ID: 1092121949

View in Genome Browser
Species Human (GRCh38)
Location 12:6050546-6050568
Sequence GACTAAGACTGGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092121949_1092121954 9 Left 1092121949 12:6050546-6050568 CCAACTTCCCTCCAGTCTTAGTC 0: 1
1: 0
2: 1
3: 28
4: 268
Right 1092121954 12:6050578-6050600 ATAGCATGCGTTCATGCCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 40
1092121949_1092121957 22 Left 1092121949 12:6050546-6050568 CCAACTTCCCTCCAGTCTTAGTC 0: 1
1: 0
2: 1
3: 28
4: 268
Right 1092121957 12:6050591-6050613 ATGCCAGAGGACTTACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 106
1092121949_1092121959 29 Left 1092121949 12:6050546-6050568 CCAACTTCCCTCCAGTCTTAGTC 0: 1
1: 0
2: 1
3: 28
4: 268
Right 1092121959 12:6050598-6050620 AGGACTTACCTTGGGGATTGTGG 0: 1
1: 0
2: 0
3: 11
4: 165
1092121949_1092121956 21 Left 1092121949 12:6050546-6050568 CCAACTTCCCTCCAGTCTTAGTC 0: 1
1: 0
2: 1
3: 28
4: 268
Right 1092121956 12:6050590-6050612 CATGCCAGAGGACTTACCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 77
1092121949_1092121955 20 Left 1092121949 12:6050546-6050568 CCAACTTCCCTCCAGTCTTAGTC 0: 1
1: 0
2: 1
3: 28
4: 268
Right 1092121955 12:6050589-6050611 TCATGCCAGAGGACTTACCTTGG 0: 1
1: 0
2: 0
3: 19
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092121949 Original CRISPR GACTAAGACTGGAGGGAAGT TGG (reversed) Intronic
901432378 1:9224935-9224957 GACTGAGACTAGAGGGAAAGAGG - Intergenic
901460800 1:9390389-9390411 CACTCAGGCTGGAGGGCAGTGGG - Intergenic
902228032 1:15009075-15009097 AGCTAAGGCTGGAGGGAAGGGGG - Intronic
903394080 1:22985967-22985989 GAAAAAGATTGGAGGGAAGGAGG - Intergenic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
904434772 1:30487253-30487275 GACTAAGACAGGAGTGAAGATGG + Intergenic
909418897 1:75440299-75440321 GACAAAGACCTGAGGGAAGTTGG + Intronic
909662278 1:78097446-78097468 GGCTAAGTCTTTAGGGAAGTTGG - Intronic
913446652 1:118957368-118957390 GACCAGGACTGGAGTGAGGTGGG + Intronic
915147280 1:153802586-153802608 GACTCAGAGTGGAGGGAAGCTGG + Intergenic
915791026 1:158671532-158671554 GACTAAGGCAGGAGGGAACAAGG + Intronic
916242123 1:162650676-162650698 GACTAGCACAGGAGGGAAGAAGG - Intronic
916582095 1:166117983-166118005 GGTTCAGACTGGAGGGAAGGAGG + Intronic
916686946 1:167156144-167156166 GACTAAGACAGGAGTGAAACAGG - Intergenic
916867775 1:168878760-168878782 CACCTAGACTGGAGGGCAGTGGG - Intergenic
917262330 1:173183610-173183632 GGCTAAAACTGGAGGCAAGTAGG + Intergenic
917489949 1:175489505-175489527 GGCTAAGACTAGAGTGAAGAAGG + Intronic
918492279 1:185094050-185094072 GAGTAAGAATGAAGAGAAGTAGG - Intronic
918800557 1:188964987-188965009 GACTAATATAGGAGGGAATTAGG - Intergenic
