ID: 1092126544

View in Genome Browser
Species Human (GRCh38)
Location 12:6078770-6078792
Sequence GTCACGGCTCTGAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092126544_1092126550 -4 Left 1092126544 12:6078770-6078792 CCCTCCCCTCTCAGAGCCGTGAC 0: 1
1: 0
2: 0
3: 17
4: 234
Right 1092126550 12:6078789-6078811 TGACCAGACAGAGCCCAGCATGG 0: 1
1: 0
2: 0
3: 28
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092126544 Original CRISPR GTCACGGCTCTGAGAGGGGA GGG (reversed) Intronic
900096551 1:942308-942330 GTCTCGGCTCCGACAGGGGCAGG - Intronic
900661868 1:3788718-3788740 GGCACGGCTCAGACATGGGAGGG + Intronic
900988866 1:6088794-6088816 GTCACAGGGCTCAGAGGGGAGGG - Intronic
901501155 1:9653135-9653157 CTCAGGGCTCTCGGAGGGGAAGG + Exonic
902814378 1:18907881-18907903 GACAAGGCACTGTGAGGGGAAGG - Exonic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG + Intronic
904609419 1:31716822-31716844 GTGACTGCTCTGAGAGAGGCAGG - Intergenic
905464010 1:38139350-38139372 ATAGCGGCCCTGAGAGGGGAGGG - Intergenic
909122227 1:71617763-71617785 GCCACAGCTCTGTGAGGAGATGG + Intronic
911180344 1:94854790-94854812 GTCGTGGCTGTGGGAGGGGAGGG + Intronic
911912399 1:103652912-103652934 GTGACGGCTCTGAGTAGAGATGG - Intergenic
911916055 1:103699036-103699058 GTGACGGCTCTGAGTAGAGATGG + Intronic
911919813 1:103747050-103747072 GTGACGGCTCTGAGTAGAGATGG - Intronic
913045956 1:115073601-115073623 GTCACTGCCCTGACTGGGGATGG + Intronic
914431860 1:147625880-147625902 CTCTTGGCTCTGAGAGGGAAAGG + Exonic
915915010 1:159935569-159935591 GTACCGGCCCAGAGAGGGGAAGG - Intronic
916051363 1:161038959-161038981 GTCTCAGCTCTGGGAGGGAACGG - Exonic
918238661 1:182603188-182603210 CTCAGGGCTCCGAGAGGGAAGGG - Intronic
918960213 1:191266024-191266046 GACACTGCTCTAATAGGGGAAGG + Intergenic
920700953 1:208217782-208217804 GTCACGATTCTCAGAGTGGAAGG + Exonic
920960289 1:210657450-210657472 GCCACTGCTCTGGAAGGGGAAGG - Intronic
921599180 1:217089133-217089155 GTTAGGGCGCTGGGAGGGGAGGG - Intronic
922675344 1:227546055-227546077 ATCACAGCTGTGAGTGGGGAAGG - Intergenic
1063007666 10:1989304-1989326 GTCACAGCCCTGGGACGGGAAGG + Intergenic
1067091024 10:43265990-43266012 CTCACTGCTCTGAGCAGGGAGGG + Intronic
1070751193 10:78965031-78965053 GTCGAGTCTCAGAGAGGGGAAGG - Intergenic
1071420569 10:85493027-85493049 TCTAGGGCTCTGAGAGGGGAAGG - Intergenic
1072749756 10:97969331-97969353 GTCAAGGGGCTGGGAGGGGATGG - Intronic
1074700995 10:116092486-116092508 GACAGGGCTCTCAGAGGGGTGGG + Intronic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1075259992 10:120955045-120955067 GACAGGGCTCATAGAGGGGAGGG + Intergenic
1076587268 10:131558048-131558070 CTCAGGCCTCTGAGAGAGGAGGG + Intergenic
