ID: 1092118623

View in Genome Browser
Species Human (GRCh38)
Location 12:6027517-6027539
Sequence GGGTCTGATCAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092118617_1092118623 11 Left 1092118617 12:6027483-6027505 CCTGGATTATCTGTGTGGGCTGA 0: 1
1: 4
2: 21
3: 172
4: 597
Right 1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG 0: 1
1: 1
2: 3
3: 43
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092118623 Original CRISPR GGGTCTGATCAGAGGGAGGC AGG Intronic
900227764 1:1540811-1540833 GGGTCTGACCAGACTGGGGCGGG - Intergenic
900465537 1:2823596-2823618 GGCTCTCCTAAGAGGGAGGCAGG - Intergenic
900471688 1:2858138-2858160 GGGTGTGAGCAAAGGGAGCCTGG - Intergenic
900607084 1:3528603-3528625 GGTCCTTATAAGAGGGAGGCAGG + Intronic
900713370 1:4128921-4128943 GGGTCTCGTGAGAGGGTGGCGGG + Intergenic
900910246 1:5592240-5592262 GGTTCTTATAAGAGGGAGACGGG + Intergenic
901028132 1:6290051-6290073 GGGTCCTGTGAGAGGGAGGCAGG + Intronic
901532816 1:9864135-9864157 GAGTGTGATCAGGTGGAGGCAGG + Intronic
901953845 1:12770159-12770181 GGGACAGGTCAGAGGGAAGCAGG - Intergenic
902804364 1:18851683-18851705 GGGTCAGATCAGTGGGAGGTTGG - Intronic
902987014 1:20161047-20161069 GGGTCTGAGCAGAGAGTGCCAGG + Intergenic
903541068 1:24096628-24096650 AGGTCTGATGAGAGGCAGGGAGG + Intronic
903830273 1:26170300-26170322 GGGTCTGAGAAACGGGAGGCGGG - Intronic
904255978 1:29255151-29255173 GGGCCTGAAGAGAGGGAGGAGGG + Intronic
904319139 1:29685182-29685204 GAGTCTGATCAGCAGGAGGTGGG + Intergenic
904625302 1:31798940-31798962 GGGTCAGGTCAGAGTAAGGCAGG + Intronic
905209864 1:36366621-36366643 GGGCCTGCTCAGAGGGATCCCGG + Intronic
905265212 1:36748662-36748684 GGTCCTTATGAGAGGGAGGCTGG - Intergenic
905316710 1:37086563-37086585 GGGCCTGAACAGACGGAGGCAGG - Intergenic
906239040 1:44230253-44230275 GGGATTGATCTGGGGGAGGCGGG - Intronic
906543155 1:46603667-46603689 GTGGCAGATCAGAGGCAGGCAGG - Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
907501133 1:54881962-54881984 GGGTCCTATCAGAGGGTGGAGGG + Intronic
907523141 1:55038200-55038222 GGGTGTGTTCTGAGGGAGGTGGG - Intergenic
908115234 1:60934106-60934128 GGGCCTGTTCAGAAGTAGGCTGG - Intronic
909480228 1:76122410-76122432 ATGTCTGCTCAGAGGCAGGCAGG + Intronic
909949427 1:81702242-81702264 GGGTCTGACCACAAGTAGGCAGG + Intronic
910624572 1:89292808-89292830 AGGTGTGATCAGAGGAATGCTGG + Intergenic
916344749 1:163775276-163775298 GGGGCTGGGGAGAGGGAGGCTGG + Intergenic
916405951 1:164498212-164498234 GGTTCTTATCAGAGGAAGGAAGG - Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
916930750 1:169575952-169575974 GGTCCTTATCAGAGGGATGCAGG + Intronic
918076487 1:181175046-181175068 GGTTCTCATCAGAGGGACCCAGG + Intergenic
920094257 1:203475724-203475746 GGGGCAGATCATAGGGAGGGAGG - Intergenic
920305409 1:205015290-205015312 GGGTCTGAGCAGTGGGAGTCTGG - Intronic
920524338 1:206655701-206655723 GGGCCAGATCAGAAGCAGGCTGG - Intronic
920900173 1:210102254-210102276 GGGGCCTATCAGAGGGTGGCAGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921177236 1:212606201-212606223 GGGGCTGAGGGGAGGGAGGCAGG + Intronic
922597150 1:226822917-226822939 GGTCCTTATAAGAGGGAGGCAGG - Intergenic
922974389 1:229771471-229771493 GAATATCATCAGAGGGAGGCAGG + Intergenic
923630736 1:235648477-235648499 GGGCCAGATCAGATGGCGGCTGG + Intronic
924630993 1:245740703-245740725 GGGACTTATCAGAGGGTGGTGGG + Intergenic
1063685768 10:8235853-8235875 GGGGCTGAGCAGAGTGGGGCAGG + Intergenic
1068682050 10:59830727-59830749 GGGTCTTAAGACAGGGAGGCAGG + Intronic
1069880913 10:71592607-71592629 GGTCCTCATTAGAGGGAGGCAGG - Intronic
1069890474 10:71649189-71649211 GGGTCTGAGCAGAGAGCTGCCGG - Intronic
1070596210 10:77834782-77834804 GGGTCTGAGCAGAAGCAGACAGG + Intronic
1070747527 10:78943566-78943588 GGTTCTTATAAGAGGGAGGCAGG - Intergenic
1071553669 10:86586149-86586171 GGGTCTTAGCAGAGGGAGTCAGG + Intergenic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1073453566 10:103623360-103623382 GGGTCTGAGCAGAGGGTGCAGGG - Intronic
