ID: 1092118074

View in Genome Browser
Species Human (GRCh38)
Location 12:6023671-6023693
Sequence CTGGGCACACACGTGGGCAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 2, 1: 0, 2: 1, 3: 26, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092118064_1092118074 5 Left 1092118064 12:6023643-6023665 CCGTCCTCCAGGTCACCACCTTG 0: 2
1: 0
2: 4
3: 36
4: 382
Right 1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG 0: 2
1: 0
2: 1
3: 26
4: 154
1092118065_1092118074 1 Left 1092118065 12:6023647-6023669 CCTCCAGGTCACCACCTTGCCAT 0: 2
1: 0
2: 0
3: 26
4: 332
Right 1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG 0: 2
1: 0
2: 1
3: 26
4: 154
1092118069_1092118074 -10 Left 1092118069 12:6023658-6023680 CCACCTTGCCATGCTGGGCACAC 0: 2
1: 0
2: 2
3: 25
4: 224
Right 1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG 0: 2
1: 0
2: 1
3: 26
4: 154
1092118066_1092118074 -2 Left 1092118066 12:6023650-6023672 CCAGGTCACCACCTTGCCATGCT 0: 2
1: 0
2: 0
3: 14
4: 193
Right 1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG 0: 2
1: 0
2: 1
3: 26
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092118074 Original CRISPR CTGGGCACACACGTGGGCAT AGG Exonic
900088923 1:910761-910783 CTGGCCACGCACGTGTGCAGCGG - Intergenic
901055205 1:6446009-6446031 CTGGCCTCACTAGTGGGCATAGG + Intronic
902875231 1:19337026-19337048 AAGGGCACACAGGTGGGCCTAGG - Intergenic
907222095 1:52914570-52914592 CTGGGCACACACGGGAGCCCTGG - Intronic
907272603 1:53299618-53299640 CTGGGCACACAGGTGGGCACAGG - Intronic
908445036 1:64191861-64191883 CTGGGCCCACACGTAGGCTGAGG + Intergenic
911669275 1:100590124-100590146 CTGGGCACACTCAAGGGCTTTGG - Intergenic
915937237 1:160096692-160096714 CAGGCCACACAGCTGGGCATGGG - Intronic
916248164 1:162709099-162709121 CTGGGCACACACTTGAACCTTGG - Intronic
922175341 1:223193133-223193155 CTCTGCACACAGGTGTGCATGGG + Intergenic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1064265451 10:13821735-13821757 CGCGGCACACAGGTGGGCATGGG + Intronic
1064461675 10:15540686-15540708 CTGGGCACAGATGTCAGCATAGG + Intronic
1065247338 10:23771810-23771832 CTGGGCACACCACTGGGCTTTGG - Intronic
1065725113 10:28661606-28661628 CTTTGCTCACACCTGGGCATAGG - Intergenic
1067457286 10:46428021-46428043 CTGGGAACACCAGTGGGGATGGG + Intergenic
1071460393 10:85888280-85888302 CTGGGCCCACGCTTGGGAATGGG - Intronic
1073944716 10:108737336-108737358 CTGGTCCCACCCTTGGGCATGGG - Intergenic
1074103780 10:110374230-110374252 CTGGGCATACAGGTGGGCCTGGG + Intergenic
1074961315 10:118448476-118448498 CTTGGCAAACAAGTGGGCATCGG + Intergenic
1075421760 10:122306555-122306577 CTGGGCTCAGACCTGGGTATAGG - Intronic
1076028015 10:127132844-127132866 CTGGATACACACGAGGGGATTGG + Intronic
1077296554 11:1829154-1829176 CAGGGCAGACACGAGGGCAGAGG + Intronic
