ID: 1092121575

View in Genome Browser
Species Human (GRCh38)
Location 12:6047932-6047954
Sequence CTATCTGCACAGAGGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092121572_1092121575 5 Left 1092121572 12:6047904-6047926 CCTAATGAATGTGTATAAGGATT 0: 1
1: 0
2: 2
3: 20
4: 270
Right 1092121575 12:6047932-6047954 CTATCTGCACAGAGGCAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092121575 Original CRISPR CTATCTGCACAGAGGCAGAA GGG Intronic
901256414 1:7831642-7831664 TTATCTCAACAGACGCAGAAAGG - Intronic
901771451 1:11532284-11532306 GTCTCTGCACGGAGGCAGCAGGG - Intronic
902987873 1:20166423-20166445 GGATCTTCACAGAGGCAGGAGGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903642106 1:24867312-24867334 ATGTCTGCACAGAGGCTGAGCGG + Intergenic
904089866 1:27937279-27937301 CTAACTGCAGAGAAGCAGACAGG + Intronic
904858233 1:33515996-33516018 CCATCTGCACAGCGGCAGCAAGG - Exonic
905150175 1:35921036-35921058 TTATCTGCACAGAGGAAGGATGG - Exonic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905501421 1:38441957-38441979 CTATGTGAACAGAGGCTAAAGGG - Intergenic
906237519 1:44220983-44221005 CTTTGTGCACAGAGGCAGTCTGG + Intergenic
909047154 1:70724351-70724373 CTATCTCAATAGATGCAGAAAGG - Intergenic
909318285 1:74251109-74251131 CTCTCTGCACAGAGGCATCATGG - Intronic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
910093904 1:83497947-83497969 TGAACTGCACAGTGGCAGAAAGG + Intergenic
910653567 1:89596943-89596965 CTATCTGGAAACAGACAGAATGG + Exonic
911719543 1:101175995-101176017 TTTGCTGCACACAGGCAGAATGG + Intergenic
911769312 1:101719154-101719176 TGAACTGCACAAAGGCAGAAGGG + Intergenic
911801749 1:102148110-102148132 CGTTCTTCACAGAGGCAGCAAGG - Intergenic
912245327 1:107956142-107956164 CTATGAGCACAGATGCAGGAAGG + Intronic
912698272 1:111857329-111857351 CCCTCTGCACAGAAGCAGAATGG - Intronic
913526583 1:119699535-119699557 CCATCAGCAGAGAAGCAGAAAGG - Intronic
913968051 1:143393107-143393129 CTATCTACACACAGCCTGAAGGG - Intergenic
914062432 1:144218697-144218719 CTATCTACACACAGCCTGAAGGG - Intergenic
914116718 1:144747657-144747679 CTATCTACACACAGCCTGAAGGG + Intergenic
915491097 1:156250440-156250462 CTAGCTGCTCAGAGGCTGCAGGG - Exonic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
916260454 1:162836726-162836748 CAATCTGAACAGAAGCAGAAAGG - Intronic
916279723 1:163036245-163036267 GTTTCTGCCCAGAGGCAGCATGG + Intergenic
916496001 1:165347418-165347440 CCCTCTGCATAGAAGCAGAAAGG - Intronic
917713998 1:177715313-177715335 TTATCTCAATAGAGGCAGAAAGG + Intergenic
919675644 1:200379997-200380019 ATATTTGCACAGAGGAAAAATGG + Intergenic
920224938 1:204431630-204431652 CTATCTGCACAGAGGGATGTCGG - Intronic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
920697226 1:208190244-208190266 CTCTCTGCACAAGGTCAGAAAGG - Intronic
921704337 1:218304425-218304447 CAAACTGTACAGAAGCAGAAGGG - Intronic
