ID: 1092128991

View in Genome Browser
Species Human (GRCh38)
Location 12:6095445-6095467
Sequence TGCAGAAGGTGGGTGTGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092128991_1092129002 14 Left 1092128991 12:6095445-6095467 CCAGTCCACACCCACCTTCTGCA 0: 1
1: 0
2: 2
3: 58
4: 377
Right 1092129002 12:6095482-6095504 ATGTTGCATGAGCTGCTGGGAGG 0: 1
1: 0
2: 1
3: 16
4: 179
1092128991_1092129001 11 Left 1092128991 12:6095445-6095467 CCAGTCCACACCCACCTTCTGCA 0: 1
1: 0
2: 2
3: 58
4: 377
Right 1092129001 12:6095479-6095501 GAGATGTTGCATGAGCTGCTGGG 0: 1
1: 0
2: 0
3: 33
4: 746
1092128991_1092129000 10 Left 1092128991 12:6095445-6095467 CCAGTCCACACCCACCTTCTGCA 0: 1
1: 0
2: 2
3: 58
4: 377
Right 1092129000 12:6095478-6095500 GGAGATGTTGCATGAGCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092128991 Original CRISPR TGCAGAAGGTGGGTGTGGAC TGG (reversed) Exonic
900032246 1:380430-380452 GGCAGGAGGTGGGTGGGGACCGG + Intergenic
900052796 1:608616-608638 AGCAGGAGGTGGGTGGGGACCGG + Intergenic
900482667 1:2906782-2906804 TGCATTCCGTGGGTGTGGACAGG - Intergenic
901051077 1:6426197-6426219 GGCAGAAGGTGGGGTTGGCCTGG - Intronic
901196861 1:7445166-7445188 TGCAGTAGCTTGGTGTGGCCTGG + Intronic
901795591 1:11677528-11677550 TGGAGAAGGTGAGGGTGCACTGG - Exonic
902518059 1:17000371-17000393 GCCATAAGGTGGGTGGGGACGGG - Intronic
902653064 1:17849369-17849391 TGCAGGAGTTGGGTGTGGTGAGG + Intergenic
903641288 1:24862102-24862124 AGGAGAAGGTGGGAGTGGACCGG + Intergenic
904662352 1:32094753-32094775 AGCAGAAGGTGGGTGAGGCCTGG - Intronic
904826944 1:33280206-33280228 TGGTGGTGGTGGGTGTGGACGGG - Exonic
905247574 1:36625629-36625651 TGCAGTAGGGGAGTGGGGACAGG - Intergenic
906676980 1:47700383-47700405 AGCAGCAGGTGGGTGGGGAGAGG + Intergenic
907268849 1:53278682-53278704 TGCACAAGTTGGGTGGGGACAGG - Intronic
912390289 1:109297986-109298008 TCCTGAAGGTGGGTTTGGATAGG - Intronic
912863519 1:113236519-113236541 TCTAGAAGGAGGGTGTGGCCAGG + Intergenic
913059690 1:115193720-115193742 GGCAGAAGGTGAGAGTGGAGAGG - Intergenic
913210897 1:116581629-116581651 TGCAGGAGGTGGGTGCAGAGGGG - Intronic
913655977 1:120960067-120960089 TGCTGAAGGTGGCTGAGTACAGG - Intergenic
913962983 1:143353772-143353794 TGCAGACGGTGGGCGGGGGCCGG + Intergenic
914057338 1:144179357-144179379 TGCAGACGGTGGGCGGGGGCCGG + Intergenic
914121808 1:144787009-144787031 TGCAGACGGTGGGCGGGGGCCGG - Intergenic
914520533 1:148411299-148411321 TGCTGAAGGTGGCTGAGTACAGG - Intergenic
918464553 1:184808059-184808081 TGCAGGAGGTGGGTGTGGCAGGG - Exonic
919978158 1:202626234-202626256 TGCAGAGGGAGGGTGGGGGCTGG - Intronic
919987317 1:202684960-202684982 TGCAGCAGTGGGCTGTGGACAGG + Intronic
920735612 1:208530418-208530440 TGAAGAGGGTGGGGGTGGTCAGG + Intergenic
921010563 1:211136627-211136649 TTGAGAATGTGGCTGTGGACAGG - Intergenic
921029844 1:211327209-211327231 TCCAGAGGGCGGCTGTGGACCGG + Intronic
923341002 1:233007033-233007055 TGCAGCAGGAGAGTGTGGTCAGG - Intronic
923767178 1:236902743-236902765 TACTGAAGGTGGGTGTAGAGAGG - Exonic
1062865227 10:846828-846850 TGCTGAAGGTGGGAGTGTCCCGG - Intronic
1063523112 10:6758734-6758756 TGCAGTAGGTGAGGTTGGACAGG - Intergenic
1064009996 10:11727970-11727992 GGCAGAGGGTGGGTTTGCACTGG + Intergenic
1065784564 10:29201568-29201590 GGGGGAAGGTGAGTGTGGACTGG + Intergenic
1066313164 10:34218031-34218053 TGCAGGAGGTGCCTGTGGAAGGG - Intronic
1066565955 10:36722414-36722436 TCCAGGAGTTGGGTGTAGACAGG - Intergenic
1067279412 10:44860034-44860056 TGAAGATGGTGGGGCTGGACAGG - Intergenic
1068522090 10:58088030-58088052 TGAAGAATGTGGGTGGGGAGAGG - Intergenic
1070335328 10:75449958-75449980 TTCAGACGGTGGGTGTGTGCAGG - Intronic
1070567592 10:77615431-77615453 TGCAGAAGGTGGGTGGTGTAGGG + Intronic
1070682061 10:78455681-78455703 GGGAGAAGGTGAGAGTGGACAGG - Intergenic
1070994536 10:80764635-80764657 TGCAGTAGATGGGAGTGCACGGG - Intergenic
1071611806 10:87038689-87038711 TGTAGAAGGAGTGTGTGCACTGG + Intergenic
