ID: 1092119554

View in Genome Browser
Species Human (GRCh38)
Location 12:6034478-6034500
Sequence CCAGGTGAGCAGAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 504}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092119545_1092119554 27 Left 1092119545 12:6034428-6034450 CCACACCAATCCTCAACAACAAA 0: 1
1: 0
2: 0
3: 20
4: 362
Right 1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 504
1092119546_1092119554 22 Left 1092119546 12:6034433-6034455 CCAATCCTCAACAACAAACAAGC 0: 1
1: 0
2: 2
3: 23
4: 321
Right 1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 504
1092119544_1092119554 28 Left 1092119544 12:6034427-6034449 CCCACACCAATCCTCAACAACAA 0: 1
1: 0
2: 2
3: 12
4: 231
Right 1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 504
1092119547_1092119554 17 Left 1092119547 12:6034438-6034460 CCTCAACAACAAACAAGCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092119554 Original CRISPR CCAGGTGAGCAGAGGGAAAA TGG Intronic
900335029 1:2158458-2158480 GCAGGGGAGCAGAAGGAAAGGGG - Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
901129737 1:6954834-6954856 CCAGGCAAGCAGAGGGAAGGCGG - Intronic
901896742 1:12319991-12320013 CCAGGTGAGGAGAGGGATGCAGG - Intronic
901928477 1:12582195-12582217 CAAGGTGAGCAGCGGATAAACGG - Intronic
902349942 1:15847280-15847302 CCAGGTGAGCGGAGGACGAAGGG + Intergenic
902673698 1:17993703-17993725 CCAGGAGAAAAGAGAGAAAATGG + Intergenic
903422476 1:23227951-23227973 TGAGTTGAGCAGAGAGAAAAAGG + Intergenic
905224729 1:36471779-36471801 ACAAGGGAACAGAGGGAAAAGGG - Intronic
905303662 1:37003088-37003110 CCTGGTGGCCAAAGGGAAAAGGG - Intronic
905404626 1:37724551-37724573 GAAGGAGAGCAGAGGGAAACTGG + Intronic
906133901 1:43481369-43481391 TCATTTGATCAGAGGGAAAAGGG + Intergenic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906745971 1:48222448-48222470 CCAGATGAGCAGGAGGAGAAAGG - Intergenic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
907116545 1:51973596-51973618 CCAAGTGAGCATAAAGAAAATGG - Intronic
907412884 1:54294840-54294862 CAAGGACAGCAGAGGAAAAAGGG + Intronic
908711630 1:67022292-67022314 ACAGGTTAGCAGAGATAAAAAGG - Intronic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909023181 1:70454510-70454532 GCAGGTGAGAAGAGAGAAGAAGG + Intergenic
909081570 1:71118669-71118691 CCAGGTCAGCAGTGGGATGAGGG + Intergenic
909129907 1:71721864-71721886 CCATGTTAACATAGGGAAAAAGG + Intronic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909736662 1:78970550-78970572 CAAGGACAGAAGAGGGAAAAAGG + Intronic
909921395 1:81385103-81385125 CCAGGTGTGCAGAAGAACAAAGG - Intronic
910173531 1:84403515-84403537 TCAGCTGAGCAGAAGGAAGAAGG + Intronic
910310902 1:85823561-85823583 CCAGGTGACCAGGGTGAACAAGG - Exonic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911856907 1:102889507-102889529 CCAGGAGAACAAGGGGAAAAAGG - Exonic
912517549 1:110225808-110225830 GCCGGGGAGCAGAGGGCAAAAGG - Intronic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
913196746 1:116463008-116463030 CCAGGAAAGCAGAGGAATAAAGG - Intergenic
915508266 1:156371048-156371070 CCATCTGAGCAAGGGGAAAAAGG + Intronic
915732461 1:158063735-158063757 CCTGGTAAGCAGAGAGAGAAGGG - Intronic
915946883 1:160159361-160159383 TAAGGTGAGCATAGGAAAAAAGG - Intronic
917449625 1:175136324-175136346 AGAGGAGAGCAGAGGGAAAAGGG - Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
917580979 1:176377550-176377572 ACAGGGTAACAGAGGGAAAAAGG - Intergenic
918471934 1:184884174-184884196 CCAGGGAAGAAGAGGGAAACAGG - Intronic
918835212 1:189453640-189453662 ACTGGTGAGGAGATGGAAAAAGG + Intergenic
919083923 1:192898155-192898177 CCAGGTGATGAGAGTCAAAAAGG + Intergenic
919155146 1:193754725-193754747 TCAGAGGATCAGAGGGAAAAAGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
920122136 1:203666658-203666680 CCTGGTGAGCATAGGGAGAGAGG - Intronic
921347958 1:214206658-214206680 CCATGTGACCAGAAGCAAAAGGG - Intergenic
922606857 1:226894917-226894939 CCAGGTGAGCACAGGGAACCAGG - Intronic
922879548 1:228970350-228970372 GCAGAAGAGCAGAGGGGAAAAGG - Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923086656 1:230707786-230707808 TCAGACGAGCAGAGGGAAGACGG - Intronic
923558069 1:235017346-235017368 CCAGGAGAACAGATGGAAAGAGG + Intergenic
923913979 1:238482181-238482203 CAAGGACAGCAGATGGAAAAAGG - Intergenic
923978203 1:239288745-239288767 CCAGGGCAAGAGAGGGAAAAGGG + Intergenic
924045789 1:240029158-240029180 CAAGATGAGCAGAGAGACAAGGG + Intronic
924635947 1:245788012-245788034 CCAGATTAGCACAGGGAACAGGG + Intronic
924635987 1:245788240-245788262 CCAGATTAGCACAGGGAACAGGG + Intronic