923448158 1:234091910-234091932 CTACCTGCTTGGAGGCAGAAGGG + Intronic
924000607 1:239547584-239547606 CCATCTGAACAAAGGCAGTATGG - Intronic
924862667 1:247941603-247941625 CTATTTGGACAGACGCCGAATGG + Intronic
1063365616 10:5488585-5488607 CAACCTGCCCAGGGGCAGAAGGG + Intergenic
1063956480 10:11272150-11272172 CTAGCAGCACAGAGGAAGACAGG - Intronic
1064102046 10:12472410-12472432 CTCCCTGCATAGAGGGAGAAGGG - Intronic
1069330027 10:67280645-67280667 CTATGTGCACACTGGGAGAATGG - Intronic
1070228611 10:74539546-74539568 CTATATGCACAGTCTCAGAAAGG - Intronic
1071074940 10:81738809-81738831 TTATCTCAACAGATGCAGAAAGG + Intergenic
1072574051 10:96684066-96684088 CTATCTCCTAAGTGGCAGAATGG - Intronic
1072735438 10:97875942-97875964 CAACCTTCACTGAGGCAGAATGG - Intronic
1073766258 10:106685950-106685972 CTAACTGCAAAGAGGCACAAAGG + Intronic
1074155599 10:110796195-110796217 TTATCTTCAGAGAAGCAGAATGG - Intronic
1074180587 10:111059506-111059528 ATATCTGCCCAGAGTCAGGAGGG + Intergenic
1075023855 10:118969570-118969592 CTCTTTGCACATGGGCAGAATGG + Intergenic
1075098447 10:119489343-119489365 CTGTGTGCACAGAGGCTTAAAGG - Intergenic
1075454758 10:122577914-122577936 GTATCTGCAGAGAAGCAGGAGGG - Intronic
1076646517 10:131958198-131958220 CTATCTCCACAGGGGCACGAGGG - Intronic
1077196772 11:1284955-1284977 CATCCTGCACAGATGCAGAAAGG - Intronic
1079605291 11:22357850-22357872 CAAACAGCACAGAGGAAGAATGG + Intronic
1080207990 11:29753311-29753333 CTATTTGTACACAGGCAGATAGG - Intergenic
1080690402 11:34552565-34552587 CATCCTGCACAGAAGCAGAAAGG + Intergenic
1081818538 11:45968218-45968240 TTCTCTGCACAGAGGCAAGAAGG + Intronic
1083848518 11:65351664-65351686 CTTCCTGCAGAGAGGCAAAATGG - Exonic
1085268520 11:75253574-75253596 TTATCTCAACAGATGCAGAAAGG - Intergenic
1086143401 11:83523984-83524006 CCTTTTGCACAGAGGAAGAAGGG - Intronic
1087347842 11:96993583-96993605 CTATCTGCAAGGAGGGAGAGAGG - Intergenic
1089753668 11:120670031-120670053 CTATGTCCACAGAGATAGAATGG - Intronic
1091064329 11:132494498-132494520 CAATCTGGAAAGAGGCAGGAAGG - Intronic
1092121575 12:6047932-6047954 CTATCTGCACAGAGGCAGAAGGG + Intronic
1099761498 12:86926129-86926151 CTATCTGGAGAGAGCCAGGACGG - Intergenic
1099905043 12:88761569-88761591 TTAACTGCTCATAGGCAGAAGGG - Intergenic
1100607829 12:96166198-96166220 CTATGTAACCAGAGGCAGAAAGG - Intergenic
1100784195 12:98062022-98062044 CTGTCTGCCCAGATGCAGAAAGG + Intergenic
1100804242 12:98264339-98264361 ATTTCTGCACAGAGGCAGATAGG + Intergenic
1101485603 12:105155458-105155480 CTATCTGAACAGTAGCAGAGGGG + Intronic
1101802449 12:108034146-108034168 CTAACTACTGAGAGGCAGAAAGG - Intergenic
1103018249 12:117512889-117512911 CTTGCTGCCCATAGGCAGAAGGG + Intronic
1107399292 13:40053416-40053438 CCAGCTACACAGAGGCAGAGTGG + Intergenic
1107738718 13:43425591-43425613 CTAGTTGCTCAGAGGCAGATGGG - Intronic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1111792058 13:92870264-92870286 CTCTGTGCAAGGAGGCAGAAAGG - Intronic