1072111337 10:92323024-92323046 TAAAGAAGGTGGCTGGGGACCGG - Intronic
1072614864 10:97042812-97042834 TGAGGAAGATGGGAGTGGACAGG - Intronic
1072760467 10:98052157-98052179 TGCAGAATCTGGGTGAGAACTGG + Intergenic
1072767570 10:98108124-98108146 TGCAGAAGGTGGGACAGGGCTGG - Intergenic
1074467548 10:113696764-113696786 GGCAGAGGGTGGGGGTGGAAAGG + Intronic
1075852973 10:125603768-125603790 TGCAGGAGTTGGGTGGGGAGGGG - Intronic
1076290079 10:129339339-129339361 GGCTGGAGGTGGGTGTGGAGGGG + Intergenic
1076716474 10:132366782-132366804 TGCAGATGGGGTGTGGGGACAGG - Intronic
1077134408 11:991411-991433 TGCAGAAGGTGATAGTGGCCTGG + Intronic
1077225079 11:1436127-1436149 TGATGAAGGTGGGTGGGGCCGGG + Exonic
1077280462 11:1742710-1742732 TGCATAAGGTTGGTGGGGACAGG + Intronic
1077352478 11:2099350-2099372 TGCAGGAGCTGGGTGGGGGCAGG - Intergenic
1077511963 11:2971017-2971039 TGCAGATGGTGGTTGTGGTGTGG - Intronic
1079487623 11:20951930-20951952 TGGAGAAGGGGAGTGTGCACTGG + Intronic
1079659261 11:23019241-23019263 TCAAAAAGGTGGGTGTGGCCAGG + Intergenic
1080984929 11:37451233-37451255 TGCAGAAGGTGTGTTTGAAATGG + Intergenic
1081693776 11:45095296-45095318 AGGAGGAGGTGGGTGTGGAGGGG - Intergenic
1081994978 11:47358543-47358565 TGCAGAGGGTGCGTGTGCACAGG - Intronic
1082268705 11:50146152-50146174 CGAAGAATGTGGGTGTGGATGGG + Intergenic
1082650836 11:55790655-55790677 TGGAGAAGGTTGATGTGCACTGG - Intergenic
1083573200 11:63770804-63770826 TGCAGAATGTGGGTGGGAAGGGG - Intergenic
1084268800 11:68018503-68018525 TGCAGGAAGTGGGTGGGGTCAGG - Intronic
1084319661 11:68366261-68366283 TGCAGAAGGTGGTGGGGGACAGG + Intronic
1084640607 11:70423709-70423731 TGCAGAGGGAGGGTGGGGAGCGG + Intronic
1084956413 11:72693895-72693917 TGCATATGGTTGGAGTGGACAGG - Intronic
1086251044 11:84814690-84814712 TGCAGGAGGTGGGGGTGAAGTGG - Intronic
1087158387 11:94926229-94926251 TGAAGAAGGTGGGTGTGTGCAGG + Intergenic
1088883060 11:113986770-113986792 TGCAGGAGGTGGGAGGGGGCGGG - Exonic
1089330713 11:117687074-117687096 TGCAGAATGTGGATGGGGGCAGG + Intronic
1090405412 11:126473273-126473295 GGGAGGGGGTGGGTGTGGACGGG - Intronic
1091004302 11:131938636-131938658 TGCAAAAGGTGGGTGGGGCAGGG + Intronic
1091358115 11:134953833-134953855 TGAAGAGGGTGGGTCTGGTCTGG - Intergenic
1092100991 12:5883615-5883637 TGGAGAAGCAGGGTGTGGAGGGG + Intronic
1092128991 12:6095445-6095467 TGCAGAAGGTGGGTGTGGACTGG - Exonic
1093214662 12:16348685-16348707 TGCAAAAGGTAGGTGTAGGCTGG - Intronic
1096113417 12:49041640-49041662 TGCAGAAGGTGAGTGGGGCTGGG - Exonic
1096154251 12:49332994-49333016 GGCAGGAGGTGGGTGAGGACGGG + Exonic
1096570126 12:52518088-52518110 TGAAGAAGGTGCGTGTGGGTGGG - Exonic
1097054978 12:56243770-56243792 TGAAGAAGGTGGGTGGGGTCTGG - Exonic
1098575772 12:72040439-72040461 TGCAGAAAGTGTGAGTGGTCTGG - Intronic
1100185346 12:92133009-92133031 AGAAGAAGGTGTGTGGGGACAGG + Intronic
1100897674 12:99202918-99202940 TGCAGAAAGAGAGTGTGGAGAGG - Intronic
1101112038 12:101495736-101495758 TGAAGAAGGTGGGTATAGATTGG - Intergenic
1101219096 12:102618137-102618159 TTAAGAAGGTATGTGTGGACAGG - Intergenic
1102362092 12:112296825-112296847 TGCAGAAGGTGGAGGTGCAGTGG + Intronic
1102362099 12:112296870-112296892 TGCAGAAGGTGGAGGTGCAGTGG + Intronic
1103609884 12:122116816-122116838 TGCAGAAGGTGGGCTGGGCCGGG + Intronic
1104043941 12:125148308-125148330 GGCAGCAGGTGGGTCTGCACTGG + Intergenic
1104066485 12:125311103-125311125 GACAAAAGGTGGGTGTGTACTGG + Intronic
1104083971 12:125457883-125457905 AGCAGGAGCTGGGTCTGGACAGG + Intronic
1104716097 12:131017268-131017290 TGCACTGGGTGTGTGTGGACTGG - Intronic
1104716103 12:131017307-131017329 TGCACTGGGTGTGTGTGGACTGG - Intronic
1104716109 12:131017346-131017368 TGCACTGGGTGTGTGTGGACTGG - Intronic
1104947297 12:132421782-132421804 TGCCGGGGGTGAGTGTGGACGGG + Intergenic
1108254273 13:48595451-48595473 GGCAGAGTGTGGGTGTGGAAGGG + Intergenic
1108358757 13:49651007-49651029 TGTAGCAGGTGAGTGGGGACAGG - Intergenic