1074304270 10:112262323-112262345 AAGTGTGATCAGATGGAGGCTGG - Intergenic
1075068809 10:119307428-119307450 GGGCCTGATTAGAGGGAGAGTGG + Intronic
1075873690 10:125789360-125789382 GGGTCTGATCAAGGGGAGGATGG + Intronic
1076074644 10:127523452-127523474 GGACCTTATAAGAGGGAGGCAGG + Intergenic
1076635157 10:131876773-131876795 GGGTCTGCCCGGAGGGAGGAGGG + Intergenic
1076930289 10:133527800-133527822 GGGGCTGATGATGGGGAGGCCGG + Intronic
1077609569 11:3636043-3636065 GGCAGTGATCAGAGGAAGGCTGG + Intergenic
1077677060 11:4204432-4204454 GGGGCTGCTCAGATGGATGCTGG - Intergenic
1078082047 11:8211253-8211275 GGGGATGGTCAGAGGGAGACAGG + Intergenic
1078088533 11:8249220-8249242 GGGTCTGTGCAGGGTGAGGCAGG - Intronic
1078106512 11:8361396-8361418 GGGTCTGGTCAGATGCAGGTTGG - Intergenic
1078519568 11:12052332-12052354 GGTTCTTAGAAGAGGGAGGCAGG + Intergenic
1078552584 11:12290663-12290685 AGATCTGATCTGAGGGCGGCAGG - Intronic
1080384967 11:31805670-31805692 GGGTCTGGGCAGAGGAAAGCAGG + Intronic
1080752941 11:35167466-35167488 GGTTCTGATCAGAAGTAGGAAGG - Intronic
1081362390 11:42196618-42196640 GGGCCTGTTCGGGGGGAGGCAGG - Intergenic
1081600282 11:44488164-44488186 GGGGGTGGTCAGGGGGAGGCTGG - Intergenic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081678223 11:44983475-44983497 GGTCCTCATAAGAGGGAGGCAGG + Intergenic
1081720548 11:45285681-45285703 GGGTAAGAGGAGAGGGAGGCTGG - Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1084563371 11:69916226-69916248 GGGTCTGGGCAGAGTGAGGCTGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084637028 11:70399089-70399111 GGGTCTGAGCGGAGGGGGCCGGG + Intronic
1085121203 11:73968707-73968729 GGGTCTGATGAGTGTGTGGCAGG - Intronic
1085278084 11:75312689-75312711 GGTCCTGACAAGAGGGAGGCAGG + Intronic
1086926693 11:92648525-92648547 TGTTCTGCTCTGAGGGAGGCAGG - Intronic
1088141806 11:106625829-106625851 GGTTCTTATAAGAGGAAGGCAGG - Intergenic
1088984332 11:114892263-114892285 GGGTCAGTACAGAGGGAGGAAGG + Intergenic
1089121748 11:116140916-116140938 GGTACTTATAAGAGGGAGGCAGG - Intergenic
1089332386 11:117699113-117699135 GGTCCTGATGAGAGAGAGGCTGG + Intronic
1090260431 11:125315103-125315125 AAGCCTGCTCAGAGGGAGGCAGG + Intronic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092137289 12:6158869-6158891 GGGTCTGCTCAGATGGCCGCCGG - Intergenic
1092232209 12:6782522-6782544 GGGTGTGAACTGAGGGAGACAGG + Intergenic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1096244360 12:49975886-49975908 GGGACAGAGCAGAGGAAGGCAGG + Exonic
1096461722 12:51825374-51825396 GGGGCTGGTGAGAGGGAGCCTGG - Intergenic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1099811430 12:87587408-87587430 GGATCTTATAAGAGGGAGTCAGG - Intergenic
1101333092 12:103772797-103772819 GGGTATGATCTGGGGCAGGCAGG + Exonic
1101559739 12:105845132-105845154 GATTCTGATCAGAGGGACGTGGG - Intergenic
1102025313 12:109711295-109711317 GGGTCTGATCTCAGGGAGATGGG + Intergenic
1102591950 12:113962952-113962974 GGTCCTTATGAGAGGGAGGCGGG + Intronic
1102975068 12:117200931-117200953 GGTTCTCATAAGAGGGAAGCAGG + Intergenic
1103344772 12:120241866-120241888 AGGGGAGATCAGAGGGAGGCAGG + Intronic
1103963848 12:124625800-124625822 AGATCTTATAAGAGGGAGGCAGG + Intergenic
1104060519 12:125264224-125264246 GGCACTTATCAGAGGGAGGCAGG - Intronic
1104110655 12:125701022-125701044 GGGTCTGGGAAGAGGGAGACTGG + Intergenic
1104241242 12:126991853-126991875 GGGGCATATCAGAGGGAGGAGGG - Intergenic
1104572288 12:129935645-129935667 GGGTTTGAGGAGAGGGAGACAGG - Intergenic
1104717974 12:131029334-131029356 GGATCTTGACAGAGGGAGGCAGG - Intronic
1104824534 12:131699344-131699366 GGTGCTTATGAGAGGGAGGCAGG - Intergenic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1106083980 13:26523999-26524021 GGGACTGCTCAGGGAGAGGCAGG + Intergenic
1106670281 13:31897911-31897933 GGGCCTTGTAAGAGGGAGGCAGG - Intergenic