1111907073 13:94267475-94267497 CTTTCTGCCAAGAGTCAGAATGG + Intronic
1112578853 13:100661021-100661043 CTATCTGCAGAAACGCTGAAAGG + Intronic
1113308612 13:109106755-109106777 CTTTCTGCACAGAGCCACATCGG - Intronic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1114731535 14:24998012-24998034 ATATTTGCACAGATGCACAATGG - Intronic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1115941849 14:38618563-38618585 CTCTCTGCTCAGTCGCAGAATGG - Intergenic
1118798671 14:69168746-69168768 CTTTCTGTACAGAGGAAGGAAGG - Intergenic
1118914776 14:70093767-70093789 CTCTCTGAGCAGTGGCAGAATGG - Intronic
1120023249 14:79553630-79553652 GTATCTGCACAGAAGGAGGAAGG + Intronic
1122955645 14:105069659-105069681 TCATCAGCACAGAGGCAGAGTGG - Intergenic
1125449670 15:39795485-39795507 CTAACTCCATGGAGGCAGAAGGG - Intergenic
1125538104 15:40454360-40454382 TCATCTCCACAGAAGCAGAAAGG - Intronic
1126499869 15:49333880-49333902 TTATATGCATAGAGGAAGAAGGG + Intronic
1126664079 15:51060025-51060047 CTCTTAGCACTGAGGCAGAAGGG - Intronic
1127208491 15:56745801-56745823 CTATCTATAAAGAAGCAGAAGGG - Intronic
1129451277 15:75652552-75652574 CTCTCTGCCCAGGGTCAGAAAGG - Intronic
1130730931 15:86491415-86491437 CTCTCTGGATAGAGTCAGAAAGG - Intronic
1131362260 15:91803637-91803659 CTCTCTATACAGAGGAAGAAAGG - Intergenic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1135001929 16:18783978-18784000 CTATCTGCAGTGAGCCAAAAGGG + Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1137243980 16:46688199-46688221 CTATCTACACAGAGTGAGTAAGG + Intronic
1138606851 16:58095200-58095222 CTTTATGCCCACAGGCAGAAGGG + Intergenic
1139583749 16:67888021-67888043 CTATCAGTACTGAGGCAGAAGGG - Intronic
1140258046 16:73353633-73353655 CTCTCTGCAGAGGGGCAGGATGG - Intergenic
1141514480 16:84534724-84534746 CGATCTGGAAAGAGGCAGAGAGG + Intronic
1142548058 17:719325-719347 TTATCTGCAAAGAGGGAGAAGGG - Intronic
1147185914 17:38713022-38713044 CCCTCTGGACAGAGGCAGATGGG - Intronic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1148638759 17:49169291-49169313 ATATGGGCACAGAGGCAGAGTGG - Intronic
1149241230 17:54652147-54652169 CTCTCTCCACATATGCAGAAAGG - Intergenic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1151012260 17:70514396-70514418 CAATCTACACATAAGCAGAATGG + Intergenic
1151745695 17:76010540-76010562 CCTTCTGCAGAGAGGAAGAAGGG + Exonic
1153445430 18:5167241-5167263 CTAACTGCAGATAGGGAGAAGGG + Intronic
1155535124 18:26809075-26809097 ATGTATGCACAGAGGCTGAAGGG + Intergenic
1157251214 18:46097977-46097999 TCACCTGCGCAGAGGCAGAATGG - Intronic
1159562620 18:70011496-70011518 TTATCTCAACAGATGCAGAAAGG + Intronic
1160993658 19:1872007-1872029 TTATCTGCACAGAGTCGGGAGGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164538435 19:29104238-29104260 CTATCTTCTCAGTGGCAGCAGGG - Intergenic