924635993 1:245788278-245788300 CCAGATTAGCACAGGGAACAGGG + Intronic
1063051685 10:2456407-2456429 GCAGGTGAACAGAGAGTAAAAGG + Intergenic
1063716953 10:8537351-8537373 TCAGAAGAGCAGAGGGTAAAAGG - Intergenic
1063908547 10:10805821-10805843 CAAGGTGATCAAATGGAAAATGG - Intergenic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1065766866 10:29038363-29038385 TCAAGTTAGCAGATGGAAAAAGG - Intergenic
1067530554 10:47068591-47068613 CCAGGAGAGCAGATTGGAAAGGG - Intergenic
1068140279 10:52996863-52996885 CCAGAGGAGAAGAGAGAAAAAGG + Intergenic
1069112763 10:64467548-64467570 CCAGGTATGTAGAGGGAAAGGGG + Intergenic
1069636920 10:69930505-69930527 CCAGGAGAGAAGGGGGAAAAAGG + Exonic
1071026196 10:81116605-81116627 CCAGGAGTGGAGAGGGAAGAGGG + Intergenic
1071342976 10:84665366-84665388 GCAGGTGAGCAGAAGGAATCTGG - Intergenic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1072889119 10:99306150-99306172 CCAGAAGAGCAGAGAGGAAATGG + Intergenic
1074139414 10:110658805-110658827 CTAGTTGAGGAGAGGGAAAGAGG - Intronic
1074250013 10:111735638-111735660 TCAGGTGAGCAGAGGGGGCATGG + Intergenic
1074479929 10:113809987-113810009 CCAGGTTCCCAGATGGAAAATGG - Intergenic
1074829830 10:117240871-117240893 GCAGGGGCGCAGAGGGAAAGAGG - Intergenic
1076083694 10:127606376-127606398 CCAGCTGAGCAGTGGAGAAAAGG + Intergenic
1076122593 10:127948132-127948154 CCAGGAGAGCAGATGGGGAAGGG + Intronic
1076279125 10:129230301-129230323 CCAGATGGCCAGAGGGAAAGTGG + Intergenic
1076773270 10:132678875-132678897 CCATGTGAGAAGCTGGAAAAGGG + Intronic
1076802081 10:132835497-132835519 CATGGTGAGCACTGGGAAAAGGG + Intronic
1076912648 10:133399417-133399439 CCAGGTCAGCTCAGGGAAGAAGG - Intronic
1077411871 11:2407472-2407494 CCAGGAGAGCAGAGTGGACAGGG - Intronic
1077813464 11:5662050-5662072 ACAGGAAAGCAGAGGTAAAAGGG + Intergenic
1078437854 11:11340230-11340252 ACAGGTGACCAGAGGGATAGAGG + Intronic
1078596656 11:12692944-12692966 CCAGTTGCACAGAAGGAAAAGGG - Intronic
1078774227 11:14379562-14379584 CCAGGTGAACAGAGAGACAGAGG + Intergenic
1078962648 11:16296424-16296446 GCAGCTGAGCAGAAGGAAGATGG + Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1083987047 11:66222356-66222378 TCTGGTGAGCAAGGGGAAAAGGG + Intronic
1084680623 11:70664250-70664272 TCAGGAGTTCAGAGGGAAAATGG - Intronic
1084747651 11:71183596-71183618 CCATGGGAGCAGAGGGAGAGTGG - Intronic
1085056409 11:73406739-73406761 CCAGATCTGCAGAGGGAAAGGGG + Exonic
1085447562 11:76610872-76610894 CAAGGCGAGCGGAGGGAGAAGGG - Intergenic
1085738400 11:79058996-79059018 CAAGGAGAGCAGAGGATAAATGG + Intronic
1085831283 11:79903964-79903986 CCAGGAGAGCAGAGGTAAGGTGG - Intergenic
1086045380 11:82525879-82525901 CCAGCTAAGCAGTGGGGAAAAGG - Intergenic
1086505127 11:87496757-87496779 CAAGGTGAGGGGAGGCAAAAAGG - Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087575725 11:99986665-99986687 CAAGGAGAGCAGAGAAAAAAAGG - Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG + Intergenic
1088822880 11:113471468-113471490 GGAGGTGAGAAGAGGGAAAATGG + Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089457636 11:118634716-118634738 CCAGGCGAGGAGAAAGAAAAGGG - Intronic
1089614154 11:119685773-119685795 CCAGGTGAGCAGAGCAAAGGTGG - Intronic
1090310426 11:125731902-125731924 TCAGGTGAGAAGAGGGAACAAGG - Intergenic
1091655688 12:2345192-2345214 CCAAGTGCGCAGAGGTGAAAGGG + Intronic
1091703364 12:2678386-2678408 CCAGGAAAGGAGAGGGAAAGGGG - Intronic
1092088489 12:5785210-5785232 ACAGGGGATGAGAGGGAAAAGGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092203789 12:6603446-6603468 CCCACTGAGGAGAGGGAAAATGG + Intronic
1093526585 12:20110569-20110591 CCAGATCAGTAAAGGGAAAATGG - Intergenic
1094613232 12:32013506-32013528 CCAGGAGGGCAGAAGAAAAAGGG - Intergenic
1094711965 12:32973514-32973536 CCAGGAGATCAAAGGGGAAATGG - Intergenic
1095319187 12:40805255-40805277 CCAGAAGAAAAGAGGGAAAAGGG - Intronic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1097477938 12:60082552-60082574 TCAGGAGAACAGAGGGAGAAAGG - Intergenic
1099254477 12:80298604-80298626 CCAGGTGAAGAGAGGGAGTAGGG + Intronic
1099997325 12:89793247-89793269 CCACCTGGGCTGAGGGAAAAAGG - Intergenic
1101672419 12:106888510-106888532 CCAGGTGTGCTGTGGGGAAAAGG - Intronic
1102138391 12:110594313-110594335 CGAGGTCAGCAGGGGGAACATGG - Intergenic
1103015750 12:117493403-117493425 TCATATGAGAAGAGGGAAAATGG - Intronic
1103862947 12:124028728-124028750 TCAGATGAACAGAGGGAAAGAGG + Intronic
1105442147 13:20424516-20424538 CCAGCTGAGCGAAGGGACAATGG + Intronic
1105584387 13:21730553-21730575 TCTGGTGAGAAGAGGTAAAAGGG + Intergenic
