ID: 1092125769

View in Genome Browser
Species Human (GRCh38)
Location 12:6074050-6074072
Sequence GAGTTTGGTGTCACTCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092125769_1092125776 26 Left 1092125769 12:6074050-6074072 CCTTTCAGAGTGACACCAAACTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1092125776 12:6074099-6074121 TACGACAAAGCAAGGAGCCATGG 0: 1
1: 0
2: 1
3: 7
4: 115
1092125769_1092125772 -2 Left 1092125769 12:6074050-6074072 CCTTTCAGAGTGACACCAAACTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1092125772 12:6074071-6074093 TCCTCTAGGCTCAAAACAAGTGG 0: 1
1: 0
2: 3
3: 8
4: 138
1092125769_1092125774 18 Left 1092125769 12:6074050-6074072 CCTTTCAGAGTGACACCAAACTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1092125774 12:6074091-6074113 TGGAGTCCTACGACAAAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092125769 Original CRISPR GAGTTTGGTGTCACTCTGAA AGG (reversed) Intronic
900740955 1:4330502-4330524 GAGTCTGGAGTCATTCTGATGGG + Intergenic
903666736 1:25012515-25012537 TTGTTTCCTGTCACTCTGAATGG + Intergenic
903958388 1:27040616-27040638 CAGTTTGGGTCCACTCTGAAGGG + Intergenic
906180571 1:43814983-43815005 GAGCTGGGTCTCACTTTGAAGGG + Intronic
906383396 1:45347077-45347099 GACTTTGGTTTCCCTCTTAATGG + Intronic
912949451 1:114110744-114110766 GAGTTTGGGGACACTCAGAAGGG - Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1062887079 10:1024912-1024934 TAATGTGGTGTCTCTCTGAACGG + Intronic
1063392483 10:5659467-5659489 GAGTTTGGTGTCACTGGACACGG - Intronic
1069230905 10:66007660-66007682 CATATTGGTGTCATTCTGAAAGG + Intronic
1074891435 10:117739436-117739458 GATTGTGGTGCCACTCTAAATGG + Intergenic
1078750024 11:14152925-14152947 GAATTTGGGGTCACTATGCATGG - Intronic
1079579618 11:22047259-22047281 TATTTTGGTGTCACTGTGAAAGG - Intergenic
1080786342 11:35478413-35478435 GAGGTTCCTTTCACTCTGAAGGG + Intronic
1081797050 11:45827814-45827836 GAGTTTGGGATCAGGCTGAATGG - Intergenic
1088072793 11:105810773-105810795 GAGTCAGGTGAAACTCTGAAAGG - Intronic
1090955416 11:131509282-131509304 GGTTTTGGTGCCACTCTGCATGG + Intronic
1091553562 12:1554805-1554827 GAGTTTGGTCTCTTTCTGAGGGG + Intronic
1092125769 12:6074050-6074072 GAGTTTGGTGTCACTCTGAAAGG - Intronic
1094778252 12:33757876-33757898 GAGAATGGTGTCACTGTGACAGG - Intergenic
1096868989 12:54581773-54581795 GGGCTTGGTGTCACTCAGTAAGG + Intronic
1099261885 12:80393118-80393140 GAGTTTGGTTTTTCTCTAAAGGG - Intergenic
1103218867 12:119226264-119226286 CAATTTGGGGTAACTCTGAAGGG + Intergenic
1103502738 12:121416264-121416286 GGGTTTGGTGTAAATCTGAATGG - Exonic
1112844723 13:103626352-103626374 GAGTTTGGTGTAAATGTTAAGGG - Intergenic
1117385853 14:55212078-55212100 AATTTGGGTATCACTCTGAAGGG - Intergenic