1165705135 19:37970580-37970602 CCCTCTGCACAGAAGCTGAACGG - Intronic
1165748944 19:38248395-38248417 CCATCTGCACAGAGACAGCAAGG + Intronic
1202701840 1_KI270712v1_random:170575-170597 CTATCTACACACAGCCTGAAGGG - Intergenic
925625953 2:5842197-5842219 CCATCTGCACACATGCAGAGAGG + Intergenic
925651288 2:6092178-6092200 CTATTTGCCCAGAGTCAGGATGG - Intergenic
928427705 2:31192589-31192611 CTATCTCCACAGTGGAGGAAGGG + Intronic
929300587 2:40299704-40299726 CTATTTGGGCAGAGGCAGATGGG - Intronic
930788772 2:55301026-55301048 TTATCTTAAAAGAGGCAGAAGGG + Intronic
931087963 2:58854817-58854839 CTAGATTCCCAGAGGCAGAAGGG - Intergenic
932423679 2:71615749-71615771 CTATCTGCACTGGGGAAGGAGGG - Intronic
933398905 2:81766190-81766212 CCATCTTCACAGCTGCAGAATGG - Intergenic
933562004 2:83899363-83899385 CTATCTGCAAACAGGAAGGAGGG + Intergenic
934172750 2:89554022-89554044 CTATCTACACACAGCCTGAAGGG - Intergenic
934283064 2:91628374-91628396 CTATCTACACACAGCCTGAAGGG - Intergenic
935821055 2:106893035-106893057 TTATTTCCACACAGGCAGAAGGG + Intergenic
936573868 2:113637532-113637554 CCATCTGCAAAGGGTCAGAAGGG - Intronic
936827434 2:116599513-116599535 CTTTCTGCAATGAGGCAAAAGGG + Intergenic
937397562 2:121551125-121551147 TTATCTCAACAGATGCAGAAAGG + Intronic
937883491 2:126885375-126885397 CTATCTGGAGAGAGGGAGAGAGG - Intergenic
941007688 2:160264423-160264445 CTCTCTGCCCAGAAGCAAAAGGG - Intronic
944985885 2:205175969-205175991 GTATCTGCACAGAGACACACTGG + Intronic
946595539 2:221302016-221302038 CTATCTACAGGGAGGCATAATGG - Intergenic
948905003 2:240975604-240975626 ATATCTGAACAGGAGCAGAAGGG - Intronic
1169040681 20:2492775-2492797 TGATCTTCACAGAAGCAGAATGG - Exonic
1169219995 20:3816610-3816632 CTGTCTGCACAGAGCCTGATGGG + Intergenic
1169820631 20:9705873-9705895 CAAGCTCCTCAGAGGCAGAATGG - Intronic
1170573374 20:17645223-17645245 CTTCCTGCACAGGGGCAGCATGG + Intronic
1174590258 20:51639567-51639589 CTATGAACACAAAGGCAGAAGGG + Intronic
1175788318 20:61725716-61725738 CCATCTGCAGAGAGACACAAGGG + Intronic
1176682335 21:9825895-9825917 CTACCTGCAAAGAGGAAGAGAGG + Intergenic
1176682614 21:9827304-9827326 CTACCTGCAAAGAGGAAGAGAGG + Intergenic
1176683173 21:9830120-9830142 CTACCTGCAAAGAGGAAGAGAGG + Intergenic
1176683452 21:9831530-9831552 CTACCTGCAAAGAGGAAGAGAGG + Intergenic
1176684010 21:9834341-9834363 CTACCTGCAAAGAGGAAGAGAGG + Intergenic
1179293187 21:40036923-40036945 TTATCTGCATAGATGCAGAAAGG + Intronic
1182059761 22:27388524-27388546 CTCTCTGAACAGAGACAGGAAGG + Intergenic
1183100782 22:35582841-35582863 CTCTGTGCCCGGAGGCAGAATGG + Intergenic
1185392741 22:50571398-50571420 CGATCTGCACAAAGGCATCAGGG + Exonic
1185426309 22:50773361-50773383 CCATCTGCAAAGGGTCAGAAGGG + Intronic
949230340 3:1743495-1743517 TTATCAGCTCATAGGCAGAATGG - Intergenic
950898213 3:16472966-16472988 TCATCTGCACAGAGTCAGACAGG + Intronic
