenic
911382280 1:97130026-97130048 CTGCCTTTAAATAGCAATACAGG + Intronic
920793817 1:209119034-209119056 TTGTCTGCTAATTCCAATATCGG + Intergenic
921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG + Intergenic
923858945 1:237873660-237873682 CTGCATGGTAATTGCAAAAAGGG + Intergenic
1063780494 10:9316886-9316908 CTGCCTGTGAATGGCAATATGGG + Intergenic
1066804357 10:39229685-39229707 CTGCCTTCTAATTTTAATAGTGG - Intergenic
1066805337 10:39244610-39244632 CTGCCTTCTAGTTTTAATACTGG - Intergenic
1067994634 10:51257958-51257980 CTTCCTCCTAATTCCAATAGGGG - Intronic
1070694610 10:78552599-78552621 CTGCCTGCTACTTGCACTTGGGG + Intergenic
1072282479 10:93879970-93879992 CTGCCTGATCATTGCAACAGAGG + Intergenic
1072782458 10:98259851-98259873 CTGCCTGGTAATTGCACACCTGG - Intronic
1078407561 11:11083804-11083826 CTGCGTGAATATTGCAATACAGG - Intergenic
1079385557 11:19976296-19976318 CTACCTGCTGCTTGAAATACGGG - Intronic
1079858712 11:25640069-25640091 CTGCCAACTAACTGCATTACTGG - Intergenic
1083734750 11:64673159-64673181 CTGCCTGCTACTTGCAGTCCAGG + Intronic
1089108952 11:116039175-116039197 CTCACTGCTAATTGAAATGCAGG + Intergenic
1089205061 11:116753666-116753688 CTGTCTGCTAATTGCAACATTGG - Intronic
1089205165 11:116755052-116755074 CTGTCTGTTAATTGCAACATTGG - Intronic
1089662466 11:119994331-119994353 CTGCCTTCTCCTTGCAATATTGG - Intergenic
1090545902 11:127767821-127767843 CTGCAGGATAATTGCAATGCTGG + Intergenic
1092110189 12:5955194-5955216 CTGCCTGCTAATTGCAATACTGG - Intronic
1095863217 12:46942107-46942129 TTGCCTGCTAATTTCTACACAGG - Intergenic
1099276618 12:80584455-80584477 CAGTCTGGTAATTGCAAAACAGG - Intronic
1104553835 12:129781875-129781897 GTGACTGCTAATTGCCAAACAGG - Intronic
1105022522 12:132826718-132826740 CTGCCAGCTTATTGCCCTACAGG - Intronic
1106339707 13:28817242-28817264 GTGCCTTCTGACTGCAATACAGG + Intergenic
1111271171 13:85888108-85888130 ATACCTGCTAAGTGCTATACAGG + Intergenic
1112221071 13:97491305-97491327 GTGCCTGATAATTCCAATATCGG + Intergenic
1112732170 13:102376494-102376516 CTGACTGCTAATTGAAAACCTGG - Intronic
1113108764 13:106799459-106799481 CTGCCAGCTAAGTGCAAGAAAGG - Intergenic
1119499987 14:75117154-75117176 CAACCTGCTAAATGCAATATGGG + Intronic
1121845564 14:97169313-97169335 CTGCCTGCTTTTTGCAACAAAGG - Intergenic
1129714485 15:77839259-77839281 GTGCCTGGTAAGTGCTATACGGG + Intergenic
1137778270 16:51074675-51074697 TTGCCTGGTAATTGCTAAACAGG - Intergenic
1142138534 16:88462340-88462362 CTGTCTGCTAAGTGCCTTACGGG + Intronic
1145260058 17:21349238-21349260 CTTCCTGCTGATTTCAATCCTGG + Intergenic
1145316560 17:21738700-21738722 CTTCCTGCTGATTTCAATCCTGG - Intergenic
1145714981 17:27010607-27010629 CTTCCTGCTGATTTCAATCCTGG - Intergenic
1153069868 18:1092754-1092776 CTGCCTCCTAATTTCCATAGAGG - Intergenic
927268943 2:21184917-21184939 CTGCCTGCTACTTACTCTACTGG - Intergenic
928444761 2:31323389-31323411 CTGCGTGTTAATTCCAATATTGG + Intergenic
929612260 2:43279925-43279947 CTGCCTGTTAATTGCATTCTAGG - Intronic
929765399 2:44839844-44839866 CTCCCTGCTGATTGCAAGAGAGG + Intergenic
932651102 2:73558008-73558030 CTTCCTGCTGGTTGCAATATGGG - Intronic
936155095 2:110042154-110042176 CTGCCTTCTGCTTGCAAGACAGG - Intergenic
936189585 2:110329260-110329282 CTGCCTTCTGCTTGCAAGACAGG + Intergenic
936578735 2:113676983-113677005 CTGCCATAAAATTGCAATACGGG + Intergenic