919598226 1:199590912-199590934 GACCAAGAGTGGTGAGAAGTGGG + Intergenic
920532782 1:206716439-206716461 GCCTAAGACTGGAGACAACTGGG - Intronic
921774782 1:219084403-219084425 TAATATGACTGGAGTGAAGTGGG - Intergenic
922293058 1:224225097-224225119 GATTAAGAATGAAGGGAAGCCGG - Intergenic
924253949 1:242163437-242163459 AATTAAGACTTGAGGGAAGCTGG - Intronic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063499865 10:6543759-6543781 GACAAGGACTGGAGGAAACTGGG + Intronic
1064870121 10:19927948-19927970 GACTCAGAATGGAGGAAGGTAGG - Intronic
1065003522 10:21358836-21358858 CACTCAGGCTGGAGGGCAGTGGG + Intergenic
1066260520 10:33725218-33725240 GACTAAGACTGAAGGGACAAGGG - Intergenic
1066303504 10:34117421-34117443 CACACAGACTGGAGGGCAGTGGG + Intronic
1067337864 10:45379165-45379187 GACTAAGAGGGGAGGGAGATGGG - Intronic
1067485379 10:46644467-46644489 GACAAAGACTGGAAGTAAGAGGG + Intergenic
1067609379 10:47697196-47697218 GACAAAGACTGGAAGTAAGAGGG - Intergenic
1067726516 10:48774951-48774973 GACAAAGAGAGGAGGGAACTGGG + Intronic
1067973794 10:51001202-51001224 AACCCAGACTGGATGGAAGTGGG - Intronic
1070874250 10:79787472-79787494 GAATTAGACTGGAGAGAACTTGG + Intergenic
1070936534 10:80302481-80302503 GATTAAGAGTGGAGGAAAATCGG + Intergenic
1071089950 10:81906579-81906601 GACATAGAGTGGAGCGAAGTGGG + Intronic
1071624970 10:87158841-87158863 GACAAAGACTGGAAGTAAGAGGG - Intronic
1071641181 10:87309626-87309648 GAATTAGACTGGAGAGAACTTGG + Intergenic
1072853822 10:98925531-98925553 AACTAATACTGCAGTGAAGTGGG + Intronic
1073757263 10:106593893-106593915 GACTAAGACTCCTGGGAAGAAGG - Intronic
1074696931 10:116058224-116058246 TCCTAAGACTAGAGTGAAGTAGG - Intronic
1075448126 10:122527974-122527996 TGCTAAGACTGGAGGGAATTTGG + Intergenic
1075923808 10:126235012-126235034 GACTAGGACTGGATGGACATGGG + Intronic
1076420946 10:130331141-130331163 GACTATGACTGGAAGTGAGTGGG - Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1081411545 11:42764337-42764359 GACTAAGTAATGAGGGAAGTGGG + Intergenic
1081562055 11:44226714-44226736 GACGAAGCCTGAAGGGAAGAAGG + Intronic
1081665982 11:44917435-44917457 GAATAAGATTGGAGGGAAGGTGG - Intronic
1081761124 11:45577016-45577038 GACTAATTCTGCAAGGAAGTTGG - Intergenic
1084295187 11:68208780-68208802 GACTAAGGCTGCAGTGAACTGGG + Intronic
1084903561 11:72328536-72328558 GACTGAGACTGAAGAGATGTGGG - Intronic
1087231595 11:95672192-95672214 GAGCCAGACTGTAGGGAAGTAGG + Intergenic
1087546139 11:99586199-99586221 AGCTAAGACTGGATTGAAGTGGG - Intronic
1087611598 11:100440946-100440968 GGCTAAAAGTGGAGGAAAGTGGG + Intergenic
1088241169 11:107775150-107775172 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
1088269712 11:108021523-108021545 CACTCAGACTGGAGTGCAGTGGG + Intronic
1090199666 11:124845371-124845393 GAGTCAGACTGGTGGGAAGGTGG - Intergenic