1105606563 13:21930897-21930919 GGAGGGGAGCAGAGGAAAAAGGG + Intergenic
1106174737 13:27320573-27320595 GCTGGTAAGCAGAGGGAAAAGGG + Intergenic
1106834215 13:33616209-33616231 AGAGGAGAGGAGAGGGAAAAGGG + Intergenic
1107024730 13:35788282-35788304 CCAGCTGAGCAGAGAGAAATGGG + Exonic
1107374436 13:39786554-39786576 CAAGGTTTGCAGAGAGAAAATGG + Intronic
1107873289 13:44766215-44766237 CCTGGTGAGAGGAGGGGAAAGGG + Intergenic
1107905384 13:45056700-45056722 ACAGGACAGCAGAGGGACAAAGG + Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108890674 13:55254375-55254397 CCAAGTGAGAATAGGGGAAAAGG - Intergenic
1110972057 13:81776204-81776226 CCAGGGGTTCAGAGGGAGAAAGG - Intergenic
1111193763 13:84844859-84844881 ACAGGTTAGCAGGGGGAAAAAGG - Intergenic
1111363739 13:87212060-87212082 CCATGTTATCAGAGGTAAAAAGG + Intergenic
1111368952 13:87290552-87290574 GCAGGTAAGCAGAAGAAAAAAGG - Intergenic
1112234365 13:97622061-97622083 CCAGGTGAGAAGAGCGAGAGCGG + Intergenic
1112297639 13:98202289-98202311 CCAGGAGAGCAAAGAGCAAAGGG - Intronic
1112468223 13:99663798-99663820 CCAGGAGAGCAGGAGTAAAACGG - Intronic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1114143582 14:19946798-19946820 GCAGGAGATTAGAGGGAAAAAGG - Intergenic
1114240905 14:20867009-20867031 CCAGGTGAGCATAAAAAAAATGG + Intergenic
1114757329 14:25274236-25274258 CCAGTTCATCAGAGAGAAAAGGG + Intergenic
1115952090 14:38732808-38732830 GTGGTTGAGCAGAGGGAAAAAGG + Intergenic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1118710354 14:68513654-68513676 ACAGGGGAGCAGAGAGAAAGGGG + Intronic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1119568121 14:75646172-75646194 TGAGGTCATCAGAGGGAAAAAGG - Intronic
1119677799 14:76568978-76569000 CCAGGTGAGGGGAGGGCAATTGG + Intergenic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1122615732 14:103016491-103016513 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1122615739 14:103016509-103016531 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1122615746 14:103016527-103016549 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1122615753 14:103016545-103016567 CCAGGTGAGGGGAGGGAACCAGG + Intronic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123678766 15:22740377-22740399 CCAGGAGAGGAAAGGGAAAGAGG - Intergenic
1124801230 15:32834818-32834840 CAAGGTGATCAGAGGGAACTAGG - Intronic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1125154409 15:36569838-36569860 CCAGGTGAGGACAGGTGAAATGG - Intergenic
1125592717 15:40864733-40864755 CCAGGTGAGGAGAGGGACACTGG + Intergenic
1126405471 15:48318302-48318324 GCAGGAGACCAGAGGGAGAAGGG - Intergenic
1127262349 15:57335550-57335572 GCTGGAGAGCAGAGGGAGAACGG - Intergenic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127373317 15:58360005-58360027 CCAGGACAGCAGAGGGAACCAGG - Intronic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1128091479 15:64922041-64922063 CCAGGGGAGCCGAGGGGACAGGG - Intronic
1129170941 15:73807464-73807486 CCAGCAGGGCAGAGGGAACATGG - Intergenic
1130679933 15:85987848-85987870 CCAGGTTAGAAGAAGGAAATGGG + Intergenic
1131223957 15:90608360-90608382 GCGGGGGAGCAGAGAGAAAAGGG - Intronic
1131297935 15:91168481-91168503 CAAGGCCAGCAGAGGAAAAAGGG + Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131683124 15:94744841-94744863 ACAGATTAGCAGAGGAAAAAAGG + Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132760995 16:1508672-1508694 CCAGGTGGGGAGAGGGGAGATGG - Intronic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1133971286 16:10570014-10570036 CCAGGGGAGGAGTGGGAGAAGGG - Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1135246551 16:20862061-20862083 CCAGGTGAGCAGTGGAGGAAAGG - Intronic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135817464 16:25648454-25648476 ACATTAGAGCAGAGGGAAAAGGG + Intergenic
1136371588 16:29840202-29840224 CCAGGAGAGCAGCTGGAACAAGG + Exonic
1137350108 16:47706005-47706027 CCAACCGAGCAGAGGGGAAAGGG - Intergenic
1137587077 16:49670051-49670073 CCACGAGAACAGAGGAAAAAAGG + Intronic
1137749062 16:50845254-50845276 CCAGAGGAGCAGAGGGAGACTGG + Intergenic
1138179535 16:54932408-54932430 CCCGGGGAGCGCAGGGAAAAGGG + Intronic
1138599328 16:58045732-58045754 CCAGGGGAGCAGAGGGGCAGAGG + Exonic
1139024562 16:62798655-62798677 ACAGAAGCGCAGAGGGAAAACGG + Intergenic
1139335000 16:66225532-66225554 CCAGTAGGGTAGAGGGAAAAGGG + Intergenic
1139369482 16:66457903-66457925 AATGGTGAACAGAGGGAAAATGG + Intronic
1139451101 16:67028910-67028932 GCGGGCGAGCAGGGGGAAAAGGG + Intergenic
1139558510 16:67727625-67727647 CCAGGTCTGCAGAGGGAAGTGGG - Intronic
1140992794 16:80230664-80230686 CCTGGTGAGCAGAGGCAGAGTGG + Intergenic