950923395 3:16717015-16717037 CAAGCTGTCCAGAGGCAGAAGGG - Intergenic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
952852668 3:37741718-37741740 CTCTCTGCACAGTGGCAACACGG + Exonic
956345911 3:68278603-68278625 CTATCTACCCAGGCGCAGAAGGG - Intronic
957871645 3:86096849-86096871 TTATCTCCATAGATGCAGAAAGG + Intergenic
964761622 3:160139919-160139941 AGCTCTGCACAGATGCAGAAAGG - Intergenic
967707429 3:192667730-192667752 GTATCTGCAGAATGGCAGAATGG + Intronic
968867014 4:3219564-3219586 CCATCTGCACAAAGGCAGAGGGG - Intronic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
971169901 4:24223149-24223171 CTATAGGCACAAAGACAGAAGGG + Intergenic
971328152 4:25661241-25661263 CTTTATGCTCAGAGGCATAAAGG + Intronic
971349702 4:25844906-25844928 CTATGTGCACACACACAGAAAGG + Intronic
971381605 4:26103653-26103675 CTCTCTGCACACAGTCACAACGG + Intergenic
971586074 4:28407205-28407227 CAATCTGCAAGGAGGCAGCAAGG + Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
977079702 4:92509461-92509483 CTAAATGCACTGAGGCAAAAAGG + Intronic
977259826 4:94785084-94785106 ATATCTCCACAGAGGCTAAATGG - Intronic
981120902 4:141050459-141050481 GATTCTGCACATAGGCAGAAGGG - Intronic
984542944 4:181063439-181063461 CTATTTGCACAGTAGCAGAACGG - Intergenic
985959804 5:3292924-3292946 CCAGCTACACAGAGGCTGAAGGG - Intergenic
986034471 5:3924798-3924820 CTATCTGCATAGAGCCATGACGG + Intergenic
986448581 5:7844910-7844932 CTAACTGTCCAGAGGCACAAAGG - Intronic
986540939 5:8843199-8843221 CTATCTGCACAGAGTGAACATGG + Intergenic
987313424 5:16701835-16701857 CTTCCTGGACAGAAGCAGAAGGG + Exonic
987351743 5:17028133-17028155 TTATCTTCATAGATGCAGAAAGG + Intergenic
988785689 5:34564013-34564035 CTAACCGCACAGAGACAGCAAGG - Intergenic
988953310 5:36287331-36287353 TTATTTTCTCAGAGGCAGAAAGG - Intronic
989437817 5:41435103-41435125 CTATGTGTACAAAGGCACAAAGG + Intronic
991001968 5:61791931-61791953 CTATCTGGACAGAGGGATAGGGG + Intergenic
992888358 5:81181559-81181581 TTATCTGCAGTGAGGCAAAATGG - Intronic
993442333 5:87972764-87972786 CTACCGGCTCATAGGCAGAAGGG - Intergenic
994282406 5:97921445-97921467 CTATCTTCACAGGGTGAGAAGGG - Intergenic
994767289 5:103934954-103934976 GTATCTGCAGTGAGGCAGGAGGG - Intergenic
995190942 5:109318796-109318818 TAACCAGCACAGAGGCAGAAAGG + Intergenic
996235908 5:121128680-121128702 TTATCTGCTCATAGGCAGACAGG + Intergenic
996687594 5:126301065-126301087 CAATCTGGAAAGAGGCAGACTGG + Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
998920093 5:147058664-147058686 CTATCTACCCACATGCAGAATGG + Intronic
1001117161 5:168949288-168949310 CTGTCTGCAAAGACGCTGAACGG - Intronic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1001923244 5:175617190-175617212 CTGGATGCACAGAGCCAGAAAGG + Intergenic
1002052348 5:176578148-176578170 ATCTCTGCAGAGAGGCAGAGAGG - Intronic
1002349300 5:178571726-178571748 CTTTCTGCACATAGGCAGTACGG - Intronic
1002643753 5:180642966-180642988 CTATCTGTACAGTGGCAATACGG - Intronic
