ID: 1092125734

View in Genome Browser
Species Human (GRCh38)
Location 12:6073915-6073937
Sequence GATGGAAGATGTTCATCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092125734_1092125745 16 Left 1092125734 12:6073915-6073937 CCCTTAGATGAACATCTTCCATC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1092125745 12:6073954-6073976 AAGACCCATCGGGGGCACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 74
1092125734_1092125740 7 Left 1092125734 12:6073915-6073937 CCCTTAGATGAACATCTTCCATC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1092125740 12:6073945-6073967 GCCCTTACCAAGACCCATCGGGG 0: 1
1: 0
2: 1
3: 0
4: 33
1092125734_1092125742 8 Left 1092125734 12:6073915-6073937 CCCTTAGATGAACATCTTCCATC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1092125742 12:6073946-6073968 CCCTTACCAAGACCCATCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1092125734_1092125739 6 Left 1092125734 12:6073915-6073937 CCCTTAGATGAACATCTTCCATC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1092125739 12:6073944-6073966 GGCCCTTACCAAGACCCATCGGG 0: 1
1: 0
2: 0
3: 4
4: 101
1092125734_1092125738 5 Left 1092125734 12:6073915-6073937 CCCTTAGATGAACATCTTCCATC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1092125738 12:6073943-6073965 AGGCCCTTACCAAGACCCATCGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092125734 Original CRISPR GATGGAAGATGTTCATCTAA GGG (reversed) Intronic
902564190 1:17299727-17299749 GATGGGAGATGTTGGTCAAAAGG + Intergenic
908798725 1:67856918-67856940 GATAGCAGATTTTCATCTAAAGG - Intergenic
909093340 1:71254950-71254972 GATGGAAGATGAAGATTTAAGGG - Intergenic
910810649 1:91232280-91232302 GAAGAAAGATTTTCATCAAAAGG + Intergenic
912025002 1:105159174-105159196 GATGGAAGATGTTTAAGTCATGG - Intergenic
915179540 1:154046336-154046358 GATTGAAGTTGTTCAGCTAAGGG - Exonic
916977758 1:170099797-170099819 GATGGAATATCTTCACATAAAGG - Intergenic
917222265 1:172744359-172744381 AAGGGAAGATGTTGATCAAAGGG + Intergenic
917302381 1:173589916-173589938 GATGGAAAATCTACAACTAATGG + Intronic
917708361 1:177657792-177657814 GATGGAAGATGGTAATAGAAGGG - Intergenic
917976068 1:180239265-180239287 GAAGGAAGATGGTTTTCTAAAGG - Intronic
918747161 1:188218310-188218332 GATGGCAGATGCTCATGTACTGG + Intergenic
919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG + Intronic
921061303 1:211587147-211587169 GATGGAAGAGATAAATCTAATGG + Intergenic
922713705 1:227853765-227853787 CATGGTAGAAGTTCATGTAAAGG - Intergenic
924185698 1:241487337-241487359 TATGTAAGATGTTCATATAAGGG + Intergenic
1065756547 10:28936018-28936040 GAAGGAAGATCATCATCAAATGG + Intergenic
1069063041 10:63913920-63913942 CATGGGAGATGTTGATCAAAGGG + Intergenic
1069630885 10:69896449-69896471 GATGGAAGATGAGCATCTTTAGG + Intronic
1070283186 10:75065072-75065094 GATGGAACATGTAGATCTGAGGG - Intergenic