1109288005 13:60434836-60434858 TCCACCAGGTGGGTGTGCACAGG + Intronic
1112447986 13:99483991-99484013 TCCTGAAGGTGGGTGTGGAAAGG - Intergenic
1113446247 13:110369838-110369860 TGAAGAAAGTGGGGCTGGACAGG - Intronic
1113662866 13:112118831-112118853 TGCTGGAGGTGGGTGGGGAGGGG + Intergenic
1113888170 13:113671888-113671910 GGCAGAAGGAAGGTGGGGACTGG - Intronic
1113963655 13:114139678-114139700 TGGTGGAGGTGGGTGTAGACAGG + Intergenic
1113963708 13:114139912-114139934 TGGTGGAGGTGGGTGTAGACAGG + Intergenic
1114037595 14:18644885-18644907 TGGAAAAGGTGGGCGTGGATGGG + Intergenic
1114121040 14:19670138-19670160 TGGAAAAGGTGGGCGTGGATGGG - Intergenic
1114454235 14:22845079-22845101 GGCGGAAGGTGGGGGTGGAAGGG - Intronic
1117108470 14:52423437-52423459 TGCAGAAGGATGTTATGGACAGG + Intergenic
1119414483 14:74460407-74460429 TTCAGGAGGTGGCTGTGGAATGG - Intergenic
1120885443 14:89448368-89448390 TGCATAAGGTGGGTGCTCACTGG + Intronic
1120890341 14:89485565-89485587 GGCAGAGGCAGGGTGTGGACAGG + Intronic
1120953862 14:90064363-90064385 AGCAGAGTGTGTGTGTGGACAGG + Intronic
1121246291 14:92463188-92463210 TGAAGAAGATGGGGGTGGATGGG - Intronic
1121456695 14:94043085-94043107 AGAAGGTGGTGGGTGTGGACGGG - Intronic
1122873312 14:104651209-104651231 TCCAGAAGGAGGGCGTGGACGGG + Intergenic
1123040738 14:105489255-105489277 TGCAGAAGCTGGGCCTGGCCTGG - Intronic
1123075124 14:105664257-105664279 TTCAGGAGGCTGGTGTGGACGGG + Intergenic
1123409771 15:20048519-20048541 GGCAGGAGGTGGGTCTGGACAGG + Intergenic
1123519103 15:21055227-21055249 GGCAGGAGGTGGGTCTGGACAGG + Intergenic
1124493785 15:30174174-30174196 TGCAGAGGGAGGGTGGGGGCTGG - Intergenic
1124749783 15:32364475-32364497 TGCAGAGGGAGGGTGGGGGCTGG + Intergenic
1125491067 15:40148767-40148789 TCAAGATGGTGGGTGAGGACCGG + Intergenic
1126326254 15:47480646-47480668 GGCAGAAGCAGGGTGTGGAGGGG - Intronic
1126860344 15:52876880-52876902 TGCAGAATGTGGGGCTGGAGTGG + Intergenic
1127929528 15:63583081-63583103 TTCAGAAAGTGGGTCTGTACAGG + Intronic
1128256541 15:66201318-66201340 TGCAGAATGTGGGGCTGGAGAGG + Intronic
1128582212 15:68818310-68818332 TGCCGAAGGTGGGTGTGTGGGGG + Intronic
1128892332 15:71342542-71342564 GGCAGAAGTTGGGGGTGGGCAGG - Intronic
1129701909 15:77773084-77773106 AGGAGAAGGTGGCTGTGGAAAGG + Intronic
1130247172 15:82262599-82262621 TGCAGCCGGTGAGTGTGGGCTGG - Exonic
1133001822 16:2855758-2855780 CCCAGAAGGTGGGTGTTGCCTGG - Exonic
1134512522 16:14859980-14860002 TGGAGGAGGTGGGTGAGGTCAGG + Intronic
1134700164 16:16258476-16258498 TGGAGGAGGTGGGTGAGGTCAGG + Intronic
1134971662 16:18536181-18536203 TGGAGGAGGTGGGTGAGGTCAGG - Intronic
1135642231 16:24130641-24130663 TGGAGAGAGTGGGTGTGGCCAGG - Intronic
1135904022 16:26493821-26493843 TGCAGAAGGAGGGGGTGGTGAGG - Intergenic
1136024179 16:27459370-27459392 GGCAGAATGGGGATGTGGACTGG + Intergenic
1136223640 16:28844646-28844668 TGCAGAGGGTGGGGCTGGATGGG - Intronic
1136367221 16:29814346-29814368 TGCAGCAGGGGGACGTGGACGGG + Exonic
1136691677 16:32036929-32036951 TGCAGTAGGTGGTTATGGACAGG - Intergenic
1136792266 16:32980492-32980514 TGCAGTAGGTGGTTATGGACAGG - Intergenic
1136877551 16:33873416-33873438 TGCAGTAGGTGGTTATGGACAGG + Intergenic
1139466452 16:67156532-67156554 AGCAGAAGGTGGCAGTGTACAGG - Exonic
1139548692 16:67661666-67661688 TGCAGAAGCGGGGTGAGGAGGGG + Exonic
1141802446 16:86320034-86320056 TGCCGAAGGTGGGAGGGGGCGGG - Intergenic
1141876158 16:86826001-86826023 TGCAGGAGGAGCGAGTGGACAGG + Intergenic
1141915413 16:87093378-87093400 TGCAGGGGCTGGGGGTGGACAGG - Intronic
1142086514 16:88186162-88186184 TCCACAAGGTGGGTGTGGGTGGG + Intergenic
1142109296 16:88322763-88322785 TCCTGAAGGTGGGTGGGCACGGG - Intergenic
1142125621 16:88408949-88408971 TTCAGAAGGTGGGGCTGGATAGG - Intergenic
1203094472 16_KI270728v1_random:1241956-1241978 TGCAGTAGGTGGTTATGGACAGG - Intergenic
1142457570 17:64960-64982 GGCAGGAGGTGGGCCTGGACAGG + Intergenic