1141049529 16:80747850-80747872 CCAGGTGGGCAGAGGTAGGAAGG - Intronic
1141352436 16:83310607-83310629 CCAAGTGAGCAAAGGCAGAAAGG - Intronic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1142545299 17:697378-697400 CCAGGGGAGCATAGGTAATATGG + Intronic
1142581275 17:944503-944525 TCAGCTGAGCAGATGGCAAAGGG + Intronic
1142748746 17:1974770-1974792 GCAGGTGAGCAGAGTGAGAGAGG - Intronic
1143407893 17:6690240-6690262 CTTGGTGAGCACAGGGATAAGGG - Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1146321930 17:31853724-31853746 AGAGGTGAGCACAGGGACAAAGG + Intronic
1146454422 17:32997933-32997955 ACAGGTGAGGTGAGGGAAAACGG - Intergenic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148043967 17:44731012-44731034 CCAGGTGAGCTGGGGCAAGATGG + Exonic
1148246450 17:46034089-46034111 TCAGAAGAGAAGAGGGAAAAAGG + Intronic
1148572709 17:48683212-48683234 TCAGGTGAGAAAATGGAAAAGGG - Intergenic
1148865181 17:50624526-50624548 CCAGGTGAGCAGATGTGGAAAGG + Exonic
1149597387 17:57872396-57872418 GCAGGTGTGCAAAGGGAAGAAGG + Intronic
1149642618 17:58213746-58213768 ACAGGTGAGGAGAGGAAGAAAGG - Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1152229845 17:79108997-79109019 CCAGGTGAGCATCGGGACAGCGG - Intronic
1152944210 17:83190343-83190365 CCAGGTGGACAGAAGGACAAAGG - Intergenic
1152985223 18:314845-314867 CCAGGTGAGCAGAAGGCCAGAGG - Intergenic
1153542472 18:6170584-6170606 CCAGGTGGGTAGAGTGACAAAGG + Intronic
1154461594 18:14595163-14595185 GCAGGAGATTAGAGGGAAAAAGG - Intergenic
1156017839 18:32566361-32566383 CTAGGTGAGAATAGGGAAATTGG - Intergenic
1156569595 18:38238348-38238370 ACATGAGAGCAGAGGGAAATGGG + Intergenic
1157564151 18:48668465-48668487 ACAGGTGAGCAGGTGGAGAAAGG - Intronic
1157965729 18:52206164-52206186 ACAGGTGAGCAGAGGGAGCAAGG + Intergenic
1158133169 18:54175521-54175543 CCAGGGGAGGAGGGGAAAAATGG - Intronic
1158268884 18:55690843-55690865 CCAGCTTAGCATAGAGAAAATGG - Intergenic
1158544501 18:58384676-58384698 CCAGGGGAGCAGAGGTATCAGGG - Intronic
1158602884 18:58870254-58870276 ACAGGAGTGCAGAGGGAAAAGGG + Intronic
1158633341 18:59135066-59135088 TCAGGTAAGGAGAGGGAATATGG + Intergenic
1160112566 18:76047609-76047631 CTAGGTGATCAGAGCTAAAATGG - Intergenic
1160250331 18:77198015-77198037 CCAGGTGTGCAGAGAGGAAAGGG + Intergenic
1160303820 18:77712489-77712511 CCAGGAGAGGAGAGAGAGAAAGG + Intergenic
1160305225 18:77727525-77727547 CCAGGAAAGGAGAGTGAAAAGGG - Intergenic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162208514 19:9073908-9073930 CGAGGTGAGGAAAGGGGAAAAGG - Intergenic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162352604 19:10159782-10159804 GCTGGTGAGCAGTGGGACAAGGG + Intronic
1162540687 19:11294159-11294181 GCAAATGAGCAGTGGGAAAACGG - Intergenic
1163954664 19:20625865-20625887 CCAGGTGAGCACAATGCAAACGG + Intronic
1164235033 19:23324208-23324230 CCAGGAGAGGAGAGGAGAAAAGG - Intronic
1164250308 19:23469826-23469848 CCAGGAGAGGAGAGGAAAAAAGG - Intergenic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1165146604 19:33734917-33734939 CAAGCTGAACAGAGGGTAAACGG + Intronic
1166107847 19:40606180-40606202 ACAGGTGGGCAGAGCGAGAATGG - Intronic
1166346416 19:42168905-42168927 CCTGGTAAGGAGAGGAAAAAGGG - Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167312518 19:48745452-48745474 CCAGCCGAGGATAGGGAAAACGG + Intronic
1167331587 19:48859596-48859618 GGAGGTGAGCAGAGGGGAAGAGG - Exonic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
1167612031 19:50512341-50512363 CCAGGTGAGCAGAGCTAAGCAGG - Exonic
1167682878 19:50935990-50936012 CCAGGTGAGAAGAGGTGGAAGGG + Intergenic
1168042242 19:53768040-53768062 AAAGGGGAGCAAAGGGAAAACGG - Intergenic
1168352693 19:55685759-55685781 CCAGGTGAGGAGAAGCAAAGGGG - Intronic
925802042 2:7611044-7611066 CCAGGTGAGCAGAGCAGACAGGG - Intergenic
926747013 2:16167095-16167117 CCAGGTTAGCACAGGGATGAGGG + Intergenic
926859745 2:17296494-17296516 AATGGTGAGCAGAGGCAAAATGG - Intergenic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
927434013 2:23051847-23051869 CCAGGTCAGCATCAGGAAAATGG + Intergenic
927698072 2:25251267-25251289 GCAGGAGTGCAGAGGGAAAGGGG - Intronic
927818536 2:26242692-26242714 CAAGGTCATCAGAGGGTAAAAGG + Intronic
927963651 2:27256392-27256414 CCAGGTGTGCAGAGGCAACATGG + Exonic
929098704 2:38288001-38288023 ACAGATGAGAAGGGGGAAAATGG + Intergenic
930004880 2:46888726-46888748 GCAGCTGAGCAGACGGGAAAAGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931721243 2:65069179-65069201 CCATGAAAGCAGAGGGGAAATGG + Intronic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