1118515972 14:66529621-66529643 GATTTTGGTGACATTCAGAAGGG + Intronic
1122106740 14:99463373-99463395 ATCATTGGTGTCACTCTGAAAGG - Intronic
1122580501 14:102768844-102768866 GACTTTGGTTTTACTCTGAGAGG - Intergenic
1124666668 15:31598576-31598598 TAGTTTGGTGTCTGCCTGAACGG - Intronic
1128095271 15:64949539-64949561 TCTGTTGGTGTCACTCTGAATGG - Intronic
1131237370 15:90708583-90708605 GAATGTGGAGTCCCTCTGAAGGG - Intergenic
1133274112 16:4626195-4626217 CAGTTTGGGGGCACTCTGAAGGG + Intronic
1134306855 16:13040897-13040919 GACTTTGGTGGCTCTCAGAATGG + Intronic
1138978674 16:62240305-62240327 GGATTTGGTTTCATTCTGAACGG - Intergenic
1139392731 16:66615307-66615329 GCTTTTGGTGTCCTTCTGAAGGG - Exonic
1141427701 16:83954607-83954629 GCGTCCTGTGTCACTCTGAACGG + Intronic
1141827698 16:86492801-86492823 GAGTTTCCTGCCACTCTGAGAGG - Intergenic
1149311071 17:55394562-55394584 GGGTTTGATGTTACTCTGCATGG + Intronic
1154969734 18:21395410-21395432 GCGTTTGGTATCACTGTGTATGG + Exonic
1155332415 18:24731632-24731654 AAGTTTGGTCTGACTCTGGATGG - Intergenic
1157779576 18:50425659-50425681 GAATTTGTTTTCACTCTTAATGG - Intergenic
1158714002 18:59862027-59862049 GACTTTGCTGTCACCCTGTAGGG + Intergenic
1164219946 19:23184247-23184269 GAGTTAGGTGGCCCCCTGAAAGG - Intergenic
926490408 2:13519291-13519313 GAGGTCCGTGTCACACTGAAGGG - Intergenic
927773684 2:25885478-25885500 GAGTATGGTGGCTCTTTGAAAGG + Intergenic
932139773 2:69264966-69264988 CAATTTGGGGTTACTCTGAAGGG + Intergenic
935833855 2:107028701-107028723 CAGTTTGGTCTGCCTCTGAAAGG + Intergenic
936105114 2:109616029-109616051 GACTTTGGTCTCAATGTGAAGGG - Exonic
937177506 2:119955002-119955024 GAGTCTGGTGTCACTATGGGGGG - Intronic
937597268 2:123686988-123687010 GAGTTGGGTGGCCCTCTGAAGGG + Intergenic
937803789 2:126113659-126113681 GTGTTTAGCGTCACCCTGAAAGG + Intergenic
939897393 2:147808650-147808672 GCTTTGGGTGTTACTCTGAATGG - Intergenic
941763829 2:169274512-169274534 GGGTTTGGTGTCTCTCTGGCTGG - Intronic
942221422 2:173772692-173772714 GAGTTTGGTGTCTGCCGGAATGG - Intergenic
946718312 2:222576941-222576963 GAGCATGGTGTCATTCTTAAAGG + Intronic
947221087 2:227792920-227792942 GAGATCGGTGTCCCTCAGAAAGG + Intergenic
1168743083 20:211591-211613 GATTTTGGTGTCAGGCAGAATGG - Intergenic
1172643464 20:36455579-36455601 GAGTTCTGTGTCACTCTGAGTGG + Intronic
1172931904 20:38592293-38592315 AAGACTGGTGTCCCTCTGAAAGG - Intergenic
1175490595 20:59378402-59378424 GAGTGTGGTTTCCTTCTGAAAGG + Intergenic
1176430561 21:6573077-6573099 GAGTGTGGTGTCCCTGTGAGTGG + Intergenic
1176430575 21:6573220-6573242 GAGTGTGGTGTCCCTGTGAGTGG + Intergenic
1178278790 21:31263252-31263274 GAGGCTGGTGTCACTCAGACTGG + Intronic
1179705955 21:43180539-43180561 GAGTGTGGTGTCCCTGTGAGTGG + Intergenic
1179705969 21:43180682-43180704 GAGTGTGGTGTCCCTGTGAGTGG + Intergenic