1072997424 10:100257778-100257800 GATGGTATATCTTCATCTAGGGG - Intronic
1075264930 10:120991975-120991997 GCTAGAAGTTGTTCATCGAAGGG - Intergenic
1075889643 10:125936009-125936031 GATGGTAGATTTTCAACTACAGG + Intronic
1080000978 11:27349698-27349720 GAGTGAAGATGTTCATTGAATGG - Intronic
1080133409 11:28823734-28823756 GATGCAGGAAGATCATCTAAGGG - Intergenic
1084436719 11:69146723-69146745 GATAGATTATGTTCATCTAGAGG + Intergenic
1087278061 11:96180187-96180209 GATGGATGGTGTTTTTCTAAAGG + Intronic
1087282304 11:96225353-96225375 GATGGAAGATCTGCTTCCAAAGG - Intronic
1088210917 11:107455036-107455058 AAGGGAAGATGTTGATCAAAGGG + Intronic
1089675753 11:120087947-120087969 GATGCAAGATGTTCATCCCGAGG - Intergenic
1089864505 11:121619978-121620000 GATGGAAGGGGATCCTCTAATGG + Intronic
1090110519 11:123903031-123903053 GATGGAAGATTTTTTTTTAATGG + Intergenic
1092125734 12:6073915-6073937 GATGGAAGATGTTCATCTAAGGG - Intronic
1093073267 12:14729504-14729526 GATGGGAGATGCCCATCAAAGGG - Intergenic
1093186567 12:16026864-16026886 CATTAAAGATGTTCATCTATAGG - Intronic
1094174937 12:27531641-27531663 CATGGAAGATCTTCAACAAATGG + Intronic
1097789966 12:63804794-63804816 AAAGGAAGATGTTGATCGAAGGG - Intronic
1098543381 12:71684656-71684678 AAGGGAAAATATTCATCTAAAGG + Intronic
1100342207 12:93690120-93690142 GATTGAAGATGACCATCTGATGG - Intronic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1106611016 13:31280582-31280604 GATGGAACATGTTCTGCTCAAGG + Intronic
1110253834 13:73409914-73409936 GAGGGATGATGTTAGTCTAAAGG + Intergenic
1111137722 13:84070828-84070850 GATTAAAGATATTCATTTAACGG - Intergenic
1113220885 13:108100634-108100656 TATGGGATATTTTCATCTAATGG - Intergenic
1113696006 13:112346033-112346055 GATGGAAGGTGTTCAGCAGAGGG + Intergenic
1115809385 14:37089864-37089886 GATGGAAGATGTCACTTTAAAGG - Intronic
1116344015 14:43766281-43766303 TAGGGGAGATGTTCATCAAAAGG - Intergenic
1117943684 14:60995458-60995480 ATGGGAAGATGTTCATCAAAGGG + Intronic
1118999589 14:70870263-70870285 GCTGGAAGTTGTTCATGGAAAGG + Intergenic
1119990861 14:79195682-79195704 GATGCAACATTTTCACCTAAAGG - Intronic
1120367815 14:83592635-83592657 GATGGCAGATGTTGATCAAAGGG - Intergenic
1124198421 15:27655323-27655345 AAAGGAAGATGTTGATCAAAGGG + Intergenic
1126963160 15:54021310-54021332 AAGGGAAGATGTTGATCAAAGGG - Intronic
1127524110 15:59775168-59775190 TATGGAAGCTGATCCTCTAATGG + Intergenic
1135619002 16:23937075-23937097 GTTGAAAAATGTACATCTAATGG + Intronic
1136452921 16:30364476-30364498 TATGCAAGATGATCATCTTAGGG - Intronic
1139021077 16:62750283-62750305 GATGGAAGATGCTCATGGAGTGG - Intergenic
1143626715 17:8114448-8114470 GATGTAAGATGTTCATTAGAGGG + Intronic
1143916762 17:10299578-10299600 GTGGGAAGATGTTTATCAAAGGG - Intronic
1153141599 18:1978939-1978961 GATGGGAGATGTTGGTCAAAGGG - Intergenic
1153459047 18:5313530-5313552 GATGGAATATGATCATATCAAGG - Intergenic