932761080 2:74439766-74439788 ACAGGAGTGCAGAGGGATAAGGG - Intronic
933436912 2:82260401-82260423 CCAGGTGAGGAGATGGGAATGGG + Intergenic
935353488 2:102176868-102176890 CCAGGTGACCTCAGGGATAAAGG - Exonic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936158817 2:110068998-110069020 CCAGCTCAGCTGAGGGAACACGG - Intergenic
936185843 2:110302334-110302356 CCAGCTCAGCTGAGGGAACACGG + Intergenic
936257884 2:110933252-110933274 ACACAAGAGCAGAGGGAAAAGGG - Intronic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
937326610 2:120993220-120993242 CCTGGAGAGGAGAGGGTAAAGGG - Intergenic
937649259 2:124301735-124301757 CCAAGAGATCAGAGGCAAAATGG - Intronic
937854708 2:126663821-126663843 CCAGGTGAGCCGAGGGAAGGAGG - Intronic
939120381 2:138109558-138109580 CCAGGTGAGTAGTGGTAAAGTGG + Intergenic
939667908 2:144973191-144973213 TCATGTAAGCAGAGGGAAATAGG + Intergenic
939710339 2:145509463-145509485 TGAGGAGAGCAGAGGGAAAGTGG - Intergenic
940211790 2:151262715-151262737 CCAGGTGAGCGGTGGGGGAAGGG - Intergenic
941376452 2:164737234-164737256 CCAGGAAAGCAAAGGGAAGAGGG + Intronic
941915064 2:170806450-170806472 ACAGCAGAGCAGAGCGAAAAAGG + Intergenic
942565131 2:177258435-177258457 CCAGGAGAGTTGAGGGGAAATGG + Intronic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
946070100 2:217027105-217027127 CCAAGAGAGCAGAGTGAAAATGG - Intergenic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG + Intronic
947501742 2:230675879-230675901 ACAGGTGGGCAGAGGAAAGAGGG - Intergenic
947578941 2:231299561-231299583 CCAGGTGGGAAGTGAGAAAATGG + Intronic
947829074 2:233126013-233126035 CCTGGTGACCAGAGGGAGATGGG + Intronic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948115545 2:235492747-235492769 CCTGGTGAGCACTGGGAGAAGGG + Intergenic
948802273 2:240438323-240438345 CCACGTGGGCTGAGGGAAACAGG + Intronic
948840245 2:240645218-240645240 CCAGGTGAGCAGCAGGCAAGAGG - Intergenic
1168887798 20:1272076-1272098 CCATGTTATCAGGGGGAAAATGG + Intronic
1170435362 20:16321694-16321716 TCAGATGTGCAGAAGGAAAATGG + Intronic
1170728294 20:18948878-18948900 CCAGGGAAGGAGAGGGAACAAGG + Intergenic
1170731224 20:18977116-18977138 CCAGGTGAGCAGAAAGATAGTGG - Intergenic
1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG + Intergenic
1172767729 20:37359626-37359648 CCAGGGGAACAGAGTGAGAAAGG + Intronic
1172855726 20:38000713-38000735 TCAGGGGAGCAGAGTGGAAATGG + Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1174317130 20:49712558-49712580 CCAGGTGAGAAGGGGGAGCATGG - Intronic
1174329550 20:49807285-49807307 GCAGGTGAGGAGAGGGAAAGAGG - Intergenic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175475826 20:59273471-59273493 TCAGTGGGGCAGAGGGAAAAGGG - Intergenic
1175687450 20:61041781-61041803 AGAGGTGAGCAGAGTGGAAATGG + Intergenic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1176241235 20:64076822-64076844 CCAGGGGAGCAGAGGCAGAGGGG + Intronic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1176812956 21:13563429-13563451 GCAGGAGATTAGAGGGAAAAAGG + Intergenic
1177574664 21:22937021-22937043 GCAGGTGAGAACTGGGAAAATGG + Intergenic
1178517901 21:33264265-33264287 CCAGGTGAGCAGTGGAGAGAAGG + Exonic
1178529434 21:33362922-33362944 GCATGAGAGCAGAGGAAAAACGG + Intergenic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
1178734495 21:35136737-35136759 CCTGGTGAGCACAGGCAAACTGG + Intronic
1178890412 21:36516093-36516115 CCAGGTGAGCACAAAGAGAAGGG - Intronic
1178958323 21:37042703-37042725 CCCCCAGAGCAGAGGGAAAAGGG - Intergenic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179782523 21:43711139-43711161 CCAGAAGAGGAGAGGGAGAAAGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182044392 22:27262877-27262899 ACAGGTGAGCAGAGGGCCTAGGG - Intergenic
1182147412 22:28005228-28005250 CCAGGCCAGGTGAGGGAAAAGGG + Intronic
1182614545 22:31578212-31578234 CCAGGGAAGCAGTGGGCAAAGGG - Intronic
1183246232 22:36695596-36695618 CCAGGTGAAGAGAGGAAGAAAGG - Intronic
1183751545 22:39723767-39723789 CCAGCTGAGCAGGAGGAAGACGG + Intergenic
1184319937 22:43733557-43733579 ACAGGTCATCAGAGGGTAAAGGG + Intronic
949276140 3:2284049-2284071 GCATGTTAGCAGAGGGAAAAAGG + Intronic
949431905 3:3985865-3985887 CCATGTTAGCAGAGAGAGAAAGG - Intronic
949960112 3:9304878-9304900 CCAGGTGAGCAGGTGGAGAATGG - Intronic
950400689 3:12767315-12767337 CCAGGACAGCAGGGGGGAAAAGG + Intronic
950570005 3:13793884-13793906 CCAGGTGTGCACAGGGAGAGAGG - Intergenic
950700906 3:14745308-14745330 GCAGGAGATCAGAGGGAAAGAGG - Intronic
951365998 3:21783346-21783368 CCAGTGGAACAGAGGGAAAAAGG + Intronic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