1142774785 17:2128424-2128446 TGCAGAAAGTGGTACTGGACAGG + Intronic
1144620310 17:16814662-16814684 TGGAGAAGCGGGGTGAGGACAGG - Intergenic
1144746900 17:17621923-17621945 CGCAGGAGGGAGGTGTGGACGGG + Intergenic
1144754666 17:17671820-17671842 TGAAGAAGGTGGGTGAGCAGAGG + Intergenic
1145964264 17:28905853-28905875 AGCAGGAGGTGGGTGGGGAAGGG + Exonic
1145982613 17:29022385-29022407 GACAGAAGCTGGGTGTTGACGGG + Intronic
1147543746 17:41382281-41382303 TGCTGGAGGTGGATGTGGGCAGG + Exonic
1147571698 17:41575540-41575562 TGGAGAAGGTGGGTGAGGACAGG - Intergenic
1147637962 17:41975378-41975400 TACAGAAGGTGGGGGTTGGCTGG + Exonic
1147674267 17:42193884-42193906 TTCAGAAGGTAGGGGTGGGCCGG + Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149058802 17:52396257-52396279 TGTAGAAGGTGGGTCTCAACAGG - Intergenic
1149523243 17:57334394-57334416 TGCTGAAGGTGGATGTGCAAAGG + Intronic
1149661695 17:58337559-58337581 TGCAGAACGTGGAGGTGAACGGG - Intergenic
1149923089 17:60677360-60677382 GGCAGAAGGCGGGTGTGGGACGG + Intergenic
1150497907 17:65623227-65623249 TGGTGAAGGTGGGTGGGGCCTGG + Intronic
1151209552 17:72534128-72534150 TGCAGGAGATGGATGTGGAAGGG - Intergenic
1151448593 17:74183073-74183095 GGGAGGAGGTGGGAGTGGACTGG - Intergenic
1152073262 17:78144528-78144550 TGCTGAAGGCGGGTGGGGAAGGG - Intergenic
1152152201 17:78609255-78609277 TGCAGATGCTGTGTGTGGCCAGG + Intergenic
1152243425 17:79172401-79172423 TGCAGGAGCTGGGAGGGGACCGG + Intronic
1152278741 17:79372923-79372945 GGCAGAAGGTGGGCGGGGACTGG + Intronic
1152517349 17:80833456-80833478 AGCAGAAGGTGGGAGGGGACCGG - Intronic
1152612415 17:81322368-81322390 TCCAGAAGGCGGGTGGGCACCGG - Intronic
1152747170 17:82046411-82046433 TGCAGAGAGTCAGTGTGGACAGG - Intergenic
1152755163 17:82084161-82084183 TGCAGCAGGTGGGTCAGCACAGG + Intronic
1152936985 17:83144887-83144909 CACAGAAGCTGGGTGTGGACGGG - Intergenic
1154496829 18:14967447-14967469 TGAAGAGGGTGGGTCTGGTCTGG + Intergenic
1155298505 18:24407510-24407532 AGCTGAAGCTGGGAGTGGACTGG - Intergenic
1155577489 18:27263907-27263929 TGCAGAAGGATGGTGGAGACTGG - Intergenic
1155996844 18:32339505-32339527 TACAGAAGATGGGTTTGGGCTGG + Intronic
1157268469 18:46249572-46249594 TGCAGAGAGTAGGTGTGGGCAGG - Intronic
1157442035 18:47718912-47718934 TGTAGGAGGTGGGTGGGGAAAGG - Intergenic
1157589712 18:48829033-48829055 AGCTGAAGGTGGGAGGGGACCGG + Intronic
1158015359 18:52776618-52776640 TGCAGGAGGTGGGGATGGGCGGG + Intronic
1159753790 18:72337575-72337597 TGAAGAAGGTGGATGTGAACTGG + Intergenic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160527517 18:79546246-79546268 TGGAGAGGGTGAGTGTGGAGAGG - Intergenic
1160527527 18:79546306-79546328 TGGAGAGGGTGAGTGTGGAGAGG - Intergenic
1160527533 18:79546336-79546358 TGGAGAGGGTGAGTGTGGAGAGG - Intergenic
1160527549 18:79546411-79546433 TGGAGAGGGTGAGTGTGGAGAGG - Intergenic
1160527561 18:79546471-79546493 TGGAGAGGGTGAGTGTGGAGAGG - Intergenic
1160527567 18:79546501-79546523 TGGAGAGGGTGAGTGTGGAGAGG - Intergenic
1161852225 19:6743591-6743613 TGGAGAAGGTGTGTGTGGCGGGG + Exonic
1162343812 19:10108127-10108149 TGCACAAGGTGGGTCTGGCCTGG + Exonic
1162405285 19:10469432-10469454 TGGAGAAGGGGGGAGGGGACAGG - Exonic
1163304563 19:16469800-16469822 TGCAGCAGGTGGCTGTGATCTGG - Intronic
1163432557 19:17276932-17276954 AGTAGCAGGCGGGTGTGGACAGG + Intronic
1165039534 19:33059258-33059280 TGAAGAAGTTGGGTGGGGAATGG - Intronic
1165349970 19:35269915-35269937 TGACCCAGGTGGGTGTGGACGGG + Exonic
1165840626 19:38787360-38787382 TGCAGGAGTTGGGTGGGGAGTGG + Intergenic
1165929441 19:39346759-39346781 TGCAGACCCTGGGTCTGGACAGG + Intronic
1166293861 19:41879458-41879480 TGCAGGAGGTGGGCGGGGCCAGG + Intronic
1167775325 19:51550830-51550852 ATCCAAAGGTGGGTGTGGACTGG + Intergenic
1202696823 1_KI270712v1_random:132030-132052 TGCAGACGGTGGGCGGGGGCCGG + Intergenic
925124122 2:1441687-1441709 GGTAGGAGGTGGGTGTGGGCAGG + Intronic
925268350 2:2583249-2583271 TGCAGAAGATTGGTGTGAAGAGG + Intergenic
