ID: 1092117400

View in Genome Browser
Species Human (GRCh38)
Location 12:6019133-6019155
Sequence CGATGAGGCGGATCTGCTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092117396_1092117400 1 Left 1092117396 12:6019109-6019131 CCTTGTTCTCAGGGGCCTGCTTC 0: 2
1: 0
2: 3
3: 42
4: 888
Right 1092117400 12:6019133-6019155 CGATGAGGCGGATCTGCTTGAGG 0: 1
1: 1
2: 0
3: 3
4: 48
1092117392_1092117400 22 Left 1092117392 12:6019088-6019110 CCACACTGCTCAGCACGAAGGCC 0: 1
1: 1
2: 1
3: 18
4: 138
Right 1092117400 12:6019133-6019155 CGATGAGGCGGATCTGCTTGAGG 0: 1
1: 1
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092117400 Original CRISPR CGATGAGGCGGATCTGCTTG AGG Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900786843 1:4654943-4654965 CGATGGGGCGGCGCTGCTTAGGG - Intronic
900787789 1:4659600-4659622 CTCTGAGGCGGATGTACTTGGGG - Intronic
1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG + Intronic
1064106134 10:12502408-12502430 CGATGAGGCGTCTTGGCTTGTGG + Intronic
1069524380 10:69154628-69154650 CAATGTGGCAGAACTGCTTGAGG + Intronic
1078483000 11:11695656-11695678 GGATGAAGCCGATCTGATTGTGG - Intergenic
1079006508 11:16794868-16794890 GGATGTGGGGGATCTGATTGGGG - Intronic
1091232914 11:134000018-134000040 CGACAAGGCCGATCTGCTGGTGG + Intergenic
1092117400 12:6019133-6019155 CGATGAGGCGGATCTGCTTGAGG + Exonic
1100030983 12:90190614-90190636 CCATGAGGGGGTCCTGCTTGTGG + Intergenic
1113247951 13:108419917-108419939 CGATGAGGCTGATGTGTTTTAGG + Intergenic
1118473468 14:66095419-66095441 GGATGAGGCGGAGATCCTTGTGG + Intergenic
1122146079 14:99689571-99689593 AGATGAGGAGGAGCTGGTTGGGG - Intronic
1128704650 15:69829958-69829980 TGATGAGGCTGATCAGTTTGGGG + Intergenic
1130957291 15:88636764-88636786 GGCTGAGGCGGATTTGCTTGAGG - Intronic
1133379119 16:5315224-5315246 CGATGAGGCCCATCTGCTGTGGG + Intergenic
1136367789 16:29816804-29816826 CGAGGAGGTGGAGCTGCCTGCGG + Exonic
1143554221 17:7650837-7650859 CGAGGAGGCGGAGCTTCTGGGGG + Intronic
1146914839 17:36671970-36671992 GGATGAGGAGGATCTGCAGGGGG - Intergenic
1147981014 17:44274007-44274029 CTGGGAGGAGGATCTGCTTGAGG + Intergenic
1152020886 17:77779695-77779717 AGATGAGGGGGATCCGCCTGGGG + Intergenic
940582079 2:155594191-155594213 TTATCAGGCAGATCTGCTTGAGG - Intergenic
1178266822 21:31151098-31151120 CAATGAGGAGGAACTGCTGGAGG + Intronic
1180568839 22:16697546-16697568 CAATGAGGCGGATCTGCTTGAGG + Intergenic
1184460439 22:44634785-44634807 TGATGAGGCAGATTTCCTTGTGG + Intergenic
951079746 3:18438916-18438938 AGATGAGGCTGAAATGCTTGCGG - Intronic
953029128 3:39165912-39165934 AGATGAGGCGGCTCTGCCTATGG + Intergenic
954672304 3:52297639-52297661 CCATGAGGCGGAGCTGCTAAGGG - Intergenic
967890312 3:194360047-194360069 AGATGAAGCTGATCTGATTGCGG + Exonic
968512566 4:1002080-1002102 CGACGAGGCGGACCCGCTGGTGG + Exonic
970470123 4:16369621-16369643 GGATGAAGCTGACCTGCTTGTGG + Intergenic
985691547 5:1315508-1315530 CCATGAGATGGATCTGCATGAGG + Intergenic
988745742 5:34135258-34135280 CGATGAAGCCGATCTTATTGTGG + Intergenic
992481370 5:77155311-77155333 CTATGGGGCGGACCTGCCTGCGG - Intergenic
997197211 5:131988122-131988144 CCATGAGGATGATCAGCTTGAGG + Exonic
998094764 5:139390955-139390977 AGATGAGGGGGGTCTGCATGAGG - Exonic
998166919 5:139849432-139849454 CCATGAGGTGTCTCTGCTTGTGG + Intronic
1006877815 6:37313941-37313963 TTATGAGGCGGTTGTGCTTGTGG + Intronic
1019765040 7:2843921-2843943 GGATGATGCGCATCTGCTTGAGG + Exonic
1023685732 7:42733225-42733247 CGATGATGCAGATCTGCCAGAGG + Intergenic
1030431547 7:109455294-109455316 GGGTGAGGCTGTTCTGCTTGTGG - Intergenic
1030463632 7:109872604-109872626 GGATGAGGAGGATATGATTGTGG - Intergenic
1036453621 8:8890856-8890878 CGATGAGGCGGGTGAGGTTGTGG + Exonic
1036676764 8:10840198-10840220 CCGTGAGGCTGAGCTGCTTGAGG - Intergenic
1055838004 9:80467784-80467806 CGATGAGAAGGATCTGCTCTGGG + Intergenic
1058486361 9:105446908-105446930 AGATGAGGCCTGTCTGCTTGAGG + Intergenic
1062534506 9:137015543-137015565 GGATGAGGCTGACCTGCTTGGGG - Exonic
1188005420 X:25013235-25013257 CGACGAGGAGGAGCTGCTGGAGG - Exonic
1188005429 X:25013298-25013320 CGACGAGGAGGAGCTGCTGGAGG - Exonic
1193904822 X:87229229-87229251 CAATGAGGCTGTACTGCTTGAGG + Intergenic
1194412885 X:93578199-93578221 TCATGAGGCGGCTCTGCATGGGG + Intergenic