1076900020 10:133333775-133333797 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900032 10:133333807-133333829 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900044 10:133333839-133333861 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900056 10:133333871-133333893 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900075 10:133333933-133333955 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900108 10:133334042-133334064 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900114 10:133334058-133334080 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900135 10:133334121-133334143 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900167 10:133334230-133334252 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900173 10:133334246-133334268 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900196 10:133334325-133334347 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900202 10:133334341-133334363 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900208 10:133334357-133334379 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1076900256 10:133334527-133334549 GGGAAGGCTCTGAGGGGGGAAGG + Intronic
1077183024 11:1224825-1224847 GTCAGGGCTCAGCGAGGGGCCGG - Intronic
1077287230 11:1773023-1773045 GGCACGGGTCGGGGAGGGGAAGG + Intergenic
1079391029 11:20022305-20022327 GTCCCAGCTCTGGGATGGGAAGG - Intronic
1081202610 11:40236053-40236075 GTCACGGCTCACAGTGGGCATGG + Intronic
1082765178 11:57162062-57162084 GCAAAGGCTCTGAGATGGGAGGG - Intergenic
1083842263 11:65311250-65311272 GACACAGCTCTCAGAGAGGAGGG - Intergenic
1084116385 11:67045178-67045200 GTCACTGCTTTGAGAGGGACTGG - Intronic
1084280799 11:68090892-68090914 GTCACTGTTCTGACAGAGGAAGG + Intronic
1084302344 11:68259828-68259850 GTGAAGGCTGGGAGAGGGGAAGG + Intergenic
1090172042 11:124613640-124613662 GTCAAGCCTCTGTTAGGGGAGGG + Intronic
1092126544 12:6078770-6078792 GTCACGGCTCTGAGAGGGGAGGG - Intronic
1092166729 12:6347244-6347266 GGCATGGCTCTGTGAGGGCACGG + Exonic
1096681628 12:53259308-53259330 GTCCCTGCCCTGGGAGGGGAGGG + Intergenic
1096818761 12:54217830-54217852 GTCACGGTCCTGAGGCGGGACGG + Intergenic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1097194745 12:57237144-57237166 GTCCCGCCCCTGAGTGGGGAGGG + Exonic
1097264867 12:57738854-57738876 GTCTGGGGTCTGGGAGGGGAGGG + Intronic
1100956457 12:99914667-99914689 ATCAGGGCTCTGATAGGGAAAGG + Intronic
1101543653 12:105689006-105689028 ACCACGCATCTGAGAGGGGAAGG + Intergenic
1102266627 12:111491492-111491514 CTCACAGCTCTGGGAGGAGAGGG + Intronic
1102418588 12:112786159-112786181 GGCAAGGCTCTGCCAGGGGAAGG - Intronic
1102550980 12:113692074-113692096 GTCACAGCTTGGTGAGGGGAGGG + Intergenic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1102704492 12:114869473-114869495 GTCTCCGCTCTTAGAGAGGAAGG + Intergenic
1103339339 12:120213080-120213102 GAAAAGGCTCTGAGAGGGGCCGG + Intronic
1103413626 12:120729829-120729851 GTCCAGGCTCTGGGATGGGATGG + Intronic
1104918087 12:132276424-132276446 GTCTCGGGTCTGGGATGGGAAGG - Intronic
1105205669 13:18221508-18221530 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1106342394 13:28842949-28842971 TTTACAGCTCTGAGAGGTGAAGG + Intronic
1113327707 13:109298511-109298533 GTAAGGTCTCTGAGAGTGGAGGG - Intergenic
1114434948 14:22698442-22698464 GTCCCGGCCCTGGGAGGGAAGGG + Intergenic