925687437 2:6487437-6487459 TGCAGACGGTGGGAGTGGAGAGG - Intergenic
926060295 2:9800884-9800906 TGCAGCTGGTGGGGGTGGAGGGG + Intergenic
927240454 2:20916050-20916072 TGTTAAAGGTGGGTGTGGAGTGG + Intergenic
927908501 2:26879842-26879864 AGCAGAAAGCAGGTGTGGACAGG - Intronic
927928028 2:27026559-27026581 TAAATAGGGTGGGTGTGGACAGG - Exonic
927949717 2:27159311-27159333 TGTAGGAGGTGGGTGGGGGCTGG - Intergenic
927954873 2:27201197-27201219 TGTAGGAGGTGGGTGGGGGCTGG - Intronic
929399352 2:41562190-41562212 TGCAGGAGCTTGATGTGGACTGG - Intergenic
929764132 2:44830114-44830136 AAGAGGAGGTGGGTGTGGACGGG - Intergenic
929925200 2:46201817-46201839 TGAAGAAGGTGGGGGTGGAGGGG + Intergenic
930104361 2:47628448-47628470 AGCAGAAGGTGGAGGTGGACAGG - Intergenic
931387329 2:61809415-61809437 TTCAGAAGGGAGGTCTGGACTGG - Intergenic
931953572 2:67392759-67392781 TGGAGAAGCTGGCTATGGACTGG + Intergenic
932396983 2:71455123-71455145 TGCAGATGGTGTCTGTGAACAGG - Intronic
932621739 2:73268980-73269002 TGGAGAAGCTGGAGGTGGACCGG - Exonic
932706885 2:74032780-74032802 TGCAGCAGGTGGGGGTGAAGGGG - Intronic
933663325 2:84945155-84945177 TGCAGAGGGTGGGTGGTGAGAGG - Intergenic
934277978 2:91589044-91589066 TGCAGACGGTGGGCGGGGGCCGG + Intergenic
934781056 2:96969963-96969985 TGCAGAAGTTAAGTGTGGGCGGG - Intronic
936091832 2:109506509-109506531 TGCAGAGGGTGGGGCAGGACAGG + Intergenic
938341902 2:130541404-130541426 CGCAGACGGGGGGTGTGGATCGG + Intronic
938693790 2:133816236-133816258 TGCACTAGGTGGGTGGTGACAGG - Intergenic
942236610 2:173914725-173914747 TGTAGAAATTGGGGGTGGACTGG - Intronic
942321689 2:174741741-174741763 TCCAGGAGGAGGGTGTGGATTGG - Intergenic
947506923 2:230714049-230714071 TGCAGAAGAGGTGTGTGGAAGGG + Intronic
947844640 2:233234085-233234107 GACAGGAGGTGGGTGTGGATGGG - Intronic
1171187120 20:23130409-23130431 TTCTGAAGTTGGGCGTGGACAGG + Intergenic
1171424225 20:25039555-25039577 GGCCGAGGGTGGGTGTGGAATGG + Intronic
1171877709 20:30593828-30593850 TGCAGGAGCTGGGTGGGGAAGGG + Intergenic
1174944297 20:54967884-54967906 TTCAGAATGTGAGTGTTGACAGG - Intergenic
1174950307 20:55035237-55035259 AGCAGAAGGTGATTGTGGAAGGG + Intergenic
1175261946 20:57680262-57680284 TGCAGAATGCGGGTGTTGACGGG - Intronic
1175845009 20:62053570-62053592 TGCTGCAGGTCGGCGTGGACGGG - Intronic
1175876371 20:62232172-62232194 TGCAGGAGGTGGGTGTGGGTCGG - Intronic
1176144810 20:63560852-63560874 TGCAAAACCTGGGTCTGGACCGG - Exonic
1176381927 21:6117990-6118012 TGCAGACCCTGGGCGTGGACCGG + Exonic
1177097041 21:16849080-16849102 GCCATAAGGTGGGAGTGGACTGG + Intergenic
1178622773 21:34191078-34191100 TGCAGAAAATGGATGTGGAATGG + Intergenic
1179299109 21:40090551-40090573 TGCAAAAGGAGGGAGTGGTCAGG - Intronic
1179502564 21:41819468-41819490 TGGGGAAGGTGGGTGTGGCGGGG - Intronic
1179741545 21:43420249-43420271 TGCAGACCCTGGGCGTGGACCGG - Exonic
1180000887 21:44995059-44995081 TGGGGCCGGTGGGTGTGGACTGG + Intergenic
1180008570 21:45034771-45034793 TGCAGAAGGTGGAGGTGGGAGGG + Intergenic
1180090818 21:45533143-45533165 TGGAGGAGGTGGGGGTGGGCAGG - Intronic
1180461723 22:15571927-15571949 TGGAAAAGGTGGGCGTGGATGGG + Intergenic
1181171029 22:21010195-21010217 TGAGGGAGGTGGGTGGGGACTGG - Intronic
1181458303 22:23071606-23071628 TGCACCGGGTGGGAGTGGACTGG + Intronic
1181466806 22:23114814-23114836 TCAACAAGGTGGGTGAGGACAGG - Intronic
1181932739 22:26415756-26415778 TGCAGAAGGTGGGTGGTCAGGGG - Intergenic
1182119090 22:27775323-27775345 TCCAGAGGGTGGGAGTGGCCAGG + Intronic
1182254693 22:29030122-29030144 TGGAGCAGGAGGGTGTGGACAGG + Intronic
1182438326 22:30345756-30345778 TGCAGAAGGCAGGTCTGGACAGG + Intronic
1182510107 22:30813588-30813610 TGCAGCAGCTGGGTGAGGATGGG - Intronic
1182519441 22:30876980-30877002 TGCAGAAGGTGGGTGGCCAGTGG - Intronic
1183328326 22:37206243-37206265 GGCAAAAGGTGGGTGCAGACTGG - Exonic
1183354135 22:37349464-37349486 CGCTGGAGGTGGGTGTGGGCAGG - Intergenic
1183647757 22:39136311-39136333 TCCAGGAGGTGGGTGTGGTTGGG - Intronic
