ID: 1092113477

View in Genome Browser
Species Human (GRCh38)
Location 12:5981544-5981566
Sequence AATTTCCACTCAGGCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092113475_1092113477 -10 Left 1092113475 12:5981531-5981553 CCTGAGTTAACTAAATTTCCACT 0: 1
1: 0
2: 1
3: 6
4: 143
Right 1092113477 12:5981544-5981566 AATTTCCACTCAGGCTGAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 139
1092113473_1092113477 27 Left 1092113473 12:5981494-5981516 CCATGCTTAGTACATAGTAGGCT 0: 1
1: 0
2: 2
3: 24
4: 180
Right 1092113477 12:5981544-5981566 AATTTCCACTCAGGCTGAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 139
1092113474_1092113477 -7 Left 1092113474 12:5981528-5981550 CCTCCTGAGTTAACTAAATTTCC 0: 1
1: 0
2: 0
3: 8
4: 160
Right 1092113477 12:5981544-5981566 AATTTCCACTCAGGCTGAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092113477 Original CRISPR AATTTCCACTCAGGCTGAGC TGG Intronic
900753480 1:4416221-4416243 CATATCCACTCAGACTGAGCTGG - Intergenic
900973059 1:6002065-6002087 CATTACCAGTCAGGCTGAGCTGG - Intronic
901294197 1:8147837-8147859 ATTTTCCAGCCAGGCTGAGTGGG + Intergenic
901805886 1:11738265-11738287 ACTGCCCACTCTGGCTGAGCTGG - Intronic
904225877 1:29018966-29018988 AGTTTACAGTCAGTCTGAGCTGG + Intronic
907250848 1:53138102-53138124 AATTTCCCCTCAGGTTTAGAAGG + Intronic
911852675 1:102838861-102838883 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
913351926 1:117871001-117871023 AATTTAAATTCAGGCTGTGCTGG - Intronic
917891175 1:179439757-179439779 TCTTTGCACTCAGGCTCAGCTGG + Intronic
1065010147 10:21413621-21413643 TATTCCCATTCAGTCTGAGCAGG + Intergenic
1065179183 10:23107766-23107788 AATATAAACCCAGGCTGAGCTGG - Intronic
1067327606 10:45284616-45284638 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
1069123002 10:64591890-64591912 TCTCTCCACTCAGGCTGTGCTGG - Intergenic
1071168497 10:82834731-82834753 AATATCCACTTAGGGTGAGTTGG + Intronic
1078399944 11:11017369-11017391 TTTTTCCAATGAGGCTGAGCAGG - Intergenic
1083354039 11:62052133-62052155 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
1085980580 11:81719001-81719023 CTATTCCACTGAGGCTGAGCTGG - Intergenic
1087299310 11:96413776-96413798 ATTCTCCACTAAGGCTGAGCTGG - Intronic
1092113477 12:5981544-5981566 AATTTCCACTCAGGCTGAGCTGG + Intronic
1095606766 12:44077110-44077132 AATACCCACGCAGGCTTAGCAGG + Intronic
1098898091 12:76084962-76084984 AATTTCCTTTCCGGCTCAGCAGG - Exonic
1099350267 12:81558776-81558798 AATTTCCACTCTGGCTGGAGTGG + Intronic
1100894521 12:99165369-99165391 AATCTCTATTCAGGCTGACCAGG + Intronic
1103217597 12:119214344-119214366 GATTTGCACTCAGGCAGAGTGGG - Intronic
1104719895 12:131039367-131039389 ACCCTCCTCTCAGGCTGAGCTGG - Intronic
1107414953 13:40191791-40191813 AATTTTCTCCCAGCCTGAGCTGG - Intergenic
1108356088 13:49629982-49630004 AAGTTCCAGTCAGACAGAGCTGG - Intronic
