ID: 1092122875

View in Genome Browser
Species Human (GRCh38)
Location 12:6056898-6056920
Sequence AGCTATGCCGCGGCCTGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092122875_1092122883 5 Left 1092122875 12:6056898-6056920 CCCGCGCAGGCCGCGGCATAGCT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1092122883 12:6056926-6056948 GGGCGCCGCACAGGCACTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 80
1092122875_1092122881 -4 Left 1092122875 12:6056898-6056920 CCCGCGCAGGCCGCGGCATAGCT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1092122881 12:6056917-6056939 AGCTGGCCAGGGCGCCGCACAGG 0: 1
1: 0
2: 0
3: 20
4: 145
1092122875_1092122885 18 Left 1092122875 12:6056898-6056920 CCCGCGCAGGCCGCGGCATAGCT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1092122885 12:6056939-6056961 GCACTCGCGGCCGTCCGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092122875 Original CRISPR AGCTATGCCGCGGCCTGCGC GGG (reversed) Exonic
900344204 1:2203387-2203409 AGCTGTGCCCAGGCCTGGGCAGG - Intronic
902380592 1:16050572-16050594 AGCTAGGAAGCGGCCGGCGCTGG - Exonic
923055933 1:230426021-230426043 CGCTGTGCTGCGGGCTGCGCTGG - Intergenic
924511270 1:244730729-244730751 GGCTGTTCCGCGGCCCGCGCAGG - Intergenic
1064961783 10:20973358-20973380 AGCTATGCCGGGGGCTGAGGTGG - Intronic
1065345358 10:24742972-24742994 AGCTATGCAGCTGCATGAGCCGG + Intergenic
1070850259 10:79557467-79557489 AGCAATGCGGCCGCCTGCTCTGG + Exonic
1070854494 10:79595539-79595561 AGCAATGCAGCTGCCTGCTCTGG + Intergenic
1070856966 10:79613833-79613855 AGCAATGCGGCCGCCTGCTCTGG - Exonic
1077404762 11:2377952-2377974 AGCTAAGGAGGGGCCTGCGCGGG + Intronic
1077495921 11:2886354-2886376 AGCTCGGCCCTGGCCTGCGCCGG + Intergenic
1086431044 11:86737361-86737383 AACTATGCCAGGGCCTGGGCTGG - Intergenic
1089709183 11:120302637-120302659 AGCAATGCTGGGGCCTGTGCAGG - Intronic
1092122875 12:6056898-6056920 AGCTATGCCGCGGCCTGCGCGGG - Exonic
1102465787 12:113130179-113130201 AGCTGTCCCTCGGCCTGCGGGGG + Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1125409961 15:39395804-39395826 TGCTATGCCGTGGCCAGTGCTGG - Intergenic
1130053555 15:80503747-80503769 AGCTCTGGCGCAGCCTGTGCAGG - Intronic
1142690839 17:1605442-1605464 AGCAATGCCATGGCCTGCCCTGG - Intronic
1147148083 17:38497830-38497852 AGTGATGCCGCGGGCTGGGCTGG + Intronic
1151310580 17:73290295-73290317 AGCAATGCCGCCGCCAGAGCTGG - Intronic
1152824808 17:82458309-82458331 AGCCCGGCCGCGGCCTCCGCGGG + Intronic
1157962020 18:52165195-52165217 ACCTATGCTTCAGCCTGCGCTGG + Intergenic
1160025044 18:75209571-75209593 AGCTGCGCGGCGGCCGGCGCAGG + Intergenic
1160456451 18:79005769-79005791 GGCTGTGCTGTGGCCTGCGCCGG + Intergenic
1160833318 19:1113271-1113293 ATCTAAGCAGAGGCCTGCGCAGG + Intronic
1161069627 19:2253609-2253631 AGCTGTGCCGCGGTGAGCGCAGG - Exonic
1161581361 19:5082762-5082784 AGTTATCCCTCGGCCTGCGTGGG + Intronic
1163308371 19:16496621-16496643 AGCTATGAAGCGACCCGCGCAGG - Intronic
1165420113 19:35718233-35718255 GGCTCCGCCGGGGCCTGCGCCGG + Exonic
1166621433 19:44304861-44304883 AGAGAAGCCGCGGCCAGCGCTGG - Intronic
1168294125 19:55370405-55370427 AGCTGGGCCGCGGCCTGGGGAGG + Intronic
925147230 2:1589225-1589247 AGCTCTGCCCAGGTCTGCGCAGG - Intergenic
925928203 2:8685443-8685465 GGCTCTGCCGGGGCCAGCGCGGG + Intergenic
927949627 2:27158881-27158903 AGCTCAGCCCCGGCCTGGGCCGG - Intergenic
937779941 2:125825700-125825722 AGCAATGCCTCGCCCTGCGTTGG - Intergenic
948059395 2:235032157-235032179 AGCTACTCCGAGGACTGCGCCGG - Intronic
1169274088 20:4221491-4221513 AGCTAGGCCGCGGAGTGTGCTGG - Exonic
1172437822 20:34942457-34942479 AGGTATGCCGGGGGCTGCCCAGG + Intronic
1173362803 20:42359775-42359797 GGCTGTGCCGGGGCCTGCCCGGG + Intronic
1175925379 20:62468809-62468831 AGCTCTGCTGGGGCCTGGGCTGG - Intronic
1176207207 20:63895480-63895502 TGCGACGCCGCGGCCTGGGCCGG + Intronic
1183058012 22:35318862-35318884 AGCTCTCCCGCGGCCAGTGCAGG + Intronic
985834045 5:2257646-2257668 AGCCACGCCGCTGCCTGTGCAGG - Intergenic
996558465 5:124802903-124802925 AGCTCTGCCGCCGCCTCCACTGG - Intergenic
1002918197 6:1545925-1545947 AGCTCTGCTGCTGCCTGCCCTGG - Intergenic
1003569952 6:7249138-7249160 AGCCTTACCGCAGCCTGCGCGGG + Exonic
1012045490 6:94267230-94267252 AGCTATGCTGTTCCCTGCGCAGG - Intergenic
1015541426 6:134317820-134317842 TGCTCTTCCGCGGCCGGCGCGGG + Exonic
1017719764 6:157236264-157236286 AGCTCTGCCGCGGACTCCGCAGG + Intergenic
1018163960 6:161076305-161076327 AGCTATACCGCAGCCTTCTCTGG + Intronic
1024345654 7:48310604-48310626 AGCTCTGCCAGGGCCTGCCCTGG + Intronic
1026899564 7:74029397-74029419 TGCTATGCCGCGGCCAACGGGGG + Intronic
1037407006 8:18553571-18553593 TGCTATGAAGCGGCCTGCTCAGG + Intronic
1044973873 8:97644714-97644736 GGCTGGGCCGCGGCTTGCGCCGG + Exonic
1052883822 9:33624090-33624112 AGCTCTGCCTCGGCCTGCCTGGG - Intergenic
1193019878 X:76780407-76780429 TGCTATTCTGCAGCCTGCGCTGG - Intergenic