1002808731 6:604642-604664 CTATCTGCACACAGCCACACTGG + Intronic
1002945214 6:1754785-1754807 TTATCTCAACAGATGCAGAAAGG + Intronic
1003273450 6:4627479-4627501 TTAACTGCAAAGAGGCACAAAGG - Intergenic
1003393495 6:5733131-5733153 CAATCTCCGCAGAGGCAGAAGGG - Intronic
1004287688 6:14337831-14337853 CTATCTCCACAGAGAAAGAATGG - Intergenic
1005133103 6:22534956-22534978 CTATCTGCATAATGGAAGAATGG - Intergenic
1005883725 6:30079034-30079056 CTATTTCCAGAGAGCCAGAAGGG + Intergenic
1007980427 6:46150110-46150132 CTATCTTAAGAGAGGCTGAAGGG + Intergenic
1013530171 6:111011889-111011911 GAATCTGGACAGAAGCAGAAAGG + Intronic
1013614361 6:111827904-111827926 CTAACTGCACAGAGGCAGGCAGG + Intronic
1014519643 6:122425766-122425788 ATCTCTTCACAGAGGAAGAATGG - Intronic
1015575410 6:134665991-134666013 CTATATTCCCAGAGACAGAAGGG - Intergenic
1016810502 6:148256697-148256719 TTGACTGCAAAGAGGCAGAAGGG + Intergenic
1018085005 6:160293913-160293935 ATTTCAGAACAGAGGCAGAAGGG + Intergenic
1018940962 6:168308648-168308670 CCATCTCCACAGAGGCAGGGTGG - Exonic
1020159440 7:5757736-5757758 CTAACTGCAAAGAGGCACAAGGG + Intronic
1021747420 7:23756724-23756746 CTATCTCAATAGATGCAGAAAGG - Intronic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1021874207 7:25033284-25033306 CTAACTGCAAAGAAGCAGGAGGG - Intergenic
1021913589 7:25409984-25410006 GAATCTGAACAGATGCAGAAGGG + Intergenic
1022432573 7:30340478-30340500 TTATCTCAACAGATGCAGAAAGG - Intronic
1023215504 7:37858609-37858631 ATAACAACACAGAGGCAGAATGG + Intronic
1023967026 7:44968044-44968066 CTATGGGAACAGAGGCAGATGGG - Intronic
1024373953 7:48617513-48617535 ACATCTGCCCAGAGGGAGAACGG + Intronic
1025022656 7:55492117-55492139 TTATCTGCACAAATGCACAATGG + Intronic
1025040872 7:55644483-55644505 CTTTTTGCAAAGAGGAAGAAAGG - Intergenic
1027012336 7:74756895-74756917 CTGCCTGCACAGTGGCACAATGG + Intronic
1029312583 7:99680667-99680689 CTATCACCACAGAGTCAGAGGGG - Intergenic
1032671440 7:134086412-134086434 CTTTATGCACAGAGCCTGAAAGG - Intergenic
1034268136 7:149791000-149791022 CTCCCTGCAGAGGGGCAGAAAGG - Intergenic
1035332028 7:158102628-158102650 ATATATGGAGAGAGGCAGAAGGG + Intronic
1038291136 8:26250934-26250956 TTGACTGCACAGAGGCACAAAGG + Intergenic
1040683697 8:49844357-49844379 CTCTCTGGAGAGAAGCAGAATGG - Intergenic
1042837498 8:73091829-73091851 CAAACAGCACAGAGGCAGGAGGG + Intronic
1044244358 8:89924762-89924784 TTCTCAGCAAAGAGGCAGAAGGG - Exonic
1045673111 8:104578834-104578856 TTATCTTGACAGATGCAGAAAGG + Intronic
1045905467 8:107339658-107339680 TCAGCTGCACAGAGGCAGGAAGG + Intronic
1046694487 8:117323896-117323918 CTAACAACACAAAGGCAGAAAGG + Intergenic
1047488817 8:125357357-125357379 TTCACTTCACAGAGGCAGAAAGG + Intronic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1048414904 8:134216242-134216264 CACTCTGCATAGAGGCAAAATGG - Intergenic