936739006 2:115481453-115481475 CAGCCTACTTACTGCAATACCGG - Intronic
939433513 2:142142573-142142595 CTGACTGCATATTGCAATTCTGG + Intergenic
945593120 2:211758961-211758983 GTGCCTGCTAATTGCACAAGTGG - Intronic
946184029 2:217966878-217966900 CTGCCTGCTGGTTGCATAACTGG + Intronic
1168905496 20:1400294-1400316 CTGCCTGCTACATGCCAAACAGG + Intergenic
1174990814 20:55507159-55507181 TTGTCTGCTAATTCCAATATTGG - Intergenic
1181958356 22:26604773-26604795 CTGGCTGGTAATTGCACTAAGGG - Intronic
951038117 3:17956038-17956060 CTCACTGCAAATTGTAATACTGG - Intronic
952793476 3:37218434-37218456 CTGCCTGCCAATGGCAAGCCAGG - Intergenic
953846349 3:46429988-46430010 CTGCCTGCTACATGCCAAACAGG + Intergenic
955772837 3:62403637-62403659 CTGTCTGCTAAGTACAATACTGG + Intronic
956717859 3:72094102-72094124 CTGCCTGCTAATCACAAGGCAGG - Intergenic
959315600 3:104802449-104802471 ATGCCTGACAATTGCAATATTGG + Intergenic
962050728 3:131812139-131812161 CTGCATCCTAATTGCAATCCTGG - Intronic
964475557 3:157094949-157094971 CTGCCTGCTGAATGCATGACTGG - Intergenic
970029632 4:11660238-11660260 CTGTCTTCAATTTGCAATACTGG + Intergenic
974407391 4:61492069-61492091 CTAATTGCTAATTGTAATACAGG - Intronic
978002912 4:103578691-103578713 CTGCCTTCCACTGGCAATACTGG - Intergenic
979283214 4:118890886-118890908 TTGCCTACTAATTGAAATATGGG + Intronic
981578657 4:146230333-146230355 CTGTCTGCTGGTGGCAATACTGG - Intergenic
985829377 5:2216766-2216788 CTGCCTGCTCATGGAAACACTGG - Intergenic
991160863 5:63500509-63500531 CTGACTTCAAATTGCACTACAGG - Intergenic
991288252 5:65005127-65005149 CTGCCTGCTACTGCCAGTACTGG - Intronic
1002993798 6:2264001-2264023 TTGCCTGTTAATTGCAATCTGGG + Intergenic
1004395986 6:15246921-15246943 TTGCATGCAAAGTGCAATACGGG - Intronic
1007531651 6:42547996-42548018 CTGCCTGCGAATTTGAATACAGG - Intergenic
1008707466 6:54180973-54180995 CTGCCTGATAATTCAAAGACAGG - Intronic
1009871930 6:69463575-69463597 CTGCATGCTCATTCCACTACAGG + Intergenic
1010567713 6:77437381-77437403 TTGCCTACTTATTCCAATACAGG + Intergenic
1011918633 6:92542965-92542987 CTGCCTGCTAATTACATTGTTGG + Intergenic
1018570911 6:165208735-165208757 CAGCCTGCTTATTCCAATTCAGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1023784030 7:43687820-43687842 CTGCCTGTTAATGGAAGTACAGG - Intronic
1025604634 7:63030504-63030526 TTCCCTGCTAATTGCAAGCCTGG - Intergenic
1025774652 7:64549517-64549539 CTGCCTGGGATTTACAATACAGG - Intronic
1031293177 7:119965631-119965653 CTGCCTTCAAATTGAAATATTGG + Intergenic
1036780331 8:11642621-11642643 TTCCCTGCTAATTGCAAGCCTGG + Intergenic
1037948921 8:23006459-23006481 TTGCCTGCTAATTGCCAGAGAGG + Intronic
1044538768 8:93386790-93386812 ATGACTGCTAATGGCAATACAGG + Intergenic
1046164899 8:110419799-110419821 CTCCCTGCTAAATGAAATGCAGG - Intergenic
1048107280 8:131425268-131425290 TTGCATTCTAATTGGAATACAGG - Intergenic
1057219615 9:93249355-93249377 CTGACTGATGATTGCAATTCAGG + Intronic
1190949918 X:55133415-55133437 CTTCCTCCTAATTTCAAAACTGG - Intronic
1195166259 X:102223566-102223588 CTGCCTTCTTATAGCAATAGAGG + Intronic
1195192600 X:102463522-102463544 CTGCCTTCTTATAGCAATAGAGG - Intronic
1196911677 X:120490150-120490172 CTGCCTGCCACTTGGAGTACTGG + Intergenic
1197463034 X:126766727-126766749 CTGCCTCCTTATTACTATACTGG + Intergenic
1199493007 X:148422072-148422094 CTGCATGGTAAGGGCAATACTGG - Intergenic