1180124156 21:45777276-45777298 AAATTTGCTGTCAGTCTGAAGGG + Intronic
1182118702 22:27773228-27773250 GGGTCTGGAGCCACTCTGAAAGG + Intronic
1182793366 22:32971943-32971965 CAGTTTGGGATAACTCTGAAGGG - Intronic
949658654 3:6251741-6251763 TAGTGTGGTGTCAAACTGAAAGG - Intergenic
958434900 3:94084284-94084306 CAATTTGGTGTCTTTCTGAAGGG - Exonic
958780331 3:98533098-98533120 GAGGTCTGTGTCACTCTAAAGGG + Exonic
959084793 3:101840445-101840467 ATGTTTGGTGTTAGTCTGAAGGG - Intronic
960982890 3:123248474-123248496 TTGTTTGGTGTCACTATAAATGG - Intronic
961823583 3:129587468-129587490 GAGTTTGGTGGGGCTCTGACCGG - Intronic
963315267 3:143752026-143752048 GAGTTTGATGTGTGTCTGAAAGG - Intronic
963525443 3:146409591-146409613 GAGTTAGGTGGCCCCCTGAAGGG - Intronic
965104372 3:164339298-164339320 GAGTTAGGTGGCCCTCTTAAGGG - Intergenic
966068643 3:175847381-175847403 CACTTTGGTGTAATTCTGAAAGG - Intergenic
968420152 4:477285-477307 GAGTCTCGTCTCACTCTGTATGG + Intronic
970716157 4:18926779-18926801 GATTTTGGTGCCACTGTAAAAGG - Intergenic
975359915 4:73457124-73457146 GATTTTGGTGTAATTCTAAAAGG + Intergenic
975403127 4:73960403-73960425 GAATTTGTTGATACTCTGAATGG + Intergenic
975463596 4:74683805-74683827 CAGTTTGGTGTTCCTGTGAATGG + Intergenic
978501144 4:109411062-109411084 CAGTTTGGTGTCACCTTTAAGGG - Intergenic
978731332 4:112030393-112030415 GGGTGTGGTGTGACTCTGGAGGG - Intergenic
982066630 4:151660150-151660172 GTGCTTGGTGACACACTGAAAGG + Intronic
982791302 4:159594809-159594831 TAGCTTGGTGACTCTCTGAAGGG + Intergenic
983377156 4:166944742-166944764 GAAGTTACTGTCACTCTGAAAGG - Intronic
986962974 5:13238087-13238109 CATTTTGGCGTAACTCTGAAGGG - Intergenic
988174849 5:27708826-27708848 GACTTTGGTGACCCGCTGAATGG + Intergenic
993033083 5:82727097-82727119 AAGTTTGATGTTACTCTGAAGGG + Intergenic
994081434 5:95711917-95711939 GAGTTGGGTGGCCCTCTGAAGGG - Intergenic
995002054 5:107145098-107145120 GACTTTGGAGTCACTCAGCAGGG + Intergenic
995648133 5:114336759-114336781 GCGCTTTCTGTCACTCTGAATGG - Intergenic
1002818454 6:699701-699723 GGGTTTGGTTTCACTGTGAAGGG - Intergenic
1003122976 6:3333377-3333399 GACTTTGCTTTCACTCTGAGTGG - Intronic
1009484436 6:64202239-64202261 GAGTTTGGTCTCCCTCTCCAGGG - Intronic
1011356226 6:86475553-86475575 GAGTTGGGTGGCCCTCTGAAGGG + Intergenic
1012016203 6:93855339-93855361 GAGTTTGCTGTTAGTCTGATAGG + Intergenic
1012339519 6:98102523-98102545 GAGTTTGGTGACTTTTTGAATGG + Intergenic
1012505444 6:99941162-99941184 GTGTTTGGTGTCAGGCAGAATGG + Intronic
1012872014 6:104683763-104683785 GGATTTGGTGCCTCTCTGAATGG - Intergenic
1013147163 6:107405062-107405084 AAGTTTGCTGTTACTCTGATGGG - Intronic
1013522342 6:110944724-110944746 GAGTTAAGTGTCACTCTCAGTGG + Intergenic
1015425323 6:133058881-133058903 GATTCTGGTGTCAGACTGAATGG - Intergenic