1077412648 11:2410738-2410760 CTGGGGACACCCATAGGCATGGG + Intronic
1078098211 11:8313354-8313376 CTGGGGACACCTGTGGGCCTTGG - Intergenic
1078245970 11:9573633-9573655 CTGGGCACTCACGTGGTTAACGG + Intergenic
1078474738 11:11621141-11621163 CTGCGCACACACGTGTGCCCCGG + Intronic
1078582196 11:12547277-12547299 CTGGGCACTCTCTTGGGCATTGG - Intergenic
1080387492 11:31818483-31818505 CTGGGCACAGACGGGGGCTCCGG + Intronic
1082829086 11:57602159-57602181 CTGGGCACTCACCTGGGCTGTGG - Exonic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1084087745 11:66862321-66862343 CTGGCCACACACACAGGCATAGG + Intronic
1084349135 11:68581717-68581739 CTGGGTAAAGATGTGGGCATGGG - Intronic
1084968489 11:72756613-72756635 CTGGGCACAGAAGTGGGGATGGG + Intronic
1085316622 11:75548913-75548935 CTGGGCACTCACCTGGGCTGGGG - Intergenic
1088808972 11:113377010-113377032 CTGGGCACACACAGAGGGATAGG + Intronic
1089197729 11:116704574-116704596 GTGAGTACACAGGTGGGCATAGG - Intergenic
1089750113 11:120645591-120645613 CTTGGCATCCACGTGGACATGGG + Intronic
1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG + Exonic
1092260682 12:6951885-6951907 GTGGGGGCACACATGGGCATGGG - Intronic
1092629340 12:10361640-10361662 CAGGGCATACACGTGGTCTTCGG + Intergenic
1093038749 12:14356082-14356104 CTGGGCACACTTGAGGGCATGGG - Intergenic
1093356360 12:18173025-18173047 GTGAGCACACACTTGGGCAAGGG - Intronic
1096512819 12:52141145-52141167 CTGGGCAACCACGAGGGCAGAGG - Intergenic
1096526668 12:52214105-52214127 CTGGGGACACCAGTGGGCACCGG + Intergenic
1098882004 12:75926591-75926613 CTGGTCACACATGTGGACAGAGG - Intergenic
1101569636 12:105941246-105941268 CTGGGAACACACATGGTTATAGG + Intergenic
1102504503 12:113375047-113375069 GTGGGCACACACGTGGGGAGTGG + Intronic
1102663044 12:114546292-114546314 CTGGGCACACATGTGTACAGAGG + Intergenic
1102665008 12:114564338-114564360 CTGGGCACACACGTGTACAGAGG - Intergenic
1103394568 12:120597728-120597750 CGGGGCAGACACGTGGGGTTGGG - Intergenic
1105011084 12:132757368-132757390 CTGAGCACTCACGTGGCCTTTGG - Intronic
1105759020 13:23496080-23496102 CTGGGCACACAGCTGGTCTTGGG - Intergenic
1113762284 13:112857899-112857921 CTGGAAGCGCACGTGGGCATAGG + Exonic
1113836154 13:113329921-113329943 CTGGGCGCCCAGGTGGGCAGGGG + Intronic
1113857484 13:113455682-113455704 CGGGCCACACACGGGGGCAGGGG + Intergenic
1114645770 14:24255282-24255304 TTGGCCACCCACGTGGGAATTGG - Intronic
1114822205 14:26034039-26034061 CTGGGGACTCACCTGGGCAAAGG - Intergenic
1116136503 14:40930733-40930755 CTGGACAGAGAGGTGGGCATAGG + Intergenic
1117485659 14:56194417-56194439 CTGGGCACTCACTGGGGCAGTGG - Intronic
1119642748 14:76327229-76327251 CTGGGGACCCACGTGGGGGTGGG + Intronic
1120531011 14:85631478-85631500 CTGGGCACCCACCAGGGCCTGGG - Exonic