1153695927 18:7641697-7641719 AATGGAAGACTTTCATCTATAGG + Intronic
1154299240 18:13178452-13178474 AATGGAAGATGTGCCTCTGAGGG - Intergenic
1157096391 18:44689142-44689164 GATGGAAGATGTAGAACAAAGGG + Intronic
1157270966 18:46275895-46275917 GATGGAAGGTGTACAGCTCAGGG + Intergenic
1160371447 18:78375470-78375492 CATGCAAGATTTTCAGCTAATGG - Intergenic
1164610891 19:29630982-29631004 GAAGGAGGCTGTTCCTCTAAAGG + Intergenic
1167979669 19:53263130-53263152 GCTGGGAGATGTTCATCAATTGG - Intergenic
927380543 2:22475166-22475188 GATGGAAGATGTTCGAATTATGG + Intergenic
933252290 2:80042537-80042559 GATGGCAAATCTTCATCTAAAGG + Intronic
933582836 2:84146884-84146906 GATAGAATATGTTGATCTATTGG - Intergenic
933935145 2:87197686-87197708 GGTGAAAAATGTTCATATAAAGG + Intergenic
936358000 2:111768212-111768234 GATGAAAAATGTTCATATAAAGG - Exonic
937625404 2:124037692-124037714 GATGGGAGATGTTGGTCAAAGGG + Intronic
938454340 2:131448535-131448557 GATGAAAGAAATTCATCAAAGGG - Intergenic
942270150 2:174266333-174266355 GATGGAAGATATTTATCATAAGG + Intergenic
944884449 2:204048366-204048388 TATCCAAGATGTTCATCTAGTGG - Intergenic
946337371 2:219047159-219047181 GATGTAAGATGTTAATGTAAGGG - Intergenic
1169635125 20:7681879-7681901 GAAGGCAAATGTTCATCAAAAGG + Intergenic
1169821718 20:9718598-9718620 GTTGGAAGGTTTTAATCTAATGG - Intronic
1170058214 20:12230597-12230619 GATGGAAGAGGTTTATCTGATGG - Intergenic
1170197224 20:13701901-13701923 GGGGGTAGATGTTCATCAAATGG + Intergenic
1171007922 20:21485920-21485942 GATGAAAGATATTAATCTACAGG + Intergenic
1173329181 20:42060117-42060139 GATGGAGTACATTCATCTAAAGG + Intergenic
1173368090 20:42406728-42406750 GATGGAAAATGTTAAACAAATGG + Intronic
1177278807 21:18951670-18951692 GAATGAAGAACTTCATCTAAAGG - Intergenic
1179394064 21:41021942-41021964 GAAGGAATATGCTCATCTGAGGG + Intergenic
1182163653 22:28149761-28149783 GAAGGGAGATGTTCATCAAAGGG + Intronic
1182846955 22:33439255-33439277 CATGGGAGATGCTCAACTAAAGG + Intronic
1182944773 22:34311591-34311613 AAGGGAAGATGTTCATTAAAGGG + Intergenic
950200656 3:11040775-11040797 GATTAAAGAGGTTCTTCTAAGGG - Intergenic
953252798 3:41261967-41261989 CATGGAAGATGTTCCTCATAGGG - Intronic
959347008 3:105208402-105208424 GATGGTAGATGTGCCTATAAAGG - Intergenic
962647247 3:137452628-137452650 TATGTAAGATGTTCATTTTAAGG - Intergenic
965890084 3:173501791-173501813 GATAGAAGATTTTTATCAAAAGG + Intronic
969933213 4:10653966-10653988 GAGGGAAGATTTTCAGCTATTGG - Intronic
971153338 4:24057310-24057332 GATGGAACATTTTTATTTAATGG + Intergenic
971592524 4:28486372-28486394 ATGGGAAGATGTTCATCAAAGGG - Intergenic
972692469 4:41412838-41412860 AAGGGAAGATGTTCATCTAGGGG + Intronic
974208559 4:58740086-58740108 GATTGATGATCTTCATGTAACGG - Intergenic
974704033 4:65488322-65488344 GCTGGAAAATGTACTTCTAAAGG + Intronic
975098276 4:70482391-70482413 AATGGAAGATAATTATCTAAAGG - Exonic