1090267371 11:125361787-125361809 GAGGAAGTCTGAAGGGAAGTTGG + Intronic
1090342219 11:126034172-126034194 GACTGAGACTTGGGAGAAGTGGG - Intronic
1090420519 11:126572184-126572206 GACTAAGACTGAAGGCAATAAGG + Intronic
1091268409 11:134288465-134288487 GCCTAAGGCAGGAGGGAGGTGGG + Intronic
1091661281 12:2385602-2385624 AACTAAGAATGGAGGGAGGCAGG - Intronic
1091784597 12:3235531-3235553 GACAAGGACTCAAGGGAAGTGGG - Intronic
1092121949 12:6050546-6050568 GACTAAGACTGGAGGGAAGTTGG - Intronic
1096546360 12:52342830-52342852 GAAGAAGGCTGGAGGGAAGAGGG - Intergenic
1097933503 12:65217856-65217878 CACTCAGGCTGGAGTGAAGTAGG + Intronic
1098256943 12:68626492-68626514 GACTGAGACTGGGGGGAAAGAGG - Intronic
1098746785 12:74247528-74247550 GTCTAAGAATGGGGGAAAGTAGG - Intergenic
1099055638 12:77836362-77836384 GCCCAAGACTGGAAAGAAGTTGG - Intronic
1099338500 12:81396402-81396424 AACAAAGACTGGATGGAAGTGGG + Intronic
1099540959 12:83907217-83907239 GGCTAAGAAGGGTGGGAAGTGGG + Intergenic
1099724922 12:86413174-86413196 GAATAAGAATGGAGGGAAAATGG + Intronic
1100516155 12:95329813-95329835 CACCCAGACTGGAGGGCAGTGGG - Intergenic
1100576872 12:95899984-95900006 AACAGAGACTGGAAGGAAGTAGG + Intronic
1102015101 12:109643023-109643045 GACTAAGAATGGAGCAAAGATGG - Intergenic
1102696594 12:114804487-114804509 GCCTAGGGCTGGAGGGAAGAGGG - Intergenic
1102825589 12:115945503-115945525 GACTAATACAGAAGGGAAGAAGG + Intergenic
1102853121 12:116269614-116269636 CACTAAGGCTGGAGTGCAGTGGG - Intronic
1103512566 12:121485269-121485291 GACTAAGCCTGGTGGCAAATGGG + Intronic
1105444395 13:20440103-20440125 GCATGAAACTGGAGGGAAGTTGG - Intronic
1106124430 13:26888864-26888886 GACAAAGGCTGGAAGGAGGTGGG - Intergenic
1106322648 13:28656764-28656786 GACTAAGATTGGGAGAAAGTAGG - Intergenic
1106330515 13:28734990-28735012 GACTCATACTGGAGGGTATTTGG + Intergenic
1107842602 13:44474694-44474716 AAATAAGAATGGAGGGAAGAAGG + Intronic
1109174527 13:59138048-59138070 GACTCAGAATGAAGGGAAATAGG - Intergenic
1109645742 13:65252251-65252273 GACAAAGAAGGGAGGGAAGGAGG + Intergenic
1110326252 13:74219000-74219022 CACTCAGGCTGGAGGGCAGTGGG + Intergenic
1111790638 13:92850869-92850891 GACTAATACAGTAGGTAAGTAGG - Intronic
1111796504 13:92927333-92927355 CACCCAGACTGGAGTGAAGTGGG - Intergenic
1117295886 14:54378461-54378483 GACAAAGTCTGGAGGAAACTAGG - Intergenic
1118153473 14:63214709-63214731 GAGTCAGACTAGAGGCAAGTGGG + Intronic
1118991899 14:70804608-70804630 GCTTAAGACTGGAGGAAAGAAGG - Intronic
1122784220 14:104156495-104156517 GACTTAGGCTGGATGGAAGCTGG - Intronic
1124696147 15:31866302-31866324 GACTAGGACTGGGAGGGAGTGGG - Intronic
1124784039 15:32662635-32662657 GAGGAAGACTTGAGGCAAGTTGG + Intronic