1106757955 13:32840971-32840993 GGGGCTTGTCAGAGAGAGGCAGG + Intergenic
1109206672 13:59490448-59490470 GGGTCTGATCCAAGGGAGGCTGG - Intergenic
1110097785 13:71552008-71552030 AGGACTAATCTGAGGGAGGCAGG - Intronic
1110597771 13:77337966-77337988 AGTTCTGATAAGAGGGAGGCAGG + Intergenic
1110849004 13:80223105-80223127 GGAACTTATAAGAGGGAGGCAGG - Intergenic
1112292500 13:98157304-98157326 GGGACTGATCAGGGGGAAGAGGG - Intronic
1112530653 13:100199239-100199261 GGGTATGTTTAGAGAGAGGCCGG - Intronic
1113270499 13:108668578-108668600 GGCTCTGATCCAAGGAAGGCAGG - Intronic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1116506497 14:45688714-45688736 GGGGCTTATCAGAGGGTGGAAGG + Intergenic
1117490359 14:56240836-56240858 GGGTCTAATCAGATGGGGGCAGG - Intronic
1117648918 14:57882101-57882123 TGGGCTGATGAGAGGGAGGGAGG - Intronic
1118009235 14:61592480-61592502 GGTTCTTATAAGAGGGAGGCAGG - Intronic
1118481444 14:66171206-66171228 GGTTCTCACAAGAGGGAGGCAGG - Intergenic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119716585 14:76863924-76863946 GTGTCTGATTTGAGAGAGGCAGG - Intronic
1119879714 14:78090657-78090679 GGGTCTAAGCAGTGGGAGGTTGG + Intergenic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1121569415 14:94936246-94936268 GGGTCTGATCGGTGGGTGGGTGG - Intergenic
1121846809 14:97179409-97179431 GGTCCTTATAAGAGGGAGGCAGG - Intergenic
1121856637 14:97276337-97276359 GGTCCTTATCAGAGGGAGGCAGG + Intergenic
1122034319 14:98936402-98936424 GGTTCTGATAAAAGAGAGGCAGG + Intergenic
1122345084 14:101053658-101053680 GGGTCTGAGCTGGGAGAGGCAGG + Intergenic
1122635028 14:103125806-103125828 GGGTCTGGGCAGGAGGAGGCTGG + Intronic
1125186176 15:36933083-36933105 GGGTCTGATCTGAGAGGGGCGGG + Intronic
1125269996 15:37928529-37928551 GGTTTTTATAAGAGGGAGGCAGG + Intronic
1126110853 15:45173914-45173936 TGGCCTGGTCAGAGGGAGGGAGG + Intronic
1126564900 15:50084839-50084861 GATCCTTATCAGAGGGAGGCAGG - Intronic
1126670860 15:51113864-51113886 GTGGCTGATCTGAGGGAGGCTGG - Intergenic
1127961857 15:63896032-63896054 GGCGGTGATCAGAGGAAGGCAGG - Intergenic
1128534314 15:68479221-68479243 GGGTGAGATCTGAGGGAGTCTGG + Intergenic
1129651469 15:77493727-77493749 GTGACGGATGAGAGGGAGGCAGG + Intergenic
1131151490 15:90050019-90050041 GGCTATCATCAGAGGCAGGCAGG - Intronic
1131370267 15:91875302-91875324 GGGTCAGAGGAAAGGGAGGCAGG - Intronic
1132155022 15:99489588-99489610 GGTCCTTATGAGAGGGAGGCAGG - Intergenic
1132793909 16:1708972-1708994 GTGTCTGATAAGAGGGGAGCGGG + Intronic
1133098098 16:3461259-3461281 GGGTCTGAACCGGGGGAGCCAGG + Intronic
1133592250 16:7257007-7257029 GGGTCGGATCAGAGGGGGAGAGG - Intronic
1134099486 16:11441663-11441685 GGGTCCTATGAGACGGAGGCAGG + Intronic
1134121421 16:11587075-11587097 GGGGGCGATCAGAGTGAGGCGGG - Intronic
1136343849 16:29663067-29663089 GGGGCTCACCTGAGGGAGGCAGG - Intronic
1137474847 16:48798826-48798848 AGGTCTTATAAGAGAGAGGCAGG - Intergenic
1137936940 16:52643959-52643981 GGTTCTGCTTAGTGGGAGGCTGG + Intergenic
1139277092 16:65738021-65738043 GTTTCTGCTCACAGGGAGGCAGG - Intergenic
1139509654 16:67419873-67419895 GGTCCTTATAAGAGGGAGGCAGG + Intergenic
1140759017 16:78094639-78094661 GGGGCCTGTCAGAGGGAGGCAGG - Intergenic
1141107586 16:81246223-81246245 GGTCCTTATAAGAGGGAGGCAGG - Intronic
1141224212 16:82100079-82100101 GGGCCTTATGAGCGGGAGGCAGG - Intergenic
1142521483 17:507868-507890 GGGCTTGGTCAGAGGGAGGTGGG - Intergenic
1142866436 17:2794347-2794369 GGTTCTTCTCAGATGGAGGCAGG + Intronic
1143502063 17:7345048-7345070 GGGTCTGGACAGAGTGAGGGAGG + Intronic
1143542269 17:7576505-7576527 GTATCTGAGCAGAGAGAGGCAGG - Exonic
1143591439 17:7887765-7887787 GGCTCGGATCTCAGGGAGGCAGG - Intronic
1143786338 17:9258572-9258594 GGGTGTGATCAGAGGCAGGTAGG - Intronic
1143893088 17:10117261-10117283 GGTCCTTATGAGAGGGAGGCAGG - Intronic
1144395205 17:14836617-14836639 GAGCCTTATAAGAGGGAGGCAGG + Intergenic