975542624 4:75530534-75530556 GATGGATTATGTTAATCCAATGG - Intronic
977508015 4:97926482-97926504 GGTGGAGCATGTTCTTCTAATGG - Intronic
978008011 4:103641982-103642004 AATGGGAGATGTTGATCAAAGGG + Intronic
979059432 4:116038290-116038312 GATTGAAGATTTTAAGCTAAGGG + Intergenic
979410010 4:120365954-120365976 GATGGAATAAGTTAATGTAACGG - Intergenic
981272859 4:142865059-142865081 GATGGTGGATATTTATCTAATGG - Intergenic
983399618 4:167246290-167246312 CATGGAAGATGTGCTTCTCAGGG - Intergenic
984374912 4:178917338-178917360 GATGGAAGTGGTTTATATAAAGG - Intergenic
985310392 4:188591415-188591437 GATGAAATAAGGTCATCTAAAGG - Intergenic
985554564 5:551565-551587 GCTGGAAGATTTTCATCAAGAGG + Intergenic
988260345 5:28878590-28878612 GATACTAGATGTGCATCTAATGG + Intergenic
989359316 5:40582134-40582156 AAGGGAAGATGTTGATCAAAGGG + Intergenic
989563882 5:42881598-42881620 GAGGGAAGATGTTGGTCAAAGGG - Intronic
990440348 5:55838691-55838713 AATGGAAGCTGTGCATCTATAGG - Intergenic
991528133 5:67586176-67586198 AATGCAAGATGTTCATAAAAAGG + Intergenic
992764207 5:79980613-79980635 CATGGAAGATCTTCATCTTATGG + Exonic
994340553 5:98622483-98622505 TAAGGAGGATGTCCATCTAAGGG - Intergenic
994509937 5:100689663-100689685 AATGGAAAATGTTCAACTAATGG + Intergenic
994594636 5:101816872-101816894 GATGAAAAATGTCCATCTAAGGG - Intergenic
995645261 5:114304549-114304571 GCTGGAAGCTGTTTATCAAATGG + Intergenic
996656316 5:125941027-125941049 GATGGGAGATGTTGATATAGGGG + Intergenic
997026754 5:130073010-130073032 AAGGGAAGATGTTGATCAAAGGG + Intronic
997049778 5:130365981-130366003 AAGGGAAGATGTTGATCAAAGGG - Intergenic
997667886 5:135646828-135646850 ATGGGAAGATGTTGATCTAAGGG + Intergenic
998672912 5:144374001-144374023 GAGGCAAGAGGTTCATATAAGGG - Intronic
1004155350 6:13162499-13162521 GATGGAAAATGTTTAACTAAAGG + Intronic
1004913254 6:20307197-20307219 GATGGGAAATGTACATCCAATGG + Intergenic
1011064599 6:83311569-83311591 TGTGGAATATGTTCATCTTATGG - Intronic
1012256818 6:97042763-97042785 AATGGGAGATGTTGATCAAAGGG - Intronic
1012292488 6:97474748-97474770 TATGGAAGATGTTAATATTAGGG - Intergenic
1012379039 6:98598304-98598326 GATGGAAGATGTTGATAATAAGG + Intergenic
1012453091 6:99374402-99374424 GATGTGAGATGTTAACCTAAGGG + Intronic
1014893929 6:126876921-126876943 AATGGAAGATGTTGGTCAAATGG - Intergenic
1016475008 6:144418051-144418073 GATGACAGATGTTCATTAAATGG - Intronic
1018363952 6:163099607-163099629 CATGGAAGATTTGCATATAAAGG - Intronic
1019639072 7:2093398-2093420 CATGGAACATGTTTTTCTAATGG - Intronic
1020615138 7:10449979-10450001 ATGGGAAGATGTTCATCAAAAGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020925998 7:14325361-14325383 GATGGTAGATGTGCAACTGAAGG + Intronic
1021294067 7:18882011-18882033 GATGAAAGAGGTTAATCTGATGG - Intronic
1022394661 7:29975994-29976016 GATGGAAGTTGTAAATGTAAAGG + Intronic