1120749523 14:88185210-88185232 CTGGGCACACACGTAGACAAGGG - Exonic
1122174318 14:99905911-99905933 GGGGGCACACACCTGGGCAAAGG - Intronic
1128389898 15:67175731-67175753 CTGTGCTCACACATGGGCACAGG - Intronic
1128390542 15:67179803-67179825 CAGGGCTGAGACGTGGGCATGGG + Intronic
1130108230 15:80944937-80944959 CTGGGCACCCAGGCAGGCATTGG + Intronic
1135468296 16:22706376-22706398 TTGGGAACACATGTGGGCACTGG - Intergenic
1136661270 16:31765376-31765398 CTGGCCAGAAACGTGGGCTTGGG - Intronic
1137721059 16:50627732-50627754 CAGGGCAGACACGTAGGAATCGG - Intronic
1137774547 16:51044278-51044300 CTGGGAACAAATGTGGGCAGAGG + Intergenic
1139347643 16:66314514-66314536 CAGGGGTCACAGGTGGGCATGGG + Intergenic
1139602017 16:67992896-67992918 CTGAGCACACTCCTGGGCAAGGG - Intronic
1142125387 16:88407700-88407722 CTGGGCCCACAGGTGGGACTTGG - Intergenic
1142191279 16:88719361-88719383 CTGGGCGCAGAAGTGGGCAGCGG - Intronic
1146887588 17:36482935-36482957 GTAGGAACACTCGTGGGCATCGG + Intergenic
1148207380 17:45787603-45787625 CTGGGCACAGCTGTGGCCATTGG + Intronic
1151413617 17:73947471-73947493 CTGGGCACAGACTTGGGGAGAGG + Intergenic
1151498372 17:74473355-74473377 CTCCGCACACAGGTGGGAATGGG - Intronic
1151541647 17:74767779-74767801 GTGGGGACACATGGGGGCATGGG - Intronic
1151568936 17:74916409-74916431 CTGGGCACATGTGTGGGAATGGG + Exonic
1152101177 17:78302514-78302536 CTGGGCAGAGGCGTGGGGATGGG - Intergenic
1152539079 17:80965875-80965897 CTCGGCCCAGACGTGGGGATGGG - Exonic
1152586624 17:81192287-81192309 CTGGGCACCCAGGTGGGCAGGGG - Intronic
1152681610 17:81671458-81671480 GTGTGCAGACACGTGGGCAAGGG - Intronic
1155453068 18:25983137-25983159 CTGGGCAGAGACATGCGCATGGG + Intergenic
1156802676 18:41136790-41136812 ATGGACACACACGTGACCATAGG + Intergenic
1158628475 18:59091844-59091866 CTGGGCATTCACTTGGGCATAGG + Intergenic
1158781487 18:60657281-60657303 CAGGTCACACACATAGGCATCGG + Intergenic
1160233632 18:77068067-77068089 CTGGGCAGACAGGAGGGGATGGG + Intronic
1160971030 19:1767844-1767866 ATGGGCTCAGATGTGGGCATGGG + Intronic
1161345866 19:3768486-3768508 CAGGGCACCCACCTAGGCATGGG - Intronic
1162267501 19:9587893-9587915 GTGGGCACACACCTGGACAAGGG + Intergenic
1162743291 19:12785644-12785666 CTGGGCACAGAAGCGGGCAGAGG + Intronic
1162910157 19:13843803-13843825 CTGGCCACCCACCTGGGCACTGG - Intergenic
1163304001 19:16465934-16465956 CTGGGTACAAACTTGGGCAAGGG + Intronic
1163576770 19:18115489-18115511 CTGGGGACCCAAGTGGGGATGGG - Intronic
1164747201 19:30625161-30625183 GTGGGCCCACAGGTGAGCATAGG + Intronic
1165796504 19:38523105-38523127 GTGGGCACTCACGTGGGACTTGG - Exonic
925180968 2:1816793-1816815 CTGTGCATACACTGGGGCATAGG - Intronic
925521109 2:4746851-4746873 CTGGCTACACAGGTGGGCACAGG + Intergenic
926803523 2:16683657-16683679 CTGGGCACACTCATTGGCACAGG + Intergenic