1144874228 17:18388766-18388788 GGGTCTGGTCAGTGGGGGTCTGG + Intronic
1145218426 17:21069413-21069435 GGGCCTCATAAGAGGGGGGCAGG + Intergenic
1145253177 17:21307536-21307558 GGGTCAGAGGAGAGGGAGGGAGG + Intronic
1145323393 17:21780382-21780404 GGGTCAGAGGAGAGGGAGGGAGG - Intergenic
1146268396 17:31468249-31468271 GGGTCTGAGCAGAGGAAGCGAGG - Intronic
1146663997 17:34684404-34684426 GGGTAAAATCACAGGGAGGCAGG + Intergenic
1146673556 17:34758030-34758052 GGTACTGATCAGAGGGTGCCTGG + Intergenic
1147645601 17:42031862-42031884 GGGACAGGTCAAAGGGAGGCAGG + Intronic
1148272867 17:46277574-46277596 GGGATTGATCATAGGGAGCCTGG - Intronic
1149111433 17:53035894-53035916 GGTTCTTATTAGAGGGAGACAGG + Intergenic
1150763149 17:67980384-67980406 GGGATTGATCATAGGGAGCCTGG + Intronic
1151028575 17:70708159-70708181 GGGTCTTATCAGAGAGTGGAGGG + Intergenic
1152207277 17:78980867-78980889 GGGGCAGAGCAGAGGGAAGCAGG + Intergenic
1152303189 17:79507184-79507206 GTGTCTGATAAGAAGCAGGCGGG - Intronic
1152347753 17:79763899-79763921 GGGCCTTATGCGAGGGAGGCAGG + Intergenic
1152598821 17:81251352-81251374 GGGTCTGCTCAGCAGGCGGCTGG + Intronic
1152610070 17:81311070-81311092 GGGTCTCAGCAGGGGGAGGCCGG - Intergenic
1153304575 18:3620166-3620188 GGTCCTTATAAGAGGGAGGCAGG + Intronic
1153322415 18:3786083-3786105 GGATCTTATAAAAGGGAGGCAGG - Intronic
1154196511 18:12271316-12271338 GGTCCTTATGAGAGGGAGGCAGG + Intronic
1156451244 18:37267524-37267546 GGGACTGCCCAGAGGGAGGATGG + Intronic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1157112074 18:44830615-44830637 GGATTTGATCAGATGGAAGCTGG + Intronic
1157514801 18:48303317-48303339 GAGTCTCATCAGAGGGAGGTTGG - Intronic
1158848172 18:61466863-61466885 GGGACAGAGAAGAGGGAGGCGGG - Intronic
1158868268 18:61659045-61659067 GGTTCTTATAAGAGGGAGGCAGG + Intergenic
1158882238 18:61791608-61791630 GGGTCTGGGAAGAGGGAGGGAGG - Intergenic
1159869842 18:73748017-73748039 TGCTCTGATCAGAAGGAGGGAGG - Intergenic
1160228838 18:77031372-77031394 GGCTCTGAGCAGAGGCTGGCAGG - Intronic
1160266713 18:77344766-77344788 TGGTGTGATAGGAGGGAGGCTGG - Intergenic
1160766570 19:811226-811248 GGGTCACACCAGAGAGAGGCAGG + Exonic
1161489751 19:4555439-4555461 GGGGCTGATCAGATGGAGGTTGG + Intronic
1161518695 19:4711470-4711492 AGTCCTTATCAGAGGGAGGCAGG + Intronic
1161542404 19:4859980-4860002 GGAGCTGATCAGAGGCATGCTGG + Exonic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1162036564 19:7943344-7943366 GAGTCTGATCAGAGGGCGAAGGG + Intronic
1162048720 19:8018957-8018979 GGTCCTTATAAGAGGGAGGCAGG + Intronic
1162098008 19:8322194-8322216 GAGACTGACAAGAGGGAGGCGGG + Intronic
1162175029 19:8824022-8824044 GGGTGTGAGCACCGGGAGGCTGG - Intronic
1163236133 19:16031663-16031685 GGGTCTGATCAGTGGGAACCTGG + Intergenic
1163262938 19:16202090-16202112 GGAACTGATTGGAGGGAGGCAGG - Intronic
1166108658 19:40610038-40610060 GGGTGGGGTCAAAGGGAGGCTGG - Intronic
1166136190 19:40778484-40778506 GGGTCTGGTGTGATGGAGGCAGG + Intronic
1166340765 19:42135314-42135336 GGGACTGGGCAGAGGGAGGTGGG - Intronic
1166864476 19:45827687-45827709 GTACCTGATCAGAGGCAGGCAGG - Intronic
1167668860 19:50838573-50838595 GGGTCTGAGGAGGGAGAGGCTGG + Intergenic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1167744574 19:51342964-51342986 GGCTGTGAGCAGGGGGAGGCAGG - Intergenic
1167915185 19:52734647-52734669 GGGGCTGAGGAGGGGGAGGCTGG + Intronic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168407739 19:56119802-56119824 GGGACTGCGCAGAGGCAGGCAGG + Intronic
925193808 2:1907530-1907552 GGACCAGATCAGAGGGAGGTAGG + Intronic
925610488 2:5697134-5697156 GGGTCTGGGAGGAGGGAGGCTGG + Exonic
926162078 2:10496151-10496173 GGGTGGGATCAGATGGAGGTGGG - Intergenic
926339601 2:11894256-11894278 GATCCTGATAAGAGGGAGGCAGG - Intergenic
926477738 2:13348492-13348514 GGGGCTTATCAGAGGGTGGAGGG - Intergenic
926868066 2:17381432-17381454 GGGTTTGATCACAGGGAGATTGG - Intergenic