952493003 3:33889646-33889668 CCAGGTTAGAAGAGGGGGAATGG + Intergenic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
953463174 3:43097490-43097512 GCAGGTGAGCAAGGGGGAAAGGG + Intronic
953776871 3:45826682-45826704 CCAGGGGAGCAGAGCTAGAAAGG - Intronic
954396467 3:50295928-50295950 CAAGGTGGGCAGAGGAAAGAAGG - Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
956190498 3:66603197-66603219 CCAGGTGAGCAAAGGACAAAGGG + Intergenic
959130944 3:102355363-102355385 CCTGGTTATCAGAGGGAAACAGG + Intronic
961324453 3:126102089-126102111 GCAGGTGGGAAGTGGGAAAAAGG + Intergenic
961443606 3:126967406-126967428 CCCAGTGACCTGAGGGAAAACGG - Intergenic
962260344 3:133898186-133898208 CCAGCTGTGTAGAGGGTAAATGG - Intergenic
962274658 3:134002953-134002975 CCAGGTGGGCAGATGGCCAAGGG - Intronic
962668545 3:137681123-137681145 ACAGGTAACCAAAGGGAAAATGG + Intergenic
962898047 3:139733727-139733749 ACAGGTGAGCAGTGGTGAAATGG + Intergenic
963853167 3:150227624-150227646 CTAGGTAAGAAGAGGGAAAGTGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964689395 3:159433064-159433086 CCAAGTGCGCTGAAGGAAAATGG - Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
966093358 3:176167643-176167665 TGAGGAGAGCAGAGGGGAAAAGG + Intergenic
966468209 3:180256232-180256254 TGAGGTGAGGAGAGGGAAGAGGG + Intergenic
967277788 3:187793729-187793751 CCAAGACAGCAGATGGAAAAAGG - Intergenic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968640077 4:1709974-1709996 CCAGGGGACCAGTTGGAAAATGG - Intronic
968816968 4:2827344-2827366 CCAGGTGGGGAGAGGCAAACGGG - Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
969440095 4:7211869-7211891 CCAGGTGGGGAGAGAGTAAAAGG - Intronic
970411204 4:15809511-15809533 CCAAGTGAGAATGGGGAAAATGG - Intronic
971338889 4:25749576-25749598 CCAGATGAGCAGAGACAAAGAGG - Intronic
972332928 4:38080448-38080470 TCAGGTGGTCAGAAGGAAAAGGG - Intronic
972583984 4:40419823-40419845 GCAGATGAGTAGGGGGAAAAGGG - Intergenic
973681733 4:53327470-53327492 GCAGGTGAGCAGACTGAGAAGGG + Intronic
974117503 4:57598143-57598165 CTATGGGAGCAGAGAGAAAAGGG + Intergenic
976262081 4:83155320-83155342 GCAGCAAAGCAGAGGGAAAATGG - Intergenic
976485659 4:85600471-85600493 CCACGTGAGAAGAGGGAGATGGG + Intronic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
978605354 4:110473656-110473678 CCAGATGAGCAGAGGTAGAAGGG - Intronic
978757085 4:112314278-112314300 CTAAGTGAGCAGAAGGTAAACGG + Intronic
979150188 4:117302218-117302240 CCAGGGTAGTTGAGGGAAAAAGG + Intergenic
979226512 4:118291955-118291977 CCAGGTGAGGGGAGGGAACTTGG + Intronic
981172339 4:141638902-141638924 CCAGGAGAGATGAGGGGAAAAGG - Intronic
981418069 4:144516865-144516887 CCAGGTCAGCACTTGGAAAAAGG - Intergenic
983367191 4:166807587-166807609 CCAGTTGAGCAGAGTGAAGGAGG + Intronic
983442952 4:167810604-167810626 CAAGGTGGGCAGAGGGCAAGCGG + Intergenic
984189463 4:176588234-176588256 GCAAGTGAGTAGAGGAAAAAAGG + Intergenic
985995438 5:3594960-3594982 CCAGGTGTGCAGAGGCAGACAGG - Intergenic
986394506 5:7315096-7315118 CCAGGTGGTCAGATGGGAAAGGG + Intergenic
986823537 5:11496116-11496138 CCAGGTAAGGAGAGACAAAAGGG - Intronic
987325830 5:16811143-16811165 CCAGGTGAGCTGATGGTAAGTGG + Intronic
988182684 5:27817385-27817407 CCAGCTGACCAGAGACAAAAAGG - Intergenic
990499554 5:56381950-56381972 AAAGGGGAGCAAAGGGAAAACGG + Intergenic
991931406 5:71756437-71756459 CATGATGAGCAGATGGAAAAAGG - Intergenic
993407683 5:87531838-87531860 CCAGGAGTTCAGAGGGAAAAAGG - Intergenic
993701421 5:91123437-91123459 GCAGAAGAGCAAAGGGAAAAGGG + Intronic
995105141 5:108369080-108369102 TTAGGTGAGCAGAGGGATGATGG - Intronic
995241290 5:109887480-109887502 CCAGGTGCTCAAAGGAAAAATGG - Intergenic
995738115 5:115325056-115325078 CCAGGTGAGCAGGGTGAAGGAGG + Intergenic
995851797 5:116553994-116554016 CCTGGAGAGGAGTGGGAAAAAGG + Intronic
996606736 5:125331483-125331505 CTAGGGGAGCAGAGAGCAAAAGG + Intergenic
998061365 5:139121217-139121239 CCAGGTAAGCAGAAAAAAAATGG + Intronic
998331713 5:141333027-141333049 CCAGGAGAGCTGTGAGAAAAAGG + Exonic
998332538 5:141341314-141341336 CCAGGAGAGCTGTGAGAAAAAGG + Exonic
998358890 5:141566979-141567001 CCAGTAGAGCAAAGTGAAAAAGG + Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999791049 5:154939606-154939628 CTAGGTGATCAGAGGAAAAAGGG + Intergenic
999975674 5:156909637-156909659 TAAGGTGATTAGAGGGAAAATGG + Intergenic
1000805573 5:165786510-165786532 CTAGGTGAGCAGAGGCAGAGAGG + Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1002857187 6:1048364-1048386 CCTTGTGGGCAGAGGGACAAGGG + Intergenic
1004309804 6:14535184-14535206 CAAGGTGAGCAGTGGAAGAAGGG - Intergenic