1015646444 6:135394775-135394797 CAGTTTGGTTTCACTCAGACCGG - Exonic
1020887565 7:13837147-13837169 GAGTTTGCTCTCTCTCTGTAGGG + Intergenic
1021050376 7:15976145-15976167 GTGATAGGTGTCACTCTGGAGGG - Intergenic
1026263247 7:68773869-68773891 GCATTTGGTGTAACTCTGAAGGG + Intergenic
1026623478 7:71971863-71971885 CAGTTTGGAGTGACTGTGAATGG - Intronic
1028901173 7:96101886-96101908 GAGATTGGTGCCACTCTTAAAGG + Intronic
1029161314 7:98554308-98554330 GGGTTTGCTCACACTCTGAAAGG + Intergenic
1029327848 7:99825024-99825046 GGTTTTGGTGTCACTCAAAAGGG - Intergenic
1029641726 7:101824922-101824944 CATTTCTGTGTCACTCTGAAAGG + Intronic
1034385184 7:150735075-150735097 GAATTTGGTGTCAAACAGAAGGG + Intronic
1034588639 7:152119423-152119445 TGGGTTGGTGTCACTCAGAAAGG + Intronic
1034598656 7:152225406-152225428 AAGTTTGGTGCCATTCTGATGGG - Intronic
1035550445 8:519622-519644 GAGTTTGCTGTAACCCTCAAAGG + Intronic
1038748197 8:30272413-30272435 GAGTTTGCATTCACTCTGATTGG + Intergenic
1039321162 8:36433355-36433377 GAGTGTGGTATCATTATGAAAGG - Intergenic
1039502493 8:38029235-38029257 GAGTTTGGTCTCACTTTTGAGGG - Intergenic
1039828790 8:41196236-41196258 TAGTTTAGTGTCTTTCTGAAAGG - Intergenic
1040891425 8:52321069-52321091 GACTTTGGTGACACGCTAAAAGG - Intronic
1044665195 8:94627709-94627731 GAGTTTGGTGGCTCTGTGATTGG + Intergenic
1045511941 8:102818406-102818428 CAGTTTGGTTCAACTCTGAAGGG + Intergenic
1045977518 8:108146526-108146548 GAGTTTGCTGGCACATTGAATGG - Intergenic
1046009410 8:108528211-108528233 GAGGTAGCTGTCTCTCTGAATGG - Intergenic
1053354532 9:37434616-37434638 AAGGTCCGTGTCACTCTGAAGGG - Intronic
1053393230 9:37751191-37751213 CAGGTTGGAGTCTCTCTGAATGG + Intronic
1055646208 9:78363787-78363809 GATTTAGGTGCTACTCTGAAAGG - Intergenic
1056215823 9:84405048-84405070 GAGTTTGGGGTAAACCTGAAAGG - Intergenic
1057428081 9:94970117-94970139 GAATTTGGAGCCATTCTGAATGG - Intronic
1058393146 9:104520235-104520257 TAGTTTGGTGTCTGCCTGAATGG - Intergenic
1060066153 9:120503075-120503097 GAATTTGGGGTCACACTGACTGG - Intronic
1060546622 9:124465739-124465761 GAGCCTGGAGTCACCCTGAAAGG - Intronic
1185805919 X:3056970-3056992 GACTTTGGAGTCACAATGAATGG - Intronic
1186806303 X:13143451-13143473 GAGTTTGGGGACTCTCTGTAAGG + Intergenic
1186977489 X:14923716-14923738 GAGATTGGTCTCACTCTTCATGG - Intergenic
1189945803 X:46177398-46177420 GAGTTTGGTGTCCATTTGCATGG + Intergenic
1190713767 X:53087701-53087723 CAGATAGGTGTCACTCTAAAAGG - Intronic
1194359932 X:92937683-92937705 TAAGTTGGTGTCACTCAGAATGG + Intergenic
1200270898 X:154682098-154682120 GAGTTTGTTGTTACTGTAAATGG + Intronic
1200668130 Y:6053504-6053526 TAAGTTGGTGTCACTCAGAATGG + Intergenic
1201273129 Y:12275009-12275031 GACTTTGGAGTCACAATGAATGG + Intergenic