926974415 2:18499320-18499342 GGGTCCTATCAGAGGGTGGAGGG - Intergenic
927142603 2:20140392-20140414 GGCTCTGATCAGGTGGGGGCAGG - Intergenic
928854125 2:35783865-35783887 GGGTATGAACAGAGTGAGTCAGG + Intergenic
929402840 2:41605414-41605436 GGGACTGCTCAGACTGAGGCTGG + Intergenic
929804983 2:45136996-45137018 GGGGCCTATCAGAGGGAGGAAGG - Intergenic
929822059 2:45281752-45281774 GGGTGTGAGCAGATGGAGGTGGG - Intergenic
932505731 2:72229526-72229548 AGGTATTATCAGAGGGAGACAGG + Intronic
932633826 2:73370517-73370539 GGGTCTGATGTGGTGGAGGCTGG + Intergenic
932771930 2:74505306-74505328 GGGTGTGATCCCAGGGAGGGTGG + Intronic
933735571 2:85491284-85491306 GGGTCTGATGTGGTGGAGGCTGG - Intergenic
933978908 2:87534671-87534693 AGGTCTGCTCAGAGAGACGCTGG - Intergenic
934515230 2:94982086-94982108 GGGTCTGGTCATAGATAGGCTGG + Intergenic
934520575 2:95017842-95017864 TGATGTGATCAGAGGGAGGATGG + Intergenic
934928619 2:98400712-98400734 GATTCTGATAAGTGGGAGGCAGG + Intergenic
935296780 2:101656632-101656654 GGTCCTTATCAGAGCGAGGCAGG + Intergenic
935668990 2:105539156-105539178 GGCACAGAACAGAGGGAGGCAGG + Intergenic
936250515 2:110864900-110864922 GTGCCTGATCACAGTGAGGCTGG - Intronic
936314921 2:111416127-111416149 AGGTCTGCTCAGAGAGACGCTGG + Intergenic
937071299 2:119065805-119065827 GGGTCTGATGGCAAGGAGGCTGG - Intergenic
940165068 2:150761844-150761866 AGTTCTTATCAGAGGGAAGCAGG - Intergenic
940406838 2:153313534-153313556 GGGGCCTATCAGAGGGTGGCGGG + Intergenic
940725510 2:157331458-157331480 AGTTCTAATAAGAGGGAGGCAGG + Intergenic
940822563 2:158373095-158373117 GGGCCTCATTAGAAGGAGGCAGG + Intronic
941772786 2:169362245-169362267 GGGTCGGGTCCGCGGGAGGCCGG - Intronic
943844390 2:192625262-192625284 GGGTCTTATAGGAGGGTGGCTGG - Intergenic
944931904 2:204528509-204528531 TGGCCTTATAAGAGGGAGGCAGG + Intergenic
946394033 2:219434548-219434570 GGGTCTGAGATGAGGGAGGAAGG + Intergenic
946832865 2:223743485-223743507 GGGACTGGTGAGAGGCAGGCAGG - Intergenic
947018550 2:225648346-225648368 GGATCCGATCAGATGGAGCCAGG + Intronic
948026568 2:234782732-234782754 GGTTCTTCTAAGAGGGAGGCAGG + Intergenic
948878280 2:240841612-240841634 GGGTCTGTTCTGAGGAAGGGAGG + Intergenic
1169056512 20:2626299-2626321 GGGTCAGCTCAGCTGGAGGCTGG + Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169112262 20:3041853-3041875 GGGTGTGGGCAGTGGGAGGCAGG - Intergenic
1170815819 20:19713447-19713469 GGGACTGGTCAGAGTGAGGTTGG - Intronic
1171211971 20:23324215-23324237 TGTTCTGATAGGAGGGAGGCAGG - Intergenic
1172586345 20:36087861-36087883 GGGAGGGATCAGAGGCAGGCAGG - Intergenic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1174151059 20:48486620-48486642 GGTCCTTATAAGAGGGAGGCAGG + Intergenic
1174419786 20:50391906-50391928 GGGCCTTATGAGAGGGAGGCGGG + Intergenic
1175703341 20:61156616-61156638 GGGACTGATAAGAGGGAGGCAGG + Intergenic
1175729759 20:61346310-61346332 TGGTGTGGTCGGAGGGAGGCAGG + Intronic
1175844129 20:62049715-62049737 GGGTCACTCCAGAGGGAGGCAGG + Intronic
1175967972 20:62669105-62669127 GGGTCTGCTCTGAGGGTGGCTGG + Intronic
1177480069 21:21675175-21675197 GGATCTTAGAAGAGGGAGGCAGG - Intergenic
1178547285 21:33503003-33503025 GACACTGATCAGAAGGAGGCTGG + Intergenic
1179008260 21:37533277-37533299 GGGTCTTAGCAGAGGGGTGCGGG - Intergenic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179947496 21:44688176-44688198 GGCTATGATCAGAGGGAAGTGGG + Intronic
1181923073 22:26335753-26335775 TGCTCTGACCAGAGGCAGGCAGG + Intronic
1183068116 22:35377690-35377712 GGGCCTTATAAGAGGGAGGCTGG - Intergenic
1183346670 22:37311975-37311997 GGGTGGGAAGAGAGGGAGGCTGG - Intronic
1183740468 22:39666017-39666039 GGGTCTGATCAGGGCTAGGACGG - Intronic
1183933645 22:41249719-41249741 GGGTCTGCTCAAGGTGAGGCCGG - Exonic
1183950072 22:41347832-41347854 TGGTGGGATCAGAGGGAGGGAGG + Intronic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184336004 22:43853605-43853627 GAGTCTCATCAGACAGAGGCTGG - Intronic