1122789806 14:104179442-104179464 AACAGGGCTCTGGGAGGGGAGGG - Intronic
1123466348 15:20518899-20518921 GTCAGGGTGCTGGGAGGGGATGG + Intergenic
1123651766 15:22482139-22482161 GTCAGGGTGCTGGGAGGGGATGG - Intergenic
1123742185 15:23290998-23291020 GTCAGGGTGCTGGGAGGGGATGG - Intergenic
1123744810 15:23311546-23311568 GTCAGGGTGCTGGGAGGGGATGG + Intergenic
1123761139 15:23433487-23433509 GTCAGGGTGCTGGGAGGGGATGG + Intergenic
1124236349 15:27992492-27992514 GCCATGGCGCTGAGAGTGGAGGG + Intronic
1124277075 15:28334877-28334899 GTCAGGGTGCTGGGAGGGGATGG + Intergenic
1124305625 15:28576729-28576751 GTCAGGGTGCTGGGAGGGGATGG - Intergenic
1126038000 15:44565467-44565489 GTCACTGATCTGACAGGAGATGG + Intronic
1130960598 15:88656331-88656353 GGCTCGGCTCTCTGAGGGGAGGG + Exonic
1132463591 16:67554-67576 TGCAGGGCTCTGAGATGGGAGGG - Intronic
1132747734 16:1443955-1443977 GTGACGGCTCTCAGCTGGGAAGG + Exonic
1134085766 16:11356649-11356671 TTCACAGCTGTGAAAGGGGATGG - Intergenic
1139467853 16:67163853-67163875 GTAAGCGCTCTGAGAGGGAACGG + Exonic
1140994751 16:80247914-80247936 GTCAGGGCTCTGAGTGGTGCTGG - Intergenic
1141543921 16:84750061-84750083 GTGACTGGTCTGAGAGGAGATGG + Intronic
1141879793 16:86850270-86850292 GTCCTGGCTTTGAGAGGGGAGGG - Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142234646 16:88915880-88915902 GTGACGCTCCTGAGAGGGGAAGG - Intronic
1142374024 16:89697664-89697686 CTCACGGCGCAGAGAGAGGAAGG + Exonic
1143787552 17:9267248-9267270 ATGATGGCTCTGAGAGTGGAGGG - Intronic
1146380485 17:32323792-32323814 GTCATGGTTGGGAGAGGGGATGG - Exonic
1147153846 17:38533449-38533471 GTCAGGGGTCAGAGAGCGGAAGG + Intronic
1147159794 17:38563188-38563210 GGTAGGGCTCTGGGAGGGGAGGG + Intronic
1147944964 17:44075742-44075764 GTCACGGCTCAGGGAGGCAAAGG - Exonic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151327808 17:73389699-73389721 GCCAGGGCTGTGAGTGGGGAGGG + Intronic
1151802314 17:76385489-76385511 GCCACGGCTCCGGGCGGGGAAGG + Exonic
1152041706 17:77907787-77907809 GTGTCGGCCCTGAGTGGGGAAGG + Intergenic
1152744656 17:82033172-82033194 GTCACAGCTCTCAGAATGGAGGG + Intronic
1155717928 18:28970013-28970035 GGCAGGACTCTGAGAGGGGCAGG - Intergenic
1160114547 18:76065107-76065129 GTCAAAGCGGTGAGAGGGGAGGG - Intergenic
1161452862 19:4356204-4356226 ACCAAGGCTCTGAGAGGGGAGGG - Intronic
1161821379 19:6533057-6533079 GCCCCAGCTCTGAGAGGGCAGGG - Intronic
1161827773 19:6580465-6580487 GTCCCAGCTGAGAGAGGGGAAGG - Intergenic
1164869820 19:31633394-31633416 GTCATTGCTGTGAGACGGGAGGG + Intergenic
1166695877 19:44851243-44851265 CTCCTGGGTCTGAGAGGGGAAGG - Intronic
1166950267 19:46422549-46422571 GCCAAGGCTCAGAGAGGTGAAGG - Intergenic
1168107807 19:54174771-54174793 GTCATGGGTCTGAGTGGGGAGGG - Intronic
926907167 2:17816640-17816662 GGAAAGGCTCTGAGAGGGGGAGG - Exonic
927956139 2:27208544-27208566 GTCACGGAGCTGAGAGGCAAAGG + Intronic
928539444 2:32270510-32270532 GTCACTGATCTGACAGGAGATGG - Intergenic
929016865 2:37506045-37506067 GTCACAGCAGTGAGAGGGGGTGG + Intergenic
929998807 2:46847245-46847267 ATCACGGCTCACAGAGGTGAGGG + Intronic