1184046515 22:41975832-41975854 TGCAGCAGTTGTGTGTGGACAGG - Intergenic
1184099188 22:42332911-42332933 GGCAGCAGGTGGGGGTTGACTGG + Intronic
1184114866 22:42416599-42416621 CACAGAAGGTGGGTGTAGAGGGG + Intronic
1185048239 22:48539903-48539925 GGCAGAAGGTGGGAGGGGATGGG + Intronic
1185112765 22:48911235-48911257 TTCAGAACCTGGGTGTGGGCGGG - Intergenic
1185112856 22:48911799-48911821 TTCAGAACCTGGGTGTGGGCGGG - Intergenic
1185320077 22:50196533-50196555 TGCTGAAGATGGGGGTGGCCTGG + Intronic
1185420894 22:50733795-50733817 TGCAGGAGGTGGGGGGAGACTGG - Intergenic
949839780 3:8307159-8307181 AACAGAAAGTGGGAGTGGACAGG - Intergenic
950374014 3:12555746-12555768 TGCAGGGGGTGGGTGGGGGCTGG - Intronic
950526663 3:13528440-13528462 TGCAGAAGGTGGGAGTGGGGTGG - Intergenic
950965960 3:17145881-17145903 GGCAGAAGGTGGCTGAGAACTGG + Intergenic
952262486 3:31753970-31753992 TGGAGAAGGGGGTTGTGGATTGG - Intronic
953134013 3:40167232-40167254 TGCAGAAGGTAGGTGGGTCCTGG + Exonic
955345845 3:58161315-58161337 GGCAGAGGGTGGGTGAGGATTGG + Intronic
955702256 3:61693618-61693640 TGCACAAGGTGTGTGTGTTCAGG + Intronic
955757679 3:62242023-62242045 TGGAGAAGGTGGGGGAGGAGAGG + Intronic
956903718 3:73743903-73743925 GGCAGAAGGTGGGTGAGGGTTGG + Intergenic
956910414 3:73810298-73810320 TGAAGAATGCGGGTGTGGATGGG + Intergenic
957505529 3:81115851-81115873 TGCAGGAGGTGGGGGTGGGGCGG + Intergenic
957624342 3:82640408-82640430 TGCAGCAGGGAGGTGTGGCCCGG + Intergenic
960868778 3:122228896-122228918 TTGAGATGGTAGGTGTGGACAGG - Intronic
961107314 3:124253081-124253103 TTCAGAAAGTGGGTGTGGCTTGG + Intronic
961523296 3:127480636-127480658 AACAGAAAGTGGGTGTGGAGGGG + Intergenic
965679265 3:171233653-171233675 TGGAGAATGTGGGAATGGACAGG + Intronic
966887238 3:184383434-184383456 TGCAGAAGGTGGGGGAGGGGTGG + Intronic
967344397 3:188437993-188438015 TGTATAAGGTGGGTAGGGACAGG + Intronic
967671271 3:192238345-192238367 GGCTGAGGGTGGGTGTGCACTGG + Intronic
968552584 4:1231305-1231327 TGCAGGAGGTGGGTGCAGCCAGG + Intronic
968585527 4:1414466-1414488 TGCAGGAGGTGGGTGGAGATGGG + Intergenic
968585568 4:1414588-1414610 TGCAGGAGGTGGGTGGAGATGGG + Intergenic
968983406 4:3863041-3863063 TGCAAAAGGTGGGGGTGGGGAGG + Intergenic
969176490 4:5402824-5402846 AGCAGAAGGTGGCTGAGGCCAGG + Intronic
969452589 4:7283363-7283385 AGCAGAAGGTGGGTGTTGGCTGG + Intronic
969462696 4:7337150-7337172 TGCAGAAGGTGGGGCTGGAAGGG + Intronic
969584886 4:8085790-8085812 TCCAGCAGGTGGGTCTGGAAGGG - Intronic
969610368 4:8224695-8224717 TGAAGAGGGTGGGGGTGCACTGG + Intronic
969909542 4:10430844-10430866 TGAAGCAGGTGGGTGGGGATGGG - Intergenic
970335344 4:15033858-15033880 GTCAGAGGGTGGGTGTGGAGAGG + Intronic
970359900 4:15298510-15298532 TGCAGAAGGTGAGGTTGGACAGG - Intergenic
971217377 4:24673885-24673907 TTCAGAATGTGGGTGTTGAAGGG + Intergenic
972632355 4:40853366-40853388 TGGAAGAGGTGGGTGGGGACAGG - Intronic
978559966 4:110022549-110022571 AGCAGAAGCTGTGGGTGGACTGG + Intergenic
980994937 4:139771040-139771062 TCCAGAAGGAGGGTGTGGTGTGG - Intronic
982694789 4:158587211-158587233 TGCAGAAGGTGAGTGAGAAATGG - Intronic
984925323 4:184801368-184801390 TGCAGAATGAGGGTGGGAACTGG + Intronic
985544134 5:500710-500732 TGGGGCTGGTGGGTGTGGACGGG + Intronic
985544168 5:500823-500845 TGGGGCTGGTGGGTGTGGACGGG + Intronic
986234991 5:5901069-5901091 TACAGAAGGTGGCAGTAGACGGG + Intergenic
988935515 5:36078670-36078692 TGCAGTAGAGGGGTGTGGACGGG - Intergenic
988985426 5:36613953-36613975 TGGAGAAGGTGGGAGAGGGCTGG - Intronic
988990017 5:36661579-36661601 TGCAGAGTGTGGGTGGGCACAGG + Intronic
992292525 5:75293630-75293652 TGCAGAAGGTGGGTGATTTCTGG - Intergenic
992834794 5:80629750-80629772 TGGAGAAGCTGGGTTTGGAAGGG - Intronic
993041494 5:82819681-82819703 AGCAAACGGTGGCTGTGGACAGG + Intergenic
993219301 5:85070059-85070081 TGCAGAAGCCAGGTGTGGCCTGG + Intergenic
993669341 5:90741183-90741205 GGTAGAAGGTGGCTGGGGACTGG - Intronic