1125121232 15:36161143-36161165 GAGAAAGACTGAAGGGAAGAAGG + Intergenic
1125225175 15:37388227-37388249 GACTAAGACTAGAGAGAACTAGG - Intergenic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128470415 15:67946772-67946794 GGCTAAGCCTAGAGGGAAGAGGG + Intergenic
1128752307 15:70158364-70158386 GACCAAGCCTGGAGGGGACTTGG - Intergenic
1130439310 15:83935034-83935056 GACTCAGACAGGTGGGAAGAGGG + Intronic
1130514217 15:84613645-84613667 GACTAAAATTGGAGGGGAGAGGG - Intronic
1130767970 15:86892195-86892217 GAATAAAACAGGAAGGAAGTGGG - Intronic
1131885773 15:96911282-96911304 GACCAAGATTGAAGGCAAGTAGG + Intergenic
1132287008 15:100670731-100670753 GATTAAGACTGGAAGGATGAGGG + Intergenic
1132304741 15:100802840-100802862 GCCTGTGACTGAAGGGAAGTGGG - Intergenic
1134857492 16:17532500-17532522 CACAAAGAGTGGAGGGAAGCTGG + Intergenic
1135923988 16:26676200-26676222 GACTAAGAGTAGAGGAAAGATGG + Intergenic
1135970698 16:27070121-27070143 GACTTTGTCTGGAGGAAAGTAGG - Intergenic
1136153303 16:28366022-28366044 GAAGAAGACTGGAGGAAAGCAGG + Intergenic
1136209783 16:28749245-28749267 GAAGAAGACTGGAGGAAAGCAGG - Intergenic
1137307255 16:47214733-47214755 GACTAAGACTGCAGAGTAATGGG + Intronic
1137991624 16:53162821-53162843 CACTCAGACTGGAGTGCAGTGGG + Intronic
1140338571 16:74135355-74135377 GACTAATACAGAAGGGAAGCTGG + Intergenic
1143850475 17:9807894-9807916 GGATAAGACTTGAGGGAGGTAGG + Intronic
1147763735 17:42818778-42818800 GCCGAAGACTGAAGGCAAGTCGG - Exonic
1148318118 17:46722291-46722313 GACTGAGGCTGGAGGTAAGAAGG - Intronic
1151039270 17:70839872-70839894 GACTAATACAGATGGGAAGTGGG - Intergenic
1151052700 17:70996446-70996468 GATTAAGAATGGAGATAAGTAGG - Intergenic
1152170838 17:78746901-78746923 CACGAAGACTGGAGTGCAGTGGG - Intronic
1153010010 18:529896-529918 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1154158834 18:11965060-11965082 CACACAGACTGGAGGGCAGTGGG - Intergenic
1155408316 18:25513965-25513987 GAGTAAGACTGGAAGGATCTTGG - Intergenic
1155442844 18:25880214-25880236 GACTACTAGTGGAGGGAAGGTGG + Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157899774 18:51503514-51503536 GACTAAGAGAAGAGGGTAGTGGG - Intergenic
1159304227 18:66618389-66618411 ATCAAAGACTGGAGGGAAGCTGG - Intergenic
1160298896 18:77660986-77661008 CACTAAGCCTGGAGTGCAGTGGG - Intergenic
1160918341 19:1508192-1508214 GACGAGGCCTGGAGGGAAGATGG + Intronic
1164529395 19:29036680-29036702 GACCATGACAGGAGGGAGGTCGG + Intergenic
1164815984 19:31203846-31203868 GGCTAATACAGGAGGGAAGAAGG - Intergenic
1164967027 19:32494183-32494205 TACTAAGATTGGAGGGAAGAAGG + Intergenic
1166089511 19:40499066-40499088 CACTCAGACTGGAGTGCAGTGGG + Intronic
1166565570 19:43763510-43763532 GACTTTGACAGGAGGGCAGTGGG + Intergenic