1184504189 22:44891189-44891211 AGGTCAGACCAGTGGGAGGCGGG + Intronic
1184812292 22:46844390-46844412 GGGTACAATCAGAGGGAGACAGG - Intronic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
1184878421 22:47289843-47289865 GGGTCTGGCCAGAGGTAGCCAGG - Intergenic
949151050 3:767349-767371 GGGTCTGAACACAAGGAGGTGGG + Intergenic
950595429 3:13976452-13976474 GGATCTGATCTGGGGGAGGTAGG - Intronic
950708593 3:14799134-14799156 GGGTCTGAACCCAGGCAGGCTGG - Intergenic
951696920 3:25454601-25454623 GGGCCTGATTACAGGCAGGCAGG - Intronic
952050224 3:29376180-29376202 GGGTCTTGTCAGAGGGTGGGGGG + Intronic
953274739 3:41483808-41483830 GATCCTCATCAGAGGGAGGCAGG + Intronic
953432872 3:42854157-42854179 GGGCCTGATCAGGGGAATGCTGG + Intronic
954633096 3:52057385-52057407 TGGTCCGTTGAGAGGGAGGCAGG - Intergenic
954840791 3:53509595-53509617 GGGGCTGACCCGAGGGAGGGCGG + Intronic
955514067 3:59709256-59709278 GGGCATTATAAGAGGGAGGCAGG + Intergenic
955911416 3:63863408-63863430 GGGTGGGACCAGAGGGAGTCCGG - Intronic
956915892 3:73870427-73870449 GGGTCCTATCAGAGGGTGGAAGG + Intergenic
957771862 3:84704432-84704454 GGGGCTTATCAGAGGGCGGAGGG + Intergenic
960170957 3:114460445-114460467 GGTTCTTATAAGAGAGAGGCAGG + Intronic
960713048 3:120550151-120550173 GGGTGTAATCAGAGGAAGGCAGG + Intergenic
961175181 3:124829649-124829671 TGGTGAGATCAGAGCGAGGCTGG - Intronic
961517568 3:127447536-127447558 GGTCCTTATAAGAGGGAGGCAGG + Intergenic
961581061 3:127882693-127882715 GGGTAGGCTCAGAGGGAGACAGG - Intergenic
962244072 3:133776805-133776827 GGGACTTATCAGAGGAAGGTGGG + Intronic
962273953 3:133998397-133998419 GGGTGGGAGCAGGGGGAGGCAGG - Intronic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
963959684 3:151295402-151295424 GGTCCTGATATGAGGGAGGCAGG - Intronic
965188611 3:165499754-165499776 GGTTCTTATAAGAGGGAGGCAGG + Intergenic
966429960 3:179820901-179820923 GGTTCTGATTAGTGGGAGACTGG + Intronic
967812184 3:193769709-193769731 GGCTCTGATTGGAGGGAAGCAGG - Intergenic
969526052 4:7704648-7704670 GGGGCTGAGCAGAAGGAAGCCGG - Intronic
969662490 4:8538330-8538352 GGGTCTGATCCGAGGGCAGTGGG + Intergenic
970473100 4:16395845-16395867 GGGTCTGTTAAGAAGGAGGAAGG + Intergenic
970777477 4:19693331-19693353 GGTTCTTATAAGAGGGAGGTAGG + Intergenic
972336348 4:38110186-38110208 GGCTCTGAATAGAGGAAGGCAGG + Intronic
972847871 4:43011333-43011355 GGATTTGGTCAGAGGGAAGCTGG + Intronic
975231013 4:71933016-71933038 GGGACTTATCAGAGGGTGGAGGG + Intergenic
977991945 4:103454403-103454425 TGGTCTTATCAGAGGGTGGAGGG - Intergenic
978924767 4:114229963-114229985 GGTTCTCATCAGGGGTAGGCTGG - Intergenic
984150653 4:176126085-176126107 GGGTCTAATCAGAGGCAGTTAGG - Intronic
985672549 5:1213870-1213892 GGGTGTGCTCCCAGGGAGGCGGG - Intronic
985698632 5:1357518-1357540 GGAAGTGATCGGAGGGAGGCGGG + Intergenic
986327615 5:6688238-6688260 GGGTCCTTTAAGAGGGAGGCAGG + Intergenic
986693827 5:10334610-10334632 GGGTCCTAGAAGAGGGAGGCAGG + Intergenic
987397670 5:17440769-17440791 GAGTCTGCTCAGAAGGTGGCTGG - Intergenic
989475581 5:41869910-41869932 GGGTCTGAACGGGGGGAGGAGGG - Intronic
991424463 5:66476464-66476486 GGGGCGGACCAGAGGGAGACAGG - Intergenic
992906956 5:81356363-81356385 GGGACTAATCAGAGGGGTGCAGG - Intronic
993225095 5:85159572-85159594 GGGTCAGATCAAGGGCAGGCTGG - Intergenic
993364591 5:87020160-87020182 GGTTCTGAGGAGAGGGAGGGAGG - Intergenic
999029154 5:148270785-148270807 GATTCTTATCAGAGGGAGGCAGG + Intronic
999866674 5:155708031-155708053 GGGCATGATTAGAGAGAGGCAGG + Intergenic
999983724 5:156983147-156983169 GGGGCTTATCAGAGGGTGGAGGG + Intergenic
1000103608 5:158038012-158038034 TGGTGTCATCAGAGGGAGACCGG + Intergenic
1001080067 5:168661026-168661048 GGGTGTCATCCGAGGGAGGCAGG - Intergenic
1002579141 5:180197094-180197116 GAGGCTCATCAGAGGCAGGCTGG - Intronic
1003074064 6:2968287-2968309 GGGTCCTATCAGAGGGTGGAGGG + Intronic