1048876813 8:138843134-138843156 CTATGTGCACAGTGGGAGAAAGG - Intronic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1049153560 8:141052760-141052782 GCGTCTGCACAGAGGCAGAATGG - Intergenic
1051503511 9:17803624-17803646 TTATCAGCCCAGAGGCAGCAGGG + Intergenic
1052846211 9:33338741-33338763 CTCTCTGCAAAGAGACAGACTGG + Intronic
1055354758 9:75426455-75426477 ATATCTGCAACTAGGCAGAAAGG + Intergenic
1055734812 9:79315308-79315330 TTATGGGCACAGAAGCAGAAGGG + Intergenic
1055770295 9:79709707-79709729 CAATGAGCACAGAGGCAAAAAGG - Intronic
1056149032 9:83765837-83765859 TTATAGGCTCAGAGGCAGAAGGG + Intronic
1057415345 9:94857162-94857184 GAATCTTCACAGAGACAGAAGGG - Intronic
1058052461 9:100420716-100420738 AAATCTGCAAAGAGGCAGACTGG + Intergenic
1058978180 9:110144292-110144314 CTAGCTTCACACAGCCAGAAGGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1061144795 9:128791361-128791383 GAATCTGCACAGAGGGAGAAGGG - Exonic
1061573326 9:131491071-131491093 CTTGCTGGACAAAGGCAGAAAGG + Intronic
1186144786 X:6614007-6614029 CCATCAGCAGAGAGACAGAAAGG - Intergenic
1186363965 X:8872496-8872518 CTTTGTGAAGAGAGGCAGAAGGG + Intergenic
1186694056 X:12010684-12010706 CTATCTGATTAGAGGCAGGATGG - Intergenic
1186791832 X:13007290-13007312 TCATCTGCACAGAGGGAGAATGG - Intergenic
1188161419 X:26808784-26808806 TTATCTCCATAGATGCAGAAAGG - Intergenic
1188968849 X:36588061-36588083 GCATCTTCACAGAGGCAGAGTGG - Intergenic
1190726559 X:53193995-53194017 GAATCTGGACAGATGCAGAATGG + Intronic
1191685773 X:63888771-63888793 TTATCTCAACAGATGCAGAAAGG + Intergenic
1192680524 X:73248767-73248789 TTATTGGCACATAGGCAGAAGGG + Intergenic
1195232569 X:102865445-102865467 CTTACAGGACAGAGGCAGAAGGG + Intergenic
1195761029 X:108246773-108246795 CTATCTACACAGGGACAGGAAGG + Intronic
1197857064 X:130925752-130925774 CTGACTGCACAGGGGCACAAGGG - Intergenic
1198085072 X:133274933-133274955 CACACTGCAGAGAGGCAGAAAGG + Intergenic
1198341656 X:135720063-135720085 CTGCCTGCGCAGAGGCAGAGGGG - Intronic
1198346342 X:135763298-135763320 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198348248 X:135780583-135780605 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198350150 X:135797846-135797868 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198352060 X:135815119-135815141 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198353968 X:135832387-135832409 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198355876 X:135849637-135849659 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198357787 X:135866916-135866938 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198359705 X:135884198-135884220 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198366559 X:135945976-135945998 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1199575957 X:149314058-149314080 ATTTCTGAACAGAGGAAGAATGG + Intergenic
1202099289 Y:21288778-21288800 TTACCAGCACATAGGCAGAAGGG + Intergenic