1167428129 19:49440107-49440129 GAATAAGGCTGGACAGAAGTGGG - Intronic
928215707 2:29359788-29359810 GACAGAGACAGGAGGGAAGCAGG - Intronic
930541065 2:52707253-52707275 TACAAAGACTGAAGGGAAGTTGG - Intergenic
930625055 2:53687652-53687674 AACTAAGTTTGGTGGGAAGTGGG - Intronic
930983436 2:57555660-57555682 GACTAAGGCAGATGGGAAGTGGG + Intergenic
931392935 2:61860246-61860268 GACTAAGACTGGACAGAGGATGG - Intergenic
932250061 2:70235452-70235474 GACAAAGACTCCAGGGAAATGGG + Intronic
933810999 2:86032584-86032606 GATGAAGACTGAAGGGAAGGAGG - Intronic
935723786 2:106004679-106004701 GAATTACACTGGAGGAAAGTTGG - Intergenic
936238549 2:110767451-110767473 GACAAAGTCTGCAGGCAAGTGGG + Intronic
936292852 2:111239732-111239754 GAGTTAGAGTGGAGGAAAGTGGG + Intergenic
936925371 2:117731208-117731230 GACTTAGCCTTTAGGGAAGTGGG - Intergenic
940169198 2:150808441-150808463 TTCTAAGAATGGAGGAAAGTGGG + Intergenic
941365009 2:164599685-164599707 CACTAAGTCTGGAAGGAAGGAGG + Intronic
942008525 2:171734559-171734581 CAGTAACACTGGAGGGATGTTGG - Intronic
942310850 2:174655301-174655323 TACTAAGAACGGAGGGAGGTGGG - Intronic
942516796 2:176762471-176762493 GGCTAAGACTTGAGAGAAGGTGG + Intergenic
942809597 2:179982183-179982205 GATTTAGACTGGGGGCAAGTCGG + Intronic
943837530 2:192532491-192532513 GACCAAGACGGGAGGTAAGGAGG - Intergenic
945305347 2:208254576-208254598 GACTAAGCCTGGAGTGTAGGAGG - Intronic
946770709 2:223085769-223085791 CACTCAGACTGGAGTGCAGTGGG + Intronic
947267331 2:228298137-228298159 GCCTAAGGCTGGAGTGGAGTCGG - Intergenic
948125066 2:235558541-235558563 GGCTACGACTGGAGGGTAGCGGG - Intronic
948347101 2:237307879-237307901 GATCAAGACTGGAGGCTAGTGGG - Intergenic
948672652 2:239578358-239578380 GACTAATACGGGAGAGAAGGAGG - Exonic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1169218604 20:3807614-3807636 GACTAAGATGGGAGGTAAGGGGG - Intergenic
1170106886 20:12761094-12761116 TAATAAGACTGGAGGGATGTAGG + Intergenic
1171037339 20:21726197-21726219 GACCAAGACAGGAAGGCAGTAGG - Intergenic
1172079801 20:32331223-32331245 GCCTAAAAGTGGAAGGAAGTCGG + Exonic
1172995273 20:39065745-39065767 GTCTCAGACTGGAGTGCAGTGGG + Intergenic
1173253614 20:41377429-41377451 GACCCAGGCTGGAGGGAAGAGGG + Intergenic
1173540170 20:43845101-43845123 GACTAAGGAGGGTGGGAAGTAGG - Intergenic
1174618456 20:51855122-51855144 GGTTAGGCCTGGAGGGAAGTGGG - Intergenic
1176369363 21:6053126-6053148 GACTAAGACAGTAGGGGAATGGG + Intergenic
1179754156 21:43485415-43485437 GACTAAGACAGTAGGGGAATGGG - Intergenic
1179936892 21:44611740-44611762 GGCAAAGACAGGAGGAAAGTGGG + Intronic
1180157628 21:45985811-45985833 CACCAACTCTGGAGGGAAGTGGG - Intronic
1180631875 22:17235442-17235464 GACTAAGACTGGAGGAAAAGAGG + Intergenic
1181090137 22:20466907-20466929 GAATGACACTGGAGGGAGGTGGG + Intronic