933389219 2:81650081-81650103 GTGAGCACACACGTGGACAAGGG + Intergenic
935608099 2:104990879-104990901 CTAGGCACCCAAGTGGGGATGGG + Intergenic
938156965 2:128949888-128949910 ATGTGCACATAGGTGGGCATGGG - Intergenic
939227927 2:139387065-139387087 CTGGTCACACATATGGGCAATGG + Intergenic
940012940 2:149073677-149073699 TTGGGGACCCAAGTGGGCATGGG + Intronic
945038028 2:205720935-205720957 CTAGGAACACACGAGGGCAAGGG - Intronic
945761409 2:213920406-213920428 ATGCACACACACGTTGGCATGGG + Intronic
947663959 2:231891338-231891360 CTGGCCGCACAGGTGTGCATGGG + Intergenic
947739492 2:232478653-232478675 CTGGGCACACACGTGTCCCTTGG - Intergenic
948891011 2:240907117-240907139 CTGGCCCCACACTTGGCCATGGG - Intergenic
1169089804 20:2851983-2852005 CTGGGCATACAGGTGTGCAGAGG + Intronic
1169510188 20:6255535-6255557 CTGGGCAAACATGTAGGCTTGGG + Intergenic
1172436314 20:34931236-34931258 CTGGGCACAGTCCCGGGCATGGG - Intronic
1174128652 20:48326698-48326720 CTGGGCCCTCACCTGGGCATCGG + Intergenic
1176382770 21:6121349-6121371 CTGGACACACACCTGCACATTGG + Exonic
1177612153 21:23465670-23465692 CTGTGAAGACACGTGAGCATCGG - Intergenic
1178019983 21:28396646-28396668 CTGGGCACAAGCCTGGGCATGGG - Intergenic
1178673778 21:34614500-34614522 CTGGGCGCACACGGGGGCCGGGG + Intronic
1179740699 21:43416890-43416912 CTGGACACACACCTGCACATTGG - Exonic
1179790429 21:43753140-43753162 ACGGGCACACACGTGGACATGGG + Intronic
1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG + Intergenic
1180706218 22:17811602-17811624 CTTGGCACCCACGTAGGCAGGGG - Intronic
1181515084 22:23405582-23405604 CTGGGGACAGAGGTGGGCGTGGG - Intergenic
1181630599 22:24149187-24149209 CCGGGCTCACAGGTGGGTATAGG - Intronic
1182093946 22:27613976-27613998 CCTGGCACACACATGGGCATGGG + Intergenic
1183687542 22:39369854-39369876 ATGGGCACAGAGGTGGGCAGTGG - Intronic
1184955215 22:47881352-47881374 CTGTGCACAGATGTGGGCAGAGG - Intergenic
1184993041 22:48183393-48183415 CTGGGGACTCACATGGACATTGG + Intergenic
1185407903 22:50665984-50666006 CTGAGCACACACGGAGACATAGG + Intergenic
949925446 3:9037578-9037600 CTGGGCACACGCATGTGCATAGG - Intronic
950589989 3:13930107-13930129 CTGGGATCAAACCTGGGCATGGG + Intergenic
953107304 3:39896315-39896337 CTGGGCCCACCCCTGTGCATCGG + Intronic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
953285824 3:41607784-41607806 ATGGGCATACACATGGGCATAGG + Intronic
956931617 3:74050021-74050043 CTGGGCACTCACATGGAAATAGG - Intergenic
957188423 3:76973900-76973922 ATGGGGACACAGGTGGGGATGGG + Intronic
961168821 3:124781359-124781381 GTGGGGACACACGAGGGCATGGG - Intronic
967230028 3:187328969-187328991 CTGTGCCCAGACTTGGGCATGGG - Intergenic
968079003 3:195833821-195833843 CTGGGCTTACACGGGGGGATTGG + Intergenic
968079016 3:195833868-195833890 CTGGGCTTACACGGGGGGATTGG + Intergenic