930054914 2:47244421-47244443 GTCAGGGCACTGATTGGGGAGGG + Intergenic
930725095 2:54674667-54674689 GTCACGGGGCTGGGAGGTGAAGG - Intergenic
932306924 2:70710451-70710473 GGCAGGGCTCTAAGAAGGGAAGG - Intronic
932441822 2:71742454-71742476 GTAGAGGCTCTGAGAGTGGATGG + Intergenic
937121478 2:119442423-119442445 GTCAGGCCTCTGTGTGGGGAGGG - Intronic
937537903 2:122913954-122913976 GTCAGGGCTCTGAGAATGGCTGG + Intergenic
937943681 2:127311347-127311369 AGCAGGGCTCTGATAGGGGAAGG + Intronic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
943774186 2:191747328-191747350 GTCTCAGCTGTGAGAGGAGATGG + Intergenic
946027395 2:216680057-216680079 GTCAAGGATCTGAGAGGAGAAGG - Intronic
946095607 2:217271773-217271795 GTGAGGGCTCTGTGAGGGGGAGG + Intergenic
948752244 2:240139495-240139517 CCCAAGGATCTGAGAGGGGATGG - Intronic
948948352 2:241233263-241233285 GGCAGGGCCCAGAGAGGGGATGG + Intronic
1171304936 20:24097095-24097117 GGCACGACTCTGGGAGGCGAAGG - Intergenic
1172593191 20:36131915-36131937 GTGACGGCTCTGGGAGGAAAGGG - Intronic
1172845458 20:37927623-37927645 GGCAAGGCTCAGAGAGGGCAGGG - Intronic
1173159433 20:40641382-40641404 GTAAAGGCTCAGAGAGGGGAAGG - Intergenic
1173873773 20:46357284-46357306 GTCACAGCCCTGCGAGGGCAGGG + Intronic
1174825946 20:53768699-53768721 GTCCAGGCTCTGACAGGGGCAGG - Intergenic
1175112504 20:56658419-56658441 ATGAGGGCTCTGAGAGAGGATGG + Intergenic
1176301460 21:5101008-5101030 GTCCCCGCCCTGAGAGGGAAGGG - Intergenic
1177240810 21:18454601-18454623 GCCAAGAGTCTGAGAGGGGAGGG + Intronic
1178383989 21:32134717-32134739 ATGCCGGCTCAGAGAGGGGATGG - Intergenic
1179524377 21:41966103-41966125 CTCAGGGCTCTGAGAGGACATGG + Intergenic
1179588378 21:42388655-42388677 GTCACTGCTCTGTGATGGGGAGG - Intronic
1179855571 21:44160891-44160913 GTCCCCGCCCTGAGAGGGAAGGG + Intergenic
1180019269 21:45110925-45110947 TTCTCTGCTCTGTGAGGGGATGG + Intronic
1180760297 22:18197208-18197230 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1180770610 22:18381506-18381528 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1180775372 22:18427488-18427510 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1180808441 22:18738543-18738565 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1180828553 22:18884464-18884486 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1181071370 22:20343507-20343529 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1181194443 22:21172457-21172479 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1181214999 22:21320321-21320343 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1183319262 22:37155208-37155230 GACACGGCTCTGAGCAGGGCAGG - Intronic
1184514023 22:44949741-44949763 CTCGCGGCTCTGTGAGGAGATGG - Intronic
1184805480 22:46792604-46792626 GTCTCGGCTCTGATATGGGAGGG + Intronic
1203232445 22_KI270731v1_random:122678-122700 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1203278647 22_KI270734v1_random:110453-110475 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