1113766526 13:112884350-112884372 TATCTCCACACAGGCAGAGCTGG - Exonic
1114140863 14:19908928-19908950 AACTTCCACTCAGCCTGATTTGG + Intergenic
1114336354 14:21694647-21694669 AATTTCAACTCAAGCTGAAGGGG - Intergenic
1115000885 14:28418657-28418679 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
1118071647 14:62252187-62252209 ATTTTCCAATCAGGTTGTGCAGG + Intergenic
1118092749 14:62500234-62500256 ATTTTCCAGTTAGGCTGACCGGG + Intergenic
1120899846 14:89566350-89566372 AATTTCTACCCAGCGTGAGCTGG - Intronic
1121904917 14:97730861-97730883 TACTTCCTCTCAGGCTGAACCGG - Intergenic
1121992651 14:98574652-98574674 AACCTCCACTCAGGTTCAGCAGG - Intergenic
1129866829 15:78915320-78915342 AATGTCCACTCCTGCAGAGCCGG - Intergenic
1131716264 15:95113957-95113979 TCTTTCCACTGTGGCTGAGCCGG - Intergenic
1135474950 16:22765756-22765778 AATATCCACAAGGGCTGAGCAGG - Intergenic
1136555061 16:31002739-31002761 CATTTCCACTGGGGCTGATCAGG - Intronic
1139716704 16:68819337-68819359 CATTTCCACTCGGGCTGAGCTGG + Exonic
1140914437 16:79481921-79481943 AATTTTCTCTAAGTCTGAGCAGG - Intergenic
1141303193 16:82837184-82837206 GATTTTCCCTCAGGCTCAGCGGG + Intronic
1141768583 16:86074866-86074888 CATTTCCTCTCTGGCAGAGCAGG - Intergenic
1147390611 17:40106970-40106992 TCTTTCCACTCAGGCTGAGCCGG - Intergenic
1147478063 17:40733157-40733179 AATCTCCACTCAGGCTCAGAGGG - Intergenic
1148656995 17:49292286-49292308 AACTTCCACTCTGGCTGTGAAGG + Intronic
1150445423 17:65224402-65224424 GATCTCCCCTCAGGCAGAGCCGG - Intronic
1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG + Intronic
1151728516 17:75897773-75897795 CATTTCCCCTGAAGCTGAGCAGG + Intergenic
1152809344 17:82374230-82374252 TCTTTCCCCACAGGCTGAGCTGG + Exonic
1153077804 18:1185425-1185447 AAATTCAAATCAGGCTGATCAGG - Intergenic
1153442838 18:5139944-5139966 TATTTCCACTGAAGCTGACCTGG - Intergenic
1155074846 18:22345639-22345661 ACTTTCCATCCAGCCTGAGCTGG - Intergenic
1155154437 18:23146495-23146517 AACTACCATTCAGGCTGGGCAGG - Intronic
1159057852 18:63484163-63484185 AATGGCCACTGTGGCTGAGCAGG + Intronic
1161709852 19:5841753-5841775 AATTTCCTCTGAGGCTTAGAGGG - Intergenic
1161716056 19:5876905-5876927 AATTTCCTCTGAGGCTTAGAGGG - Intronic
1164291028 19:23868868-23868890 TTTTTGCACTCAGGCTCAGCTGG - Intergenic
1165178485 19:33947663-33947685 AATCTTCCCTCAGGCTGTGCTGG + Intergenic
1165765930 19:38351214-38351236 ACTTTCCAATGAGGCTGAGGCGG + Intronic
926449021 2:12979884-12979906 AATTTGAAAGCAGGCTGAGCAGG - Intergenic
927990147 2:27442089-27442111 CCTTTCCACACAGGCTGGGCGGG - Exonic
928974659 2:37072731-37072753 AATCTCTAGTCAGGCTGATCAGG + Intronic
929298302 2:40272658-40272680 AGTTCCCAGGCAGGCTGAGCTGG + Intronic
930230620 2:48840739-48840761 TATTTCTACTGTGGCTGAGCTGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
934774496 2:96928537-96928559 AATATCCACTCAGGAACAGCAGG - Intronic