995614987 5:113951863-113951885 TGCAAAGGGTGGGGGTGGATGGG - Intergenic
997398131 5:133580890-133580912 TGAAGGAGGCGGGTGTGGAGAGG - Intronic
998065399 5:139153941-139153963 TGAAGAAGTTGGGTCTGGGCTGG - Intronic
998623631 5:143821638-143821660 AGCAGAAAGTGGGTATGGAATGG + Intergenic
999438184 5:151580726-151580748 GGCAGAGGGTGGGTGTGAAGTGG + Intergenic
999635571 5:153618481-153618503 AACAGCAGGTGGGTGTAGACTGG + Intronic
999822341 5:155240437-155240459 AGAAGAAGGAGGGTGTAGACAGG - Intergenic
1001579934 5:172791575-172791597 TGAAGAAGCTGGGTGTGGGTGGG - Intergenic
1001653238 5:173329723-173329745 TCCAGGAGGAGGGTGGGGACGGG - Intergenic
1001735855 5:174000021-174000043 TGTAGAAGGTGTGTGTTGACTGG + Intronic
1001936927 5:175711998-175712020 TGCAGCAGGTGGGGGTGGACAGG + Intergenic
1002741574 5:181438438-181438460 GGCAGGAGGTGGGTGGGGACCGG - Intergenic
1003558099 6:7158457-7158479 TACAGAGGGTGTGTGTGGAGTGG - Intronic
1004048440 6:12049064-12049086 AGCAAAAGGTGGGTGTGGGCAGG + Intronic
1005560223 6:27032563-27032585 TGATGAAGGTGTGTGTAGACAGG - Intergenic
1005826061 6:29632574-29632596 GGCAGGAGGAGGGTGGGGACAGG - Intronic
1006391753 6:33762839-33762861 AGCAGATGGTGGGTGTGGGATGG - Intergenic
1006398799 6:33803918-33803940 TGGAGAAAGTGGGTGGGGAGTGG - Intronic
1006644383 6:35505988-35506010 AGAAGAAGGTGGGTGGGGAGAGG - Exonic
1007230556 6:40344976-40344998 TGAAGGAGCTGGGTGTGGGCTGG - Intergenic
1007520672 6:42450231-42450253 TGCAGAAGGTGGGTGCTAACTGG + Intronic
1007642684 6:43355237-43355259 AGGAGAAGGTGGGTGTGGATGGG + Exonic
1008043151 6:46823238-46823260 TGCAGAAGTGTGGTGTGGCCAGG - Intronic
1008155475 6:48008787-48008809 TGGAGAGGGTGGCTGTGGTCAGG + Exonic
1008535541 6:52504054-52504076 TGCTGAAGGTGGGTGATGACTGG + Intronic
1012447595 6:99322539-99322561 TGCAGAAGGTGGGTTTTCACTGG - Intronic
1012945571 6:105461970-105461992 TTAAGAAGGTGGGTGGGGGCAGG - Intergenic
1015464460 6:133533279-133533301 TGCAGCAGGTGGGTGGGTGCAGG - Intergenic
1015663933 6:135605727-135605749 TACAGAAGGTTGGTTTGGAAAGG + Intergenic
1017035367 6:150262421-150262443 TGAAGAAGGAGGGTGGGGAAGGG - Intergenic
1017062112 6:150493556-150493578 TGGAGAAGGTGTGTGTGTAGAGG + Intergenic
1017140036 6:151182177-151182199 TCCAGAATGTGTGTGTGGAAGGG + Intergenic
1017716868 6:157218936-157218958 GACAGAAGGTGGATGTGCACCGG - Intergenic
1018903288 6:168061792-168061814 GGCAGAAGGTGGGGCTGGGCTGG - Exonic
1019246712 6:170714203-170714225 GGCAGGAGGTGGGTGGGGACCGG - Intergenic
1020034761 7:4958294-4958316 TGAAGAAGGTGGGCGTGGGGAGG - Intronic
1020044617 7:5031775-5031797 TGGAGGAGGTGGGTGGGGCCTGG - Intronic
1020829933 7:13082178-13082200 GGCAGAAGAAGGGTGTGAACCGG + Intergenic
1021026552 7:15674795-15674817 TGGGGAAGATGGGTGTGAACAGG + Intronic
1021231530 7:18091397-18091419 AGAAGGAGATGGGTGTGGACTGG + Intronic
1021623645 7:22572006-22572028 GGAAGAAGGTAGGTTTGGACTGG + Intronic
1021940692 7:25676165-25676187 CTCAGAAGCTGGGTGTGGAAAGG - Intergenic
1023543029 7:41287282-41287304 AGCAGAAGGTGAGTGGGGTCAGG - Intergenic
1023878679 7:44306717-44306739 AGCAGGAGGAGGGTGTGGGCAGG + Intronic
1023995549 7:45157358-45157380 GGCAGAGGGTGGGGGTAGACCGG - Intergenic
1025227953 7:57180117-57180139 TGCAGGAGGAGGCTGCGGACAGG + Intergenic
1026177973 7:68014444-68014466 TGCAGCAGATGGATGTCGACGGG + Intergenic
1027848246 7:83413590-83413612 AGCAGAATGTGAGTGTGAACCGG - Intronic
1028693223 7:93677455-93677477 GGCAGAAGGTCTGTCTGGACAGG + Intronic
1029397745 7:100319801-100319823 TGGAGGAGGTGGGTGGGGCCTGG + Exonic
1029402321 7:100353794-100353816 TGCAGCAGGTGGGCCTGGCCAGG - Intronic
1030139473 7:106290373-106290395 TGTGGAAGCTGGGTGGGGACTGG - Intergenic
1030698712 7:112615201-112615223 TGGAGAAAGTGGGGGTGGAGAGG + Intergenic
1031878513 7:127169268-127169290 TGGAGAAGGTTAGAGTGGACTGG + Intronic
1032613461 7:133441296-133441318 AGCAGAAGGTAGGTTGGGACTGG + Intronic
1033320014 7:140330886-140330908 TGCAGAAGGTTCGTGTAGACAGG + Intronic