950097240 3:10337413-10337435 GTCACAGCCCTGCGAGGGGAGGG - Intronic
950416574 3:12872467-12872489 GTCAGGCCTCTGAGGGGGGATGG - Intergenic
952970667 3:38648820-38648842 GTTCCGGCTCAGAGAGAGGAGGG + Intronic
954375281 3:50191340-50191362 GTCAGGGCTGAGAAAGGGGAAGG - Intergenic
954419187 3:50409672-50409694 GCCACGGCTCTCTGAGGGCAGGG + Intronic
954716118 3:52527771-52527793 GCCAGGGCTCTGGGTGGGGAGGG - Intronic
955158927 3:56445743-56445765 GTGAAGGCTCTGAGACAGGAAGG - Intronic
957733855 3:84180576-84180598 GTAACTGCTCTGAAAGAGGAAGG + Intergenic
963600535 3:147374588-147374610 GTCCTTGCTCTGAGAGGGAATGG + Intergenic
965881732 3:173395898-173395920 GTCCTGGCTCTGAGGGGGGCAGG + Intergenic
967135492 3:186509535-186509557 CACACAGCTCTGAGTGGGGAGGG + Intergenic
967339923 3:188385385-188385407 GTGACAGAGCTGAGAGGGGAAGG + Intronic
968454446 4:689767-689789 GACACGGCTCTCAGAGGAGTAGG + Intergenic
969581283 4:8067068-8067090 GTCGAGGCTCAGAGAGGCGAGGG + Intronic
970540512 4:17073842-17073864 GGCACGGCGCTGAGAGGTAAGGG - Intergenic
973217621 4:47688030-47688052 GTCACAACTGTGAGAGTGGAGGG - Intronic
977020793 4:91756453-91756475 GTCACATCTCTGAGAAGGGTGGG - Intergenic
979283081 4:118889160-118889182 GTCACGGCTCTGTGCTAGGAAGG + Intronic
980708343 4:136529606-136529628 GACATGGCTCTGAGAGGCTAAGG + Intergenic
981649154 4:147036373-147036395 ATCACGGCTCTTGGAGGAGAGGG - Intergenic
982254149 4:153435901-153435923 GTAAAGGTTCGGAGAGGGGAGGG - Intergenic
982983342 4:162170058-162170080 GTCACAGCTATGAGAAAGGATGG + Intergenic
983782707 4:171691870-171691892 GTCAGAGCTGAGAGAGGGGAAGG + Intergenic
985502631 5:258539-258561 GGCAAGGCTCTGAGAGGAGAAGG - Intergenic
985502689 5:258855-258877 GGCAAGGCTCTGAGAGGAGAAGG - Intergenic
986728623 5:10618479-10618501 GCCACGGCTCTGAGAGGAAAGGG - Intronic
989102524 5:37835748-37835770 GTGACTCCTCTGGGAGGGGAAGG - Exonic
994242850 5:97444688-97444710 GACAGAGCTCTGAGAGGGAAGGG - Intergenic
995861493 5:116645500-116645522 TGCACAGCTCTGAGAGGAGATGG - Intergenic
997262666 5:132476506-132476528 GTCACTGGTCAGAGAAGGGAGGG + Intergenic
999269867 5:150290534-150290556 GTCACAGCTGTGAGAGGTGGGGG - Intergenic
999285698 5:150392974-150392996 CTCAGGGCTCTATGAGGGGACGG - Intronic
999294908 5:150453109-150453131 GTGTGAGCTCTGAGAGGGGAGGG - Intergenic
1000610120 5:163364957-163364979 GTGACAGCTCTCAGTGGGGAGGG - Intergenic
1000902602 5:166928000-166928022 CTCATGGCTCTGGCAGGGGAGGG + Intergenic
1001125272 5:169013498-169013520 GTCAGGTCTCTGAGAGCAGAAGG - Intronic
1001380736 5:171304854-171304876 GTCACAGGACTGAGTGGGGAGGG - Intergenic
1002158845 5:177303312-177303334 GTCAGGGTCCTGAGCGGGGACGG + Exonic
1002327636 5:178420393-178420415 GTCACATCTCAGGGAGGGGAGGG - Intronic
1002327751 5:178420695-178420717 GTCACATCTCAGGGAGGGGAGGG - Intronic
1002591372 5:180293142-180293164 GTCAAGCCTCTGAGAGGAGTGGG + Intergenic
1003512401 6:6792372-6792394 GTAACTGATCTGGGAGGGGAGGG - Intergenic
1007185434 6:39967142-39967164 GACACTGCACTGATAGGGGAAGG - Intergenic
1011045576 6:83078109-83078131 GTAAAGGCACTGAGATGGGAGGG + Intronic