935078549 2:99770160-99770182 CTATTCCACTCTGGCTGAGCTGG + Intronic
935187515 2:100747496-100747518 AATTTCCACCCAGGGGGAGATGG - Intergenic
940361392 2:152799905-152799927 AATTTCAGCTCAGGCTGAATTGG - Intergenic
941846462 2:170139426-170139448 AGTTTGGACTCAGGATGAGCTGG + Intergenic
942944989 2:181662451-181662473 AATTCCCACTCAGCATGAGAGGG - Intronic
943018789 2:182547660-182547682 AATTTACACTCAGGCAGACTAGG + Intergenic
947537058 2:230946752-230946774 AGTTTCCACTCTGGCAGAGCTGG + Intronic
948249299 2:236512770-236512792 AATTTACAATTAGGCTGATCTGG + Intergenic
1170414036 20:16121069-16121091 TACTTCCATTCAGACTGAGCAGG - Intergenic
1172801418 20:37578992-37579014 AAGTTGCACAGAGGCTGAGCTGG - Intergenic
1174277028 20:49411356-49411378 GATTTGAACTCAGGCAGAGCTGG + Intronic
1174552570 20:51372546-51372568 AATTTCCCTTTAGGCTGAGCAGG - Intergenic
1174749637 20:53099103-53099125 CATTACCTCTTAGGCTGAGCTGG - Intronic
1181790759 22:25264143-25264165 AATTTTCTCTCTGGTTGAGCTGG - Intergenic
1182882523 22:33745797-33745819 AACTTCCACCCAGGCTCAGTGGG - Intronic
1185355740 22:50368860-50368882 AAATTCTACTCAGTGTGAGCTGG - Intronic
949435197 3:4021351-4021373 AATTTCCACTATAGCTGTGCTGG - Intronic
951043099 3:18009910-18009932 AATTTCCCCTCAGGCAAAGTAGG + Intronic
951683861 3:25323254-25323276 TATTTCCCCTCATTCTGAGCTGG - Intronic
952427614 3:33191647-33191669 AATTTACACTCAGGCTGGCTGGG + Intronic
953803579 3:46048488-46048510 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
953846427 3:46430588-46430610 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
955003597 3:54949405-54949427 AATTTGAACTCCAGCTGAGCTGG - Intronic
961223361 3:125217640-125217662 AAGGTCCACTCAGGCTCAGTGGG - Intergenic
961830999 3:129623016-129623038 CATCCCCACCCAGGCTGAGCAGG - Intergenic
971395944 4:26227559-26227581 CATCTCCACTCAGGCTGTGGAGG - Intronic
974289271 4:59910243-59910265 AATTTTGCCTCAGGCAGAGCAGG - Intergenic
975737403 4:77394602-77394624 TCTTTGCACTCAGGCTCAGCTGG + Intronic
975847878 4:78544104-78544126 AATGTTTACTCAGTCTGAGCAGG - Intronic
976128646 4:81860358-81860380 TATTTCTACTGTGGCTGAGCTGG - Intronic
976787165 4:88835098-88835120 AAATTCCACACATGCTCAGCAGG + Intronic
981550134 4:145935799-145935821 AATTTCCTCTCAGACGGAGAGGG + Intronic
981732604 4:147915280-147915302 AATCTGCACTGAAGCTGAGCTGG + Intronic
981813078 4:148797618-148797640 AATTTGCACCCAGGCAGATCTGG - Intergenic
983549909 4:169007109-169007131 ATTTGCCACTCAAGCTGAGAAGG - Intronic
986808483 5:11331327-11331349 AATTTCCCCTCATACTGAGGAGG - Intronic
987190472 5:15472180-15472202 AATTGCCACTCAGCCTGATAGGG - Intergenic
994042906 5:95277623-95277645 AAATTCCACTCCAGCAGAGCTGG + Intronic
995039429 5:107571219-107571241 AATTCCCACTCTGGCTGGGGCGG - Intronic
995526026 5:113051212-113051234 AGTTTCCACAGAGGATGAGCTGG + Intronic
1000934423 5:167291162-167291184 AATTTCCACTGAGAAAGAGCAGG - Intronic