1181878789 22:25960772-25960794 GACCAAGACTGAAGGGAAAGTGG - Intronic
1182101614 22:27661723-27661745 CACTCAGACTGGAGTGCAGTGGG - Intergenic
1182439960 22:30357305-30357327 GACTAAGGGAGTAGGGAAGTGGG - Intronic
1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG + Intronic
1183444523 22:37844296-37844318 GACTCAGGGCGGAGGGAAGTAGG - Exonic
1183621290 22:38974359-38974381 CCCTAAGACTGCAGGGATGTAGG + Intronic
1184201658 22:42973725-42973747 GCCTAAGACTGGAGTGTAGCAGG - Intronic
1185401910 22:50623308-50623330 CCCTAAGACTGGGGGGAAGGGGG + Intronic
1185409400 22:50674333-50674355 GCCTGAGACGGGAGGGAAGCGGG - Intergenic
949096225 3:89078-89100 AAATAAGACTTGAGGGAAATTGG - Intergenic
950947124 3:16960603-16960625 GACTAAGAATGGGGTGAAGCAGG - Intronic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
953661561 3:44894738-44894760 GCCTAGGACAGGATGGAAGTAGG + Intronic
955579286 3:60401588-60401610 GACTAACAGTGGAGGGAAGCTGG - Intronic
957541811 3:81580694-81580716 GACTAAGGCTGGATGGAACAGGG + Intronic
957804330 3:85127500-85127522 GACTCAGCCTGGAGAGAAGGGGG + Intronic
958438088 3:94122322-94122344 GACTAAGACTGGAGGAAGAGAGG - Intronic
962319608 3:134379290-134379312 GAGTAATCCTGGAGGGAAGGAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
967516276 3:190372601-190372623 CACCAAGGCTGGAGGGTAGTAGG - Intronic
967864837 3:194181452-194181474 GAATAAGAGTGGATGGAAGCAGG + Intergenic
968342668 3:197970423-197970445 GACAAAGACTAGAGGAAATTAGG + Intronic
969118900 4:4892465-4892487 TACTGAGACTGGAGTGCAGTGGG + Intergenic
969948008 4:10804767-10804789 GAATAAGGGTGCAGGGAAGTGGG - Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
972136320 4:35899193-35899215 GACTAAGATTTGAGGGAGTTTGG - Intergenic
975331750 4:73123788-73123810 TGCTATGACTGGGGGGAAGTGGG + Intronic
976766619 4:88604453-88604475 GCCTAGGACTGGAGGGAAAGAGG - Intronic
977239412 4:94548728-94548750 TACTAAGCTTAGAGGGAAGTGGG - Intronic
978048671 4:104167489-104167511 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
978281026 4:107014478-107014500 GACTAAGAAAGGAGGGGAGCAGG + Intronic
979833529 4:125331061-125331083 AACGAAAACTGGAGGGAAGAAGG - Intronic
982310189 4:153976283-153976305 GAATGAGGCTGGAGAGAAGTTGG - Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986092386 5:4523165-4523187 GAGCAAGACTGGAGGAAGGTGGG + Intergenic
989383264 5:40830085-40830107 AACTAAGATGGGAGGGAAGTAGG + Exonic
993086915 5:83374512-83374534 GACTAATACAGTAGGCAAGTGGG + Intergenic
993756713 5:91740047-91740069 GACTAATACTGATGTGAAGTTGG + Intergenic
995339928 5:111047040-111047062 GCCTAAGACTAGAGAGAAGTAGG + Intergenic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001163152 5:169339213-169339235 GGCCAAGACTGGAGGGAACTTGG + Intergenic