1022880999 7:34587264-34587286 GATGTAAGCTGTTGATCTGAAGG - Intergenic
1022947412 7:35301185-35301207 AAGGGGAGATGTTCATATAAAGG - Intergenic
1023137350 7:37065551-37065573 CATGGAAGACCTTCATTTAAGGG - Intronic
1023272289 7:38477162-38477184 AAGGGAAGATATTTATCTAATGG - Intronic
1023626794 7:42123131-42123153 AGTGGAAGATGTTAATTTAAGGG - Intronic
1024054522 7:45651394-45651416 GATGGAATATGTTTATCAACAGG + Intronic
1028422212 7:90646182-90646204 GCAGGAGGATGTTCATCTTATGG + Intronic
1030846144 7:114414420-114414442 AATGGAAAATTTTCAGCTAATGG - Intronic
1032576974 7:133065033-133065055 GATGCAAGATGTTAATGAAAAGG + Intronic
1032580683 7:133100455-133100477 AATGGGAGATGTTCGTCAAAGGG + Intergenic
1033787354 7:144749277-144749299 GATGGAAAATGTGTATCTATAGG - Intronic
1035675423 8:1452466-1452488 CATGGAATATGGTCATCTCAGGG + Intergenic
1039143558 8:34420272-34420294 GCTGGAAGATGAACATCAAAAGG - Intergenic
1039669841 8:39583797-39583819 AAGGGAAAATGTTGATCTAAAGG - Intergenic
1041306131 8:56463182-56463204 GATGGAACATCATCATTTAAGGG - Intergenic
1041875861 8:62686198-62686220 GATGCAAGATGGTCTGCTAAAGG - Intronic
1043321055 8:78987479-78987501 CATTGGAGATGTTCATCAAAGGG - Intergenic
1045941595 8:107745283-107745305 GACTGAAGATGTCTATCTAATGG - Intergenic
1046419712 8:113964346-113964368 AAGGGAAGATGTTGATCAAAGGG - Intergenic
1050256709 9:3800126-3800148 GTTGGAAAATATTCATATAAAGG - Intergenic
1051007502 9:12364825-12364847 AAGGGAAGATGTTGATCGAAAGG - Intergenic
1051019989 9:12532260-12532282 GAGGCAAGATGCTAATCTAATGG - Intergenic
1051875874 9:21792833-21792855 AAGGGAAGATGTTGATCAAAGGG + Intergenic
1057721992 9:97539593-97539615 AATGGCATATGTTCATCTATGGG - Intronic
1058000702 9:99862145-99862167 GATGGAAGACATCCTTCTAATGG - Intronic
1058125038 9:101182258-101182280 AAGGGAAGATGTTGATCAAAGGG + Intronic
1059996989 9:119920664-119920686 AAGGGAAGATGTTGATCAAAGGG - Intergenic
1061164941 9:128916787-128916809 GATGGAAGGTGTTCAGGGAAAGG + Exonic
1186858163 X:13645771-13645793 GACAGAAGAGGTTCATCTTAAGG - Intergenic
1187040296 X:15587830-15587852 GCATGAAGATGTTCATATAATGG + Exonic
1190500141 X:51067512-51067534 GATAAAAGATGTTCATATAATGG + Intergenic
1191586827 X:62836038-62836060 AATGGAAGATGCTGATCAAAGGG + Intergenic
1192440089 X:71167860-71167882 GATGGAAGAGGTTTAGCTAGAGG - Intronic
1192962136 X:76142646-76142668 GATGGGAGACATTCATCTCAGGG - Intergenic
1192963397 X:76152441-76152463 GATGGGAGACATTCATCTCAGGG + Intergenic
1193918218 X:87393508-87393530 GGTGGAAGAAGTTCATTGAATGG + Intergenic
1194470827 X:94294086-94294108 CATAGAAGATGTTCAGCTACAGG + Intergenic
1199104703 X:143850715-143850737 AAGGGAAGATGTTAATCAAAGGG + Intergenic
1200793854 Y:7322866-7322888 GATGCAAGATGTGGAACTAAGGG - Intergenic
1201853176 Y:18511201-18511223 AAGGGGAGATGTTCATCAAAGGG + Intergenic
1201880145 Y:18809183-18809205 AAGGGGAGATGTTCATCAAAGGG - Intronic