1034202434 7:149290898-149290920 GGAAGAAGGTGGGGGTTGACAGG + Intronic
1035394670 7:158527218-158527240 TGGAGAAGCTGGGTGTGGGGTGG - Intronic
1035501430 8:93758-93780 GGCAGGAGGTGGGTGGGGACCGG + Intergenic
1036141764 8:6215594-6215616 GGCAGAAGGAGGGTGAGGATTGG - Intergenic
1037583607 8:20261539-20261561 TGCAGAAGGGGGCTGGGGATGGG - Intronic
1037992985 8:23333625-23333647 TGCAGACGATGGGAGGGGACAGG + Intronic
1038041151 8:23725428-23725450 TGCAGAAGGTGGCTGGGGTGTGG + Intergenic
1038413547 8:27376388-27376410 AGCAGCAGGTGGGCCTGGACTGG + Intronic
1038973743 8:32668248-32668270 TGCAAAAGGGGGATATGGACAGG - Intronic
1040335392 8:46413416-46413438 TGCCGCAGGTTGGTGTGGGCGGG + Intergenic
1040751534 8:50714712-50714734 TCCAGGAGGTGGGTGTGGAGAGG + Intronic
1041274373 8:56142326-56142348 TGCTGACGGTGGGTGTGCACAGG + Intergenic
1041727363 8:61030635-61030657 CCGAGAAGGTGGCTGTGGACAGG + Intergenic
1041814278 8:61950345-61950367 TGGAGAAGGTTGGAGTGGAGAGG - Intergenic
1043531089 8:81150800-81150822 TGAATAAGGTGGGTGTAGCCGGG - Intergenic
1043610192 8:82053646-82053668 TGCAGGGTGTGGGTGTGCACAGG - Intergenic
1043952097 8:86320674-86320696 GGCAGAATTTGGGTGGGGACAGG + Intronic
1044920925 8:97168550-97168572 TGTAGAGGGTGGGTGAGGTCAGG - Intergenic
1044942118 8:97354059-97354081 AGCAGAGGGTGGGTGTGAAGGGG - Intergenic
1048598012 8:135887181-135887203 TGCAGAGTGTGTGTGTAGACAGG + Intergenic
1048817332 8:138345839-138345861 CTGAGAAGGTGGATGTGGACAGG + Intronic
1049241741 8:141540873-141540895 TGAAGCATGTGCGTGTGGACAGG - Intergenic
1049278142 8:141730197-141730219 TGCAGCTGGTGGGTCTGGGCAGG - Intergenic
1049686630 8:143941742-143941764 TGTAGAGGGTGGGTGTAGCCTGG - Intronic
1049788656 8:144463011-144463033 TGCAGAAGGTGGGCGGGGAGGGG + Intronic
1051340078 9:16102907-16102929 AGCTGAGGGTGGGTATGGACTGG - Intergenic
1051507183 9:17840050-17840072 TGCTGTAAGTGGGTGTGGTCTGG - Intergenic
1051819631 9:21149620-21149642 TGCTGAAAGTGGGTGTAGACAGG + Intergenic
1052916580 9:33927941-33927963 TGGAGAAGGTGGCTGAGGACTGG + Exonic
1054451232 9:65404481-65404503 TGCAGGCTGTGGGTGGGGACTGG - Intergenic
1054877163 9:70109006-70109028 AGGTGAAGCTGGGTGTGGACTGG + Intronic
1056728934 9:89147358-89147380 GGCAGAAGGTGGGTGAAGCCAGG - Intronic
1058574532 9:106386143-106386165 AGGTGAAGGTGGGTGAGGACAGG - Intergenic
1059510377 9:114839621-114839643 TGCTGCAAGTGGGTGTGGCCAGG - Intergenic
1060227006 9:121798618-121798640 TGCAGAGGGTGGGGGTGGGCTGG + Intergenic
1061640672 9:131952520-131952542 TGGAGAGGGTGGGTCTGGAGAGG - Intronic
1062034697 9:134377829-134377851 TGATGGAGGTGGGTGTGGAGGGG - Intronic
1062278324 9:135740981-135741003 TGCAGAACCTGGCTGAGGACTGG - Intronic
1062350062 9:136134122-136134144 TGCTGAGGGTAGGTGTAGACAGG + Intergenic
1203492340 Un_GL000224v1:118982-119004 TGCAGGAGCTGGGTGGGGAAGGG + Intergenic
1203504963 Un_KI270741v1:60854-60876 TGCAGGAGCTGGGTGGGGAAGGG + Intergenic
1203607485 Un_KI270748v1:69654-69676 GGCAGGAGGTGGGTGGGGACCGG - Intergenic
1186897393 X:14017646-14017668 TCCAGAAGGTGGGAGAGGCCTGG - Intronic
1189563066 X:42210669-42210691 TAAAGAAGCTGGGTGTGGCCGGG - Intergenic
1190396772 X:49993155-49993177 TGGAGAAGGTGGGTGTGGGGAGG - Intronic
1191601867 X:63017269-63017291 TGCAGAAGGTGGGTGATTTCTGG - Intergenic
1191736012 X:64388519-64388541 TGGAGAAGTAGGGTGTGGAGAGG - Intronic
1192199969 X:69060523-69060545 TGCTGGAGGTGGGGGTGGACTGG + Intergenic
1192346631 X:70314299-70314321 TTCAGAAGGTGGATATGGCCCGG + Intronic
1195731280 X:107970354-107970376 GGAAGAAGCAGGGTGTGGACGGG - Intergenic
1196898597 X:120361756-120361778 TGCAGGGGGTGGGTGTGGGTGGG - Intergenic
1197761088 X:130028884-130028906 TGTAGAAGGTGTGTGTGGCGGGG + Intronic
1199363056 X:146944664-146944686 TGCTGAATGTGGGTGTGGAGGGG + Intergenic
1200088549 X:153623756-153623778 AGCAGCAGGTGGGTGCTGACGGG - Intergenic
1200100098 X:153685938-153685960 GGAAGAAGGTGGGTGTGGGAAGG + Intronic
1201132146 Y:10960532-10960554 TGCAAAAGGATGGAGTGGACTGG - Intergenic