1001394965 5:171411763-171411785 GACTAAGAATGGATAGAAGTGGG - Intergenic
1001538161 5:172514315-172514337 GACTAAGGCTGGCTGGAACTGGG - Intergenic
1002423168 5:179160720-179160742 GACTAAGACTTGTGGGACATTGG + Intronic
1003094588 6:3132333-3132355 GCCTGAGAGAGGAGGGAAGTCGG - Intronic
1004051259 6:12081872-12081894 GGGGAAGCCTGGAGGGAAGTGGG - Intronic
1004534805 6:16490285-16490307 GAAAAAGACTGAAGGGAAGTTGG - Intronic
1005010356 6:21330037-21330059 GACAAAGACTACAGGGAAGTTGG + Intergenic
1006524098 6:34589097-34589119 AACTAAGACTTGAGGGAAGGAGG + Exonic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1008822513 6:55650919-55650941 GACTCACACTTAAGGGAAGTAGG + Intergenic
1011411101 6:87067318-87067340 GACAAAGAGAGGAGGGAAATCGG + Intergenic
1011795939 6:90951349-90951371 GACTAAGAGTGGAGAGAGGTGGG - Intergenic
1013286628 6:108687491-108687513 GACTCAGACTGGAGGGAGTAAGG + Intergenic
1016380638 6:143475008-143475030 TACTCAAACTGGAGGGAAGCAGG + Intronic
1017209660 6:151841036-151841058 GAAGAAGACTGGAAGGAAGGAGG - Intronic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1019937797 7:4267759-4267781 TACTAAGAGTGGAGGGGAGACGG - Exonic
1020454900 7:8360805-8360827 AACTAAGACTGTGGGGATGTGGG - Intergenic
1021610495 7:22453065-22453087 GAGAAAGACTGCAGGGGAGTTGG - Intronic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1024447513 7:49498559-49498581 GACTCAGACTGGAGTACAGTAGG + Intergenic
1024715453 7:52074814-52074836 GCAGAAGACTGGAGGGAGGTGGG - Intergenic
1026149961 7:67779554-67779576 GACTCAGGCTGGAGTGCAGTGGG - Intergenic
1026625450 7:71987951-71987973 GACACAGACTGGAGAGCAGTGGG + Intronic
1026699403 7:72626732-72626754 GACTAGGGCTGGAGAGCAGTGGG - Intronic
1027385919 7:77659688-77659710 CACTCAGACTGGAGTGCAGTGGG + Intergenic
1029799840 7:102934876-102934898 GACAATGACAGGAGGGAAGGAGG + Intronic
1031762562 7:125733215-125733237 GTAAAAGACTGAAGGGAAGTGGG + Intergenic
1031882135 7:127209599-127209621 GACTAAGACTGGCGGGGAAAAGG + Intronic
1032105647 7:129026831-129026853 CACTCAGGCTGGAGGGCAGTGGG + Intronic
1033065516 7:138150114-138150136 GCCAAGGACTGGAGGGAAGAAGG + Intergenic
1034704438 7:153127818-153127840 GGGTAAGACTGGAGGGCAGGAGG + Intergenic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1037011591 8:13850268-13850290 GACCAAGACTGGAGGAATTTTGG - Intergenic
1037108899 8:15142583-15142605 GAATAAGACTGGATGGTAATTGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037823321 8:22146345-22146367 GACAAAGAATGGAGAGAACTTGG + Intergenic
1038303287 8:26375974-26375996 CACCCAGACTGGAGGGCAGTAGG + Intergenic
1039511896 8:38098597-38098619 GCCTGAGACTGGAGGAAAGAAGG - Intergenic
1039702871 8:39979393-39979415 CACTCAGGCTGGAGGGCAGTGGG + Intronic