1005342614 6:24857499-24857521 GTGTCTGAGCAAAGGAAGGCAGG - Intronic
1006181230 6:32154522-32154544 GCGTCTGTTCCGAGGGAGGAGGG + Intronic
1007813641 6:44504446-44504468 GGGTCTGATCGGAAAGAGCCAGG + Intergenic
1010363211 6:75018868-75018890 GGGAGTGAGGAGAGGGAGGCAGG - Intergenic
1011547686 6:88499222-88499244 GGGTCTGGGCAGAGGGAGCAGGG + Intergenic
1012160685 6:95881564-95881586 GGGACTACTCAGAGGGAGGAGGG - Intergenic
1012794570 6:103743069-103743091 GGGGCAGATGGGAGGGAGGCTGG + Intergenic
1012898461 6:104978783-104978805 GGTTTTGATCAGAAGGAGGAAGG - Intronic
1015592766 6:134838388-134838410 GGGACTTATCAGAGGGTGGAGGG - Intergenic
1016369298 6:143355559-143355581 GGTCCTTATAAGAGGGAGGCAGG + Intergenic
1017428030 6:154342624-154342646 GGGGCTGAGGAGGGGGAGGCAGG + Intronic
1018007085 6:159632291-159632313 TGATGTGATCAGAGGGAGGACGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018906801 6:168080277-168080299 GGATCTGAGCGGAGGGAGGGAGG - Intronic
1018946313 6:168348759-168348781 GGGTCTGGAGAGAGGGATGCAGG + Intergenic
1019056338 6:169226126-169226148 GGTCCTCATCAGAGGGACGCGGG - Intronic
1019214356 6:170433753-170433775 GGTTCTCATAACAGGGAGGCAGG + Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1020404640 7:7818142-7818164 GGGTCTTATCAGAGGGTGGAAGG - Intronic
1020748658 7:12111729-12111751 GCGTCAGGGCAGAGGGAGGCGGG + Intergenic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1026545200 7:71316283-71316305 GGATCTGATCAGAGGGAGAATGG + Intronic
1026839510 7:73661797-73661819 GGTTCTTATAAGAGGGAGGAAGG - Intergenic
1027838308 7:83275025-83275047 GGGTTTCATCCCAGGGAGGCAGG - Intergenic
1029305559 7:99617126-99617148 GGGGCTGAGCGGAGGGAGACGGG - Intronic
1030174130 7:106632801-106632823 GGGCCTGATAAGAGGGAGGCCGG - Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031681958 7:124686407-124686429 GACTCTTATAAGAGGGAGGCAGG + Intergenic
1031824218 7:126542798-126542820 GTGACAGATCAGAGGGAGGATGG + Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1034393297 7:150801796-150801818 TGTCCTGTTCAGAGGGAGGCTGG - Intronic
1034422116 7:150995768-150995790 GGGTCGGGGCAGAGGGAGGAGGG - Intronic
1034458175 7:151182978-151183000 GGGTGTGATCTCAGGGAGGCTGG + Intronic
1034965275 7:155386961-155386983 GGATCTAATCATAGGGATGCAGG + Intronic
1035587164 8:785559-785581 GGGCCTGAGGGGAGGGAGGCCGG - Intergenic
1035620358 8:1032130-1032152 GGGTCTGCTCAGAGTCAGCCAGG + Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036772979 8:11591795-11591817 GGGCCTGTTCAGAGGGAGTAAGG + Intergenic
1037437551 8:18879287-18879309 AGGTCAGATAAGAGGGAGACAGG + Intronic
1037806066 8:22058470-22058492 GGGTCTCTTCAGAGGGTGGGTGG + Intronic
1037915723 8:22772102-22772124 GGGTCTTATCACAGTGATGCAGG - Intronic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039236259 8:35505822-35505844 GAGTCTGATCAAAGGCAGTCCGG - Intronic
1039981926 8:42415372-42415394 GTGTCAGATCACAGTGAGGCCGG + Intergenic
1042136018 8:65633876-65633898 GGATCTGACAAGAGGCAGGCGGG + Intronic
1042396281 8:68295071-68295093 GGTTATGGTCAGCGGGAGGCAGG - Intergenic
1043246681 8:78012092-78012114 GGGTTTTATCAGAGGGAAGCAGG + Intergenic
1043254711 8:78119707-78119729 GAATCTGATCTGAGGGAGACAGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044531320 8:93310683-93310705 TGCTCTAATAAGAGGGAGGCAGG + Intergenic
1044592870 8:93930889-93930911 GGGTGGGATGAGAGAGAGGCTGG + Intergenic
1044966132 8:97575669-97575691 GGTCCTTATAAGAGGGAGGCAGG + Intergenic
1045396819 8:101768981-101769003 GGTTCTTTTAAGAGGGAGGCAGG + Intronic
1045651752 8:104347912-104347934 GGCTCTTATAAGAGGGAGGCAGG + Intronic
1046698636 8:117374219-117374241 GGATCTGCTCATAGGGATGCTGG + Intergenic
1047314824 8:123723165-123723187 GGGGCCCATCAGTGGGAGGCAGG + Intronic
1047319425 8:123765713-123765735 GGTCCTTATTAGAGGGAGGCAGG - Intergenic
1047700917 8:127448532-127448554 GGCCCTTATAAGAGGGAGGCAGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048503594 8:135000956-135000978 GGGTCTGCTGAGGAGGAGGCTGG + Intergenic