1005084590 6:21992063-21992085 AAAGCTGAGCAGAGGGGAAAAGG - Intergenic
1005136795 6:22578157-22578179 CCATTTTAGCAGATGGAAAAAGG + Intergenic
1005953368 6:30647300-30647322 CCAGGTGAGCGGAGGAGAAGAGG + Exonic
1006295101 6:33166772-33166794 CCGGGTGAGCAGGGAGAGAAGGG - Exonic
1006575779 6:35044517-35044539 CAAAGTGAGGAGAGGGAACAGGG - Intronic
1006832947 6:36979812-36979834 ACAGGTGGGCAGATGGAAGAGGG - Intronic
1006998517 6:38285543-38285565 CCAGGTAAGCAAATGGAAAACGG + Intronic
1007415221 6:41687700-41687722 CCAGGTGAGAACAAGGAAGAGGG + Intronic
1008036782 6:46753556-46753578 CCTGGTGAGAAGAGGGAAAAGGG + Intronic
1008508496 6:52254168-52254190 CCAGGTGAGCAGAACTGAAATGG - Intergenic
1009890924 6:69680869-69680891 TCAGGTGAGCAGCTGGAAGATGG - Intronic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1013091343 6:106903407-106903429 CCAGGAGGGTAGAGGAAAAACGG - Intergenic
1013273520 6:108562053-108562075 CCAGGTGAGGAGAGGGGGCAGGG + Intronic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1015893986 6:137998624-137998646 GTAGGGGAGGAGAGGGAAAAAGG + Intergenic
1016178870 6:141119218-141119240 CCATGTGAGTGGAGGTAAAAAGG + Intergenic
1017363733 6:153607171-153607193 GGAGGAGAGCAGAGAGAAAACGG + Intergenic
1017831948 6:158138478-158138500 CCAAGTGAAGAGAGGGAAAGTGG - Intronic
1018668352 6:166160229-166160251 CAAGTTATGCAGAGGGAAAAAGG - Intronic
1018799432 6:167210707-167210729 CCAAGTGGGCAGAGGGAGCAGGG + Intergenic
1019109035 6:169694993-169695015 CCCGGCCAGCAGAGGGAGAAGGG + Intronic
1019511939 7:1422046-1422068 CCAGGTGTGCACAGGTAAATAGG + Intergenic
1020223540 7:6261107-6261129 CCAGGATTCCAGAGGGAAAAGGG + Intronic
1021098654 7:16562669-16562691 CCAGGGGAGCAGAGGGATTCTGG + Intronic
1021264944 7:18508591-18508613 GCAGGTGAGATGAGGGACAAGGG - Intronic
1021296809 7:18918236-18918258 CCATGTTTGCAGAGGGAGAATGG + Intronic
1021378749 7:19940594-19940616 TCAGATGGGCAGAGGGAAACCGG + Intergenic
1022015245 7:26343844-26343866 CCAGGAAAGCAAAAGGAAAAAGG - Intronic
1022547074 7:31199845-31199867 CCAGGTGAGCAGAGAGGCTAAGG - Intergenic
1023198291 7:37665766-37665788 CCAGCAGGGCAGAAGGAAAAAGG - Intergenic
1023262341 7:38370531-38370553 CCAGGTGAGGACAGAGAGAAAGG - Intergenic
1024492818 7:50004847-50004869 CAAGGTGGAGAGAGGGAAAAGGG + Intronic
1024691874 7:51811490-51811512 ACAGGTGAAAAGAGAGAAAATGG - Intergenic
1025710199 7:63901149-63901171 CCAGCTGAGCAGCGGGAAGTGGG - Intergenic
1025911518 7:65832505-65832527 CCAGTGGAGCAGAAGGAAAGAGG + Intergenic
1026529239 7:71183078-71183100 CCAGATGTGCAGAGTGAAAGGGG + Intronic
1027441591 7:78224968-78224990 TGAGGTGAGCAGAGGGAAGGCGG - Intronic
1027512401 7:79098826-79098848 CCAGGAGAGGAGAGAGAAAGGGG + Intronic
1028261000 7:88665119-88665141 CCAGGTGGAAAGAGGGAAATAGG - Intergenic
1029043382 7:97600911-97600933 CAAGGTGAGCAAGGGGAAGAAGG + Intergenic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031619101 7:123914521-123914543 CAATGTGAGCAGAGGTGAAAGGG + Intergenic
1031648837 7:124260449-124260471 CCAGAAGAGCATGGGGAAAATGG - Intergenic
1032127635 7:129206302-129206324 CCAGGTGAGCAGGTGGAAGTAGG - Exonic
1032359707 7:131244130-131244152 CCTGGGGAGTAGAGGGAAATCGG - Intronic
1032700008 7:134371003-134371025 CCAGGTGGGCAGAGGAGATACGG + Intergenic
1032886300 7:136142848-136142870 CTAGGTGAGCAGAGGAGGAAGGG - Intergenic
1033133645 7:138766925-138766947 ACAGATAAGCAGTGGGAAAAGGG - Intronic
1033226875 7:139569348-139569370 CCAGGTGCGCCGATGGCAAAAGG + Exonic
1033573674 7:142658842-142658864 CCACGTGGGCAGAGGGAAATGGG + Intergenic
1034545509 7:151786226-151786248 CCACGTGAGGAGAAGAAAAAGGG + Intronic
1034760382 7:153667011-153667033 CCAGGTGAGAAGAGGAAGAAAGG - Intergenic
1035698609 8:1620937-1620959 TCTGGAGAGCAGAGGGTAAAGGG - Intronic
1036991815 8:13606844-13606866 CCAGGTGATGGGATGGAAAATGG + Intergenic
1038484384 8:27923276-27923298 GCACGTGAGCAGAAGGGAAAGGG - Intronic
1039653747 8:39375379-39375401 CCAACTGAGCAGAGCCAAAATGG - Intergenic
1040772501 8:50994575-50994597 CCAGGGGAGCAGAGAAAATAAGG - Intergenic
1041231921 8:55761326-55761348 CCATGTGAGCAGAAGCACAAAGG - Intronic
1042213260 8:66402893-66402915 CCAGGAGGGGAGAGGGCAAATGG + Intergenic
1044291121 8:90471791-90471813 GCAGGTGAGAAGAGGAAAAGAGG + Intergenic
1044334541 8:90963861-90963883 CCAGGAGAAGAGAGAGAAAAAGG + Intronic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1045524905 8:102933329-102933351 CCTGGTGAGAAAAGAGAAAAAGG - Intronic
1046310541 8:112430839-112430861 ACAGGTCAACAGAGGGAAAAGGG + Intronic
1046512739 8:115219865-115219887 CCAGGTGAACAAAGGCAAGAAGG + Intergenic