1040845462 8:51833299-51833321 TACTATGACTGGAGGTAACTTGG - Intronic
1044208725 8:89523501-89523523 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1044928527 8:97230039-97230061 GAAAAAGACAGGAGGGAAGATGG + Intergenic
1045657096 8:104398667-104398689 GACAATGCCTGGAGGGCAGTTGG - Intronic
1045660746 8:104435226-104435248 GACAAAAACTGGACTGAAGTGGG + Intronic
1046762732 8:118038295-118038317 AACTAACACTGGAGGTAAATTGG + Intronic
1047756903 8:127926084-127926106 GACCATGACTGGAGGGAAGTGGG - Intergenic
1047861097 8:128967965-128967987 GACTAACATTGGAGGGAAGACGG + Intergenic
1047938719 8:129807009-129807031 GACTAATACAGGAAGGAAATTGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1052483946 9:29071229-29071251 CACTAAAACTGGAGTGTAGTTGG + Intergenic
1055364483 9:75528032-75528054 GCCTGAGACTGTAGGGAAGAAGG + Intergenic
1055710545 9:79056293-79056315 GGCTATGACTGCAGGGAAGCAGG + Intergenic
1056856219 9:90131897-90131919 GTCTGTGACTGGAGGGATGTGGG - Intergenic
1056945483 9:90991978-90992000 GACAAAGTCTGGAGGAAACTAGG + Intergenic
1057586752 9:96335319-96335341 GAGGAAGAATGGAGGGGAGTTGG + Intronic
1058934341 9:109754535-109754557 GACTAAGACAGATGGGAAGGAGG - Intronic
1059611244 9:115898863-115898885 GACTAATACAGGAGTGAAATGGG + Intergenic
1061026001 9:128050149-128050171 AACTAAGAGTGGAGGAAAGATGG + Intergenic
1061079194 9:128360214-128360236 GACAAACAGGGGAGGGAAGTGGG - Intronic
1061233531 9:129328703-129328725 GCCTCTGGCTGGAGGGAAGTGGG + Intergenic
1186204676 X:7188817-7188839 GACTAAGATTGCATGGATGTGGG - Intergenic
1187095400 X:16142760-16142782 GAATAAGGGTGGTGGGAAGTTGG - Intronic
1187450609 X:19392957-19392979 GACTAGGACTGGAGGAAGTTGGG + Intronic
1188344045 X:29042222-29042244 AACTAAGACTGAATGGAACTTGG + Intronic
1189009735 X:37035086-37035108 GACTCAGGCTGGAGTGTAGTGGG - Intergenic
1189013427 X:37070784-37070806 GACTCACACTTGAGGGCAGTGGG + Intergenic
1189038832 X:37520630-37520652 GACTCAGGCTGGAGTGTAGTGGG + Intronic
1189249952 X:39593110-39593132 GAGAAAGACTGAAGGGAGGTTGG - Intergenic
1190169500 X:48100742-48100764 GACTAATACAGGAGGGATATGGG - Intergenic
1190710477 X:53064719-53064741 GACAAAGAGAGAAGGGAAGTGGG + Intronic
1193211834 X:78816065-78816087 GACTAACACTTGTGGGAACTGGG + Intergenic
1194839765 X:98726158-98726180 GACTAACACTTCAGGGCAGTGGG + Intergenic
1195063494 X:101218926-101218948 GACAAAGACTGGTTGGGAGTGGG - Intergenic
1195277724 X:103298794-103298816 GATTAAGTCTGGTGGGAATTGGG - Intergenic
1195882089 X:109603194-109603216 GACTAAGAGTGGAGAGACTTGGG - Intergenic
1197470029 X:126855881-126855903 GACTAACCCTTCAGGGAAGTGGG - Intergenic
1197677634 X:129347300-129347322 GACTCACACTTGAGGGCAGTGGG - Intergenic
1197751384 X:129966174-129966196 GACAGAGAATGGAGGGAAGTTGG - Intergenic