1002058214 5:176610542-176610564 AATTTCCTCGCTGGCGGAGCCGG - Intergenic
1002562557 5:180092197-180092219 AATTTCCACCCTGAGTGAGCTGG + Intergenic
1002630844 5:180576225-180576247 AATTTCCAGTGAAGGTGAGCTGG + Exonic
1002891662 6:1337995-1338017 ATTTTTGACTCAGACTGAGCTGG - Intergenic
1003513426 6:6800183-6800205 GTTTTCCATTCAGGGTGAGCTGG - Intergenic
1006228554 6:32561945-32561967 TCTTTTCACTCAGGCTCAGCTGG + Intronic
1006897097 6:37478213-37478235 AATTCCCACTCAGGCAGTGGAGG - Intronic
1010986608 6:82432507-82432529 AATATTCCCTCAGGCTGAGGTGG + Intergenic
1015806223 6:137111722-137111744 AAGTTGCATTCAAGCTGAGCTGG + Intergenic
1017534193 6:155328942-155328964 AATTTCCACACAGTCTCTGCTGG - Intergenic
1019638183 7:2088120-2088142 TATTTCCACTCAGCCTGTGCGGG - Intronic
1020151408 7:5684629-5684651 CAGTTCCACTCAGGCTGTGGTGG + Intronic
1022896019 7:34751126-34751148 GTTTTCCACACTGGCTGAGCAGG + Intronic
1023409352 7:39873720-39873742 AATTTCCCTTCAAGCTGAGAAGG - Intergenic
1023815762 7:43948789-43948811 CATTTCCACTCAGTCAGTGCTGG - Intronic
1025043583 7:55670308-55670330 AATTTCCCTTCAAGCTGAGAAGG + Intergenic
1025136505 7:56418814-56418836 AATTTCCCTTCAAGCTGAGAAGG + Intergenic
1026154309 7:67813800-67813822 AACTTCCACTCAGGCTGGTAAGG - Intergenic
1026240199 7:68567184-68567206 AATTTCAACTCAGGCTGTCTAGG - Intergenic
1030078629 7:105758378-105758400 GATTTACACTCAGTCAGAGCAGG + Intronic
1034190155 7:149207602-149207624 AATTTCGACTCTGGCAGAACTGG - Intronic
1034874100 7:154709957-154709979 AATGTGGACTCAGGCAGAGCCGG - Intronic
1037695703 8:21222065-21222087 TATTTTTATTCAGGCTGAGCTGG - Intergenic
1040345213 8:46485852-46485874 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
1041490329 8:58426135-58426157 ATTTTCCACTTTGGCTGAGTTGG - Intronic
1043575477 8:81651553-81651575 AATTTCCAAGCAGGCTCATCAGG + Intergenic
1043832063 8:85001541-85001563 CCTTTCCCCTCAGCCTGAGCTGG - Intergenic
1045343939 8:101277804-101277826 AATCTCCACCCAGTCTGATCTGG - Intergenic
1055454688 9:76461113-76461135 AATATCCACCCAGCCTTAGCAGG - Intronic
1056785578 9:89590552-89590574 AAGATCCACCCAAGCTGAGCTGG + Intergenic
1056891674 9:90499997-90500019 AATTTCCAGTTAGGGAGAGCAGG - Intergenic
1061573794 9:131493788-131493810 ACTCACCACACAGGCTGAGCGGG + Intronic
1186210490 X:7245356-7245378 AATTTCCTCTCTGGTTGAACTGG + Intronic
1187507227 X:19887576-19887598 AATTTCCACTCGCGGGGAGCAGG - Exonic
1188694381 X:33171950-33171972 AATTTCAAGTCAGGATGACCTGG - Intronic
1190722290 X:53159688-53159710 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
1193676075 X:84454231-84454253 TATCTCCACTGTGGCTGAGCTGG - Intronic
1195446515 X:104958355-104958377 AATTTCCAGGCAGTCTGACCTGG - Intronic
1197997207 X:132390325-132390347 AATTTCCCCCCAGACTAAGCAGG + Intronic
1201677790 Y:16606676-16606698 AATTTCCTCCCAGTGTGAGCGGG - Intergenic