1012703911 6:102497074-102497096 GTCAGGACTCAGAGTGGGGAAGG - Intergenic
1014989360 6:128054776-128054798 GTCAAGGCTCTCTGAGGGTAGGG - Intronic
1015325386 6:131918334-131918356 GGCAAGGCACTGAGAGTGGATGG + Intergenic
1016854124 6:148649581-148649603 GTCAGAGCTTAGAGAGGGGAGGG - Intergenic
1018373719 6:163191729-163191751 GTCATGGCTCTGAGTGGGAGTGG - Intronic
1018937622 6:168283981-168284003 GGCACGGCTCTGAGCATGGAAGG + Intergenic
1018937637 6:168284048-168284070 GGCACGGCTCTGAGCATGGAAGG + Intergenic
1018937651 6:168284115-168284137 GGCACGGCTCTGAGCATGGAAGG + Intergenic
1018937665 6:168284182-168284204 GGCACGGCTCTGAGCATGGAAGG + Intergenic
1019541778 7:1554884-1554906 GTCACGCCTCTGGAAGGAGAAGG + Intronic
1021717602 7:23473935-23473957 CTCACGGCTCACAGTGGGGAGGG + Intergenic
1023940436 7:44765736-44765758 GCCACGTCCCTGAGATGGGAGGG - Intronic
1024208747 7:47185973-47185995 GGCAAGGCCCTGAGAAGGGAAGG - Intergenic
1026858728 7:73770987-73771009 GACAGGGCTCGGAGAGGGGAGGG - Intergenic
1029708043 7:102285910-102285932 GGAAGGGGTCTGAGAGGGGAGGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033514009 7:142088097-142088119 GGCACAGCTCTGATAGGGTAGGG + Intronic
1034975231 7:155444953-155444975 GTCACGGGGCGGGGAGGGGAGGG + Intergenic
1035663111 8:1362162-1362184 GTCTCGGCACTGGCAGGGGAGGG + Intergenic
1035757027 8:2042349-2042371 GCCGCGGCTCTGAGAGGAGCTGG - Intergenic
1038446258 8:27606309-27606331 GCCAAGGCTCTGAGTGGGGAAGG - Intronic
1048828115 8:138449399-138449421 GGAAGGGCTCTGAGAGAGGACGG + Intronic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1052022376 9:23540201-23540223 GTAACGGGTATGAGAAGGGATGG - Intergenic
1053001073 9:34577709-34577731 ACCAGGCCTCTGAGAGGGGAGGG - Intronic
1054464466 9:65485248-65485270 GTCAGGGCCCAGAGAGTGGATGG - Intergenic
1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG + Intergenic
1057491451 9:95523066-95523088 GACAGGTCTCTGAGAGGGGGTGG - Intergenic
1058467792 9:105245518-105245540 GTCACGGCACTAAGGGGGGATGG - Intronic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1061288908 9:129639888-129639910 GTCAAGGAGCTGAGACGGGAGGG - Intronic
1061545465 9:131301782-131301804 ACCAAGGCGCTGAGAGGGGAAGG + Intronic
1061620559 9:131808818-131808840 GCCACTGCTCTGCGAGGGGTCGG + Intergenic
1061929431 9:133824832-133824854 GACGGGGCTCTGAGAGAGGAAGG - Intronic
1062038948 9:134395452-134395474 GTCAGGGCTCTGTGTGGGGCCGG + Intronic
1062255005 9:135616685-135616707 GGCTGGGCTCTGAGTGGGGAGGG + Intergenic
1062349043 9:136130191-136130213 GTCCCGGGGCTGGGAGGGGACGG - Intergenic
1062383984 9:136301407-136301429 GTCCCGGGGCTGGGAGGGGACGG + Intronic
1062426813 9:136509953-136509975 GACACGGGTCTGGGAGAGGACGG + Exonic
1189216202 X:39326959-39326981 GCCAGTGCTCTGGGAGGGGAAGG - Intergenic
1190091080 X:47438070-47438092 GTCTCGGCTCAGAGAGGAGTAGG + Intergenic
1190131120 X:47749768-47749790 GTCAGGGCTCTGACTGGGAAAGG - Intergenic
1192236723 X:69300812-69300834 ATCAAGGCTCGGAGAGGTGAAGG - Intergenic
1199907853 X:152252905-152252927 GTGTCAGCTCTGAGAGAGGATGG - Intronic