ID: 1092138451

View in Genome Browser
Species Human (GRCh38)
Location 12:6166418-6166440
Sequence CTGTGGAGAGGGAGCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092138451_1092138460 16 Left 1092138451 12:6166418-6166440 CCTTCCATGCTCCCTCTCCACAG No data
Right 1092138460 12:6166457-6166479 TGTATGTGATACACACGCACAGG No data
1092138451_1092138461 20 Left 1092138451 12:6166418-6166440 CCTTCCATGCTCCCTCTCCACAG No data
Right 1092138461 12:6166461-6166483 TGTGATACACACGCACAGGCAGG No data
1092138451_1092138457 -9 Left 1092138451 12:6166418-6166440 CCTTCCATGCTCCCTCTCCACAG No data
Right 1092138457 12:6166432-6166454 TCTCCACAGGAACACAGGCATGG No data
1092138451_1092138458 -8 Left 1092138451 12:6166418-6166440 CCTTCCATGCTCCCTCTCCACAG No data
Right 1092138458 12:6166433-6166455 CTCCACAGGAACACAGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092138451 Original CRISPR CTGTGGAGAGGGAGCATGGA AGG (reversed) Intergenic
No off target data available for this crispr