ID: 1092139423

View in Genome Browser
Species Human (GRCh38)
Location 12:6172506-6172528
Sequence CTGAAGTTCCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092139418_1092139423 4 Left 1092139418 12:6172479-6172501 CCTGTGTGAATGACAAGGAAGTG No data
Right 1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG No data
1092139417_1092139423 5 Left 1092139417 12:6172478-6172500 CCCTGTGTGAATGACAAGGAAGT No data
Right 1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092139423 Original CRISPR CTGAAGTTCCAGAGGGAGGA AGG Intergenic
No off target data available for this crispr