968224869 3:196967264-196967286 CTGCGCACACACCTGGGCGCCGG - Intronic
968426375 4:526275-526297 CTGGGGCCACACGGGGGCCTGGG - Intronic
968578607 4:1379334-1379356 CTGGGCATCCAGGTGGGCAGGGG + Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
973735278 4:53865250-53865272 CCGGGCTCACACTTGTGCATGGG + Intronic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
979762287 4:124421143-124421165 CTGGGCACACACTTAGGAAAGGG - Intergenic
985540014 5:483529-483551 CTGGGCGGACACGGGGGCCTCGG - Intronic
985610378 5:884675-884697 CTGGGCACTTGCCTGGGCATGGG + Intronic
1001321489 5:170686055-170686077 CTGGGGACAAAAGTGGGGATGGG - Intronic
1004864545 6:19838928-19838950 GAGGGCACCCTCGTGGGCATGGG + Intronic
1005687862 6:28272387-28272409 CTGGCCAGACAGGTGGACATGGG + Intronic
1005811651 6:29520524-29520546 CTAGGCACAGACGATGGCATGGG + Intergenic
1006418201 6:33917788-33917810 CTGGGCACACACCTGCCCCTTGG + Intergenic
1010212656 6:73374349-73374371 CTGGGCAAACACATGGGAGTGGG - Intronic
1011703701 6:89980373-89980395 CTGGACACACACATGAGCATGGG + Intronic
1013768343 6:113598660-113598682 CTGGGTTCACACCTGGGCCTTGG - Intergenic
1013866008 6:114697155-114697177 CTGGGCACACATGTGGGCGGTGG - Intergenic
1019280374 7:196799-196821 CTGGGCACTCACCTGGTCATGGG + Intronic
1019623560 7:2004007-2004029 CTGGGCACTCCCGGGGGCACAGG + Intronic
1020989495 7:15179516-15179538 CTGGGAACACACTAGGGCAGGGG + Intergenic
1029653234 7:101908053-101908075 CTGGGCACTCACTTGGGGGTGGG - Intronic
1032879355 7:136072536-136072558 CTGGTCACAGGCGTGGTCATGGG + Intergenic
1034336085 7:150324392-150324414 CTGGGCACGCACTTGGGAAAAGG + Intronic
1035445504 7:158939306-158939328 CTGGGACTACAGGTGGGCATGGG - Intronic
1040815964 8:51508755-51508777 CTAGGCAGCCACATGGGCATGGG - Intronic
1041319498 8:56598765-56598787 ATGGCCACAGACGTGGTCATAGG - Intergenic
1042458393 8:69032343-69032365 TTGGACACACACGTGCACATAGG - Intergenic
1047048358 8:121080189-121080211 CTGAGTACAGATGTGGGCATTGG + Intergenic
1048985145 8:139731076-139731098 CAGGGCACACACGTGCACACTGG + Exonic
1053062414 9:35042733-35042755 CTGGCCACACACGTGGGATTAGG + Intronic
1057221294 9:93259266-93259288 CTGGGTACACAGGTTGGCCTGGG - Exonic
1057292954 9:93818857-93818879 CTGTGCACACACGCAGGCCTTGG - Intergenic
1059385122 9:113958636-113958658 CTGGGCACAAACGTGTGAATGGG - Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062246624 9:135571702-135571724 GTGGGCACACACCTGGACAAGGG + Intergenic
1189213296 X:39302721-39302743 TTGGTCACACACATGAGCATAGG - Intergenic
1193603187 X:83534237-83534259 ATAGGCACACACGAAGGCATGGG - Intergenic
1198262175 X:134974595-134974617 CTGGGCACAGAGGTAGCCATTGG + Intergenic
1198965578 X:142226393-142226415 CTGAGCACACACCTGGGCAAGGG + Intergenic
1201297806 Y:12479594-12479616 CAGCGCAACCACGTGGGCATGGG - Intergenic