1047113611 8:121817520-121817542 AGAGGAGAGGAGAGGGAAAAGGG + Intergenic
1047505576 8:125476945-125476967 CCAGCTGAGCAGAGAAAAATGGG - Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1049168391 8:141141379-141141401 CCAGGTGAGCCAAGGGACCAGGG + Intronic
1049339855 8:142106279-142106301 ACAGGTGAACAGAGGGACACAGG + Intergenic
1049367035 8:142244818-142244840 GCAGGGGAGCAGAGGGAGCAGGG + Intronic
1049790009 8:144468169-144468191 CCAGGAGAGCAGAGGGACTGTGG + Intronic
1052607120 9:30718830-30718852 CCAGGAGAGAAGAGAGAAAATGG - Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1052886277 9:33651221-33651243 CCACGTGGGCAGAGAGAAATGGG + Intergenic
1053043529 9:34894346-34894368 AGAGATGAGAAGAGGGAAAATGG - Intergenic
1053478877 9:38401490-38401512 GCAGGGGACCAGAGGGATAAGGG + Intergenic
1055413446 9:76056394-76056416 CCGTGTGAGGAGAGGGCAAAAGG + Intronic
1055964040 9:81847845-81847867 AAAAGTAAGCAGAGGGAAAAAGG + Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056787477 9:89603683-89603705 CCTGGGGAGTAGAGGGCAAAAGG - Intergenic
1056803199 9:89708397-89708419 CCAGGTGAGGAGTGGGGAAGTGG - Intergenic
1056829205 9:89900789-89900811 CCAGGTGAGCAAAGGGGTAAGGG + Intergenic
1057049024 9:91907921-91907943 CCAGGTGGGCACAGGGCAAGGGG + Intronic
1057164614 9:92915949-92915971 CCAGGGGAGAAGAGAGAGAAGGG - Intergenic
1057857645 9:98614121-98614143 CCACATCAGCAGAGGAAAAAGGG + Intronic
1058793278 9:108472304-108472326 CCATGTGAGCAGAAAAAAAAAGG + Intergenic
1059263233 9:112999728-112999750 CAAGGTGGGCAGAAGGGAAAGGG + Intergenic
1059395605 9:114032353-114032375 GCAGGAGAGCAGATGGCAAATGG - Intronic
1059610777 9:115890751-115890773 GCAGGTTAGCATAGGGAAGAAGG - Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1059783119 9:117550914-117550936 CAAGGTGAGGAGAAGGTAAATGG + Intergenic
1060212967 9:121721787-121721809 CCAGATGGGCAGAGGGCAATAGG + Intronic
1060622538 9:125081130-125081152 CTTTGTGAGCAGAGTGAAAATGG + Intronic
1060689989 9:125649237-125649259 CCAGGTTAGAAGAGGGAATCTGG - Intronic
1061101982 9:128499072-128499094 CCAGCTGAGCAGAACCAAAACGG + Exonic
1061445130 9:130633330-130633352 CCAAGCGAGCAGAGGGAAAGGGG - Intronic
1061672100 9:132194514-132194536 CCAGGACAGCAGAGGGACATGGG - Intronic
1062210106 9:135358904-135358926 ACAGGTCCGCAGAGGCAAAAGGG + Intergenic
1062288273 9:135783312-135783334 CCAGCTCAGAAGAGGGAAGAGGG + Intronic
1203481537 Un_GL000224v1:13182-13204 CAAGGTGAGGACAGGGAAATGGG + Intergenic
1185775540 X:2800179-2800201 CCAGGTGATGAGAGGGAGACAGG + Intronic
1185868679 X:3645174-3645196 CCAGGTGAGCAAAAGGAGACAGG - Intronic
1185910678 X:3977719-3977741 AAAGGCGAGGAGAGGGAAAAGGG + Intergenic
1186576851 X:10775801-10775823 CCAGGTGACCTCAGGGACAAAGG + Intronic
1187258814 X:17666492-17666514 CCAGGTGAGGAGATGGATATGGG - Intronic
1187764900 X:22630671-22630693 CCCTGTCAGCAGAGGGAGAAGGG - Intergenic
1187793185 X:22973094-22973116 CCAGCTGAGCAGTGAGAAACTGG + Intergenic
1188340723 X:28998000-28998022 CCAGCTGCACTGAGGGAAAAGGG - Intronic
1188807509 X:34610271-34610293 GCAGGTGAGGAGAGTGAAAAGGG - Intergenic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189481537 X:41395770-41395792 TCAGCTGAACAGAGGGGAAATGG + Intergenic
1190891184 X:54569646-54569668 CCAGATGATCAAGGGGAAAAAGG - Intergenic
1191650032 X:63527077-63527099 CCAGGGAAGCAGAGGGCAAGAGG - Intergenic
1193531790 X:82663478-82663500 CTCAGTGAGCAGAGGGATAACGG + Intergenic
1193741014 X:85216913-85216935 CTAGGTGAACAGGGGAAAAATGG + Intergenic
1195523000 X:105852101-105852123 TCAGGTGAGCAAACAGAAAATGG - Intronic
1195932056 X:110088254-110088276 CCAGATGAGCACTGGGAAAGGGG - Intronic
1195958205 X:110356856-110356878 GCAAGAGAGCAGAAGGAAAATGG + Intronic
1196038340 X:111172489-111172511 GCAGGAGAGGAGAGGGAGAAGGG - Intronic
1196050437 X:111298380-111298402 CCAGGTGAATGCAGGGAAAAGGG + Exonic
1196594047 X:117522532-117522554 CCAGGTGAGCTGGGGGAGACAGG - Intergenic
1196790570 X:119460621-119460643 CCAGGTGAGCTTATTGAAAATGG - Intergenic
1197858781 X:130947963-130947985 CCAGGAGAGGAGAGAGAAAGGGG + Intergenic
1198594806 X:138224523-138224545 CCAGGACAGGAGAGGGCAAAGGG + Intergenic
1199250082 X:145651309-145651331 CCAGGTTAGCAGTGTGGAAAGGG - Intergenic
1199356975 X:146874332-146874354 CCATGTAAGCAGAGGGAATATGG - Intergenic
1199772208 X:150982496-150982518 TCAGGAGAGCAGAGGGAATGAGG + Intronic
1200237183 X:154473295-154473317 CCAGGTGCTCAGAGAGAATAGGG - Exonic
1200795484 Y:7337598-7337620 CCAGGTGAGCAAAAGGAGATAGG + Intergenic
1201294378 Y:12451178-12451200 CCAGGTGATGAGAGGGAGACAGG - Intergenic
1201891057 Y:18944561-18944583 GAAGGTGAGGAGAGTGAAAAGGG - Intergenic