1049245734 8:141561331-141561353 GGGTCAGACTAGAAGGAGGCTGG - Intergenic
1050354162 9:4767703-4767725 AGGTCAGATGAGAGAGAGGCTGG - Intergenic
1053120092 9:35539813-35539835 GGGTAGGATCAAAGGGAGGAGGG - Intronic
1053382131 9:37657864-37657886 AGGTCCAAGCAGAGGGAGGCTGG - Intronic
1053445364 9:38149046-38149068 GGTTCTTGTAAGAGGGAGGCAGG + Intergenic
1053473676 9:38365406-38365428 GGGTCTGATTACAAAGAGGCAGG - Intergenic
1053662043 9:40290951-40290973 GGGTCTGGTCAGAGGGGGCTCGG + Intronic
1054522566 9:66085333-66085355 GGGTCTGGTCAGAGGGGGCTCGG - Intergenic
1055440426 9:76331358-76331380 GGGTCTGATAAGAGAGATGCCGG + Intronic
1055930803 9:81558057-81558079 GGCTCTGATGAGAGGCAGGTAGG - Intergenic
1056220704 9:84448282-84448304 GGTCCTTACCAGAGGGAGGCAGG + Intergenic
1056493865 9:87136426-87136448 GGTCCTGATAAGAGGGAGGTTGG + Intergenic
1056508574 9:87281118-87281140 GTGCCTTATAAGAGGGAGGCAGG + Intergenic
1056555869 9:87686627-87686649 GGGTCTTACCAAAGGGATGCTGG + Exonic
1057041750 9:91853220-91853242 GGGCCTGATCAGAGGGCACCAGG + Intronic
1057303374 9:93899174-93899196 GGGGCTGAGCAGAGCCAGGCTGG + Intergenic
1057593172 9:96391513-96391535 TTGCCTTATCAGAGGGAGGCAGG + Intronic
1057678597 9:97154815-97154837 GGGTCTGGTCAGAGGGGGCTCGG - Intergenic
1057804922 9:98212988-98213010 GGGTCAGTTCAGAGGGAGAGGGG + Intronic
1057863425 9:98660831-98660853 GGTTCTTATAAGAAGGAGGCAGG - Intronic
1058007879 9:99938819-99938841 GGACCTGATAAGAGGGAGGGAGG + Intronic
1059426376 9:114223334-114223356 AATTCTGCTCAGAGGGAGGCTGG + Intronic
1060296003 9:122343278-122343300 GGGTCTGATGTGAGGGTGGGGGG - Intergenic
1060541032 9:124430270-124430292 GGGTCTTACAAGAGGGAGGCAGG + Intergenic
1060588221 9:124799878-124799900 GAGCCTGCTCAGAGGGAGGTGGG + Intronic
1060848505 9:126856511-126856533 GGCTCAGGTCAGAGAGAGGCAGG + Intergenic
1061291649 9:129653798-129653820 AGGGCTGAGCAGCGGGAGGCAGG + Intergenic
1061384391 9:130279909-130279931 GGTCCTCATAAGAGGGAGGCAGG + Intergenic
1062012089 9:134272837-134272859 GGGTCTGGGCAGTGGCAGGCAGG - Intergenic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062526580 9:136980318-136980340 AGGTCAGATTAGAGGCAGGCAGG + Intronic
1062713441 9:137989300-137989322 GGGTGTGATCAGAGAGAGTATGG + Intronic
1186184052 X:7002763-7002785 GGAACTCATCAGAGGGAAGCCGG + Intergenic
1186308739 X:8293710-8293732 GGGTTTCATAAGAGGGATGCAGG + Intergenic
1186594040 X:10961201-10961223 GATTCTTATAAGAGGGAGGCAGG + Intergenic
1187948109 X:24446175-24446197 GGTTCTTATAAGAGGGAGACAGG + Intergenic
1188013687 X:25084702-25084724 GGGTGTTAACAGATGGAGGCAGG - Intergenic
1188969135 X:36591693-36591715 GGGTCTTATCAGAGGGTAGAAGG - Intergenic
1189177553 X:38973109-38973131 GGGGCCTATCAGAGGGAGGAGGG + Intergenic
1189487785 X:41446237-41446259 GGGTCTGATCAAAATGAGGGTGG - Intergenic
1189705168 X:43752350-43752372 GGTTCTCTTAAGAGGGAGGCAGG - Intergenic
1189711291 X:43815040-43815062 GGGTGTGTTCAGAAGGATGCAGG + Intronic
1189938872 X:46099801-46099823 GGGTCTGATTAGAGGGTAGAGGG - Intergenic
1190040131 X:47064551-47064573 GGTGCTTATAAGAGGGAGGCAGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1193703485 X:84791576-84791598 GTGAATGATCACAGGGAGGCAGG + Intergenic
1193773385 X:85614778-85614800 GGGTCCTATCAGAGGGTGGAAGG - Intergenic
1195648029 X:107254571-107254593 GGGTCTGTTCAGAGAGTGGGGGG - Intergenic
1195708714 X:107757353-107757375 GGAACTGCTCTGAGGGAGGCAGG + Intronic
1196858122 X:120002212-120002234 TGGTGTGATCATAGTGAGGCAGG - Intergenic
1197278578 X:124508830-124508852 GGGTCTGCCCAGAGAGAGGAGGG - Intronic
1197359917 X:125488515-125488537 GGGGCTTATCAGAGGGTGGAGGG - Intergenic
1199218699 X:145291656-145291678 GGGGCTTATCAGAGGGTGGAAGG + Intergenic
1199765407 X:150937650-150937672 GGTCCTTATAAGAGGGAGGCAGG - Intergenic
1201866613 Y:18662332-18662354 GTGACTGATTAGAGGGAGCCAGG + Intergenic