ID: 1092143752

View in Genome Browser
Species Human (GRCh38)
Location 12:6200901-6200923
Sequence CCTTCCTCTCTGGCACTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092143752_1092143759 5 Left 1092143752 12:6200901-6200923 CCTCCGAGTGCCAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1092143759 12:6200929-6200951 AGAAGCGGAGCACCCCTCTTTGG 0: 1
1: 0
2: 2
3: 5
4: 70
1092143752_1092143764 18 Left 1092143752 12:6200901-6200923 CCTCCGAGTGCCAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1092143764 12:6200942-6200964 CCCTCTTTGGGCCAAGGCCAAGG 0: 1
1: 0
2: 0
3: 37
4: 248
1092143752_1092143760 6 Left 1092143752 12:6200901-6200923 CCTCCGAGTGCCAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1092143760 12:6200930-6200952 GAAGCGGAGCACCCCTCTTTGGG 0: 1
1: 0
2: 1
3: 3
4: 44
1092143752_1092143766 21 Left 1092143752 12:6200901-6200923 CCTCCGAGTGCCAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1092143766 12:6200945-6200967 TCTTTGGGCCAAGGCCAAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 220
1092143752_1092143767 28 Left 1092143752 12:6200901-6200923 CCTCCGAGTGCCAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1092143767 12:6200952-6200974 GCCAAGGCCAAGGAGGACTGTGG 0: 1
1: 0
2: 6
3: 33
4: 327
1092143752_1092143761 12 Left 1092143752 12:6200901-6200923 CCTCCGAGTGCCAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1092143761 12:6200936-6200958 GAGCACCCCTCTTTGGGCCAAGG 0: 1
1: 0
2: 1
3: 11
4: 118
1092143752_1092143758 -10 Left 1092143752 12:6200901-6200923 CCTCCGAGTGCCAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1092143758 12:6200914-6200936 GAGAGGAAGGCAGGGAGAAGCGG 0: 1
1: 1
2: 45
3: 557
4: 4096

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092143752 Original CRISPR CCTTCCTCTCTGGCACTCGG AGG (reversed) Intronic
900040635 1:460285-460307 CCTTTCCCTCTGTCACTCTGTGG - Intergenic
900062065 1:695256-695278 CCTTTCCCTCTGTCACTCTGTGG - Intergenic
900094593 1:935084-935106 CATTGCTCTCTGGGACTCTGTGG + Intronic
901626965 1:10630053-10630075 CCTCCCTCTCTGGCCCTGGGAGG + Exonic
901923261 1:12550653-12550675 CCCTCCTGACTGGCAGTCGGTGG - Intergenic
903128949 1:21266003-21266025 TCTTCCTCTCTGGGACTTTGGGG - Intronic
903131362 1:21281509-21281531 CCTTGGTCTCTGGTACTCAGAGG + Intronic
903647497 1:24904076-24904098 CCTTCTACTCTGGCAGCCGGGGG + Intronic
904823411 1:33259174-33259196 CCTTCCTCTGTGACACTCAGAGG + Intronic
908316106 1:62934124-62934146 GATTCCTCTCTGGGACTCAGTGG + Intergenic
909085702 1:71167792-71167814 TCTGCCTCTCAGGCACTTGGGGG + Intergenic
914957744 1:152179654-152179676 TCTTCCTTCCTGGCACTGGGAGG - Intergenic
914984858 1:152447779-152447801 CCTGCCTCTTTGGCCCTCGCTGG - Intergenic
919807064 1:201386428-201386450 CCTTCCTCTCTGCTCCTTGGTGG + Exonic
921687637 1:218108364-218108386 CCTTTTTCTCTTGCACCCGGAGG + Intergenic
922150203 1:222995384-222995406 CCTGCCTCTCTGGCAATCACTGG + Intronic
1065963504 10:30752982-30753004 CCTTCCTCTGTGGGACTGGGCGG + Intergenic
1067785106 10:49240117-49240139 CCTTCCTTACAGGCCCTCGGTGG + Intergenic
1069718354 10:70534720-70534742 CCTTGGTCTCTGGCACCAGGTGG + Exonic
1072719427 10:97771635-97771657 CCTGCCGCTCTGCCACACGGTGG - Exonic
1074278950 10:112032934-112032956 CTTTCCTCCTTGGCACTGGGGGG + Intergenic
1074822579 10:117191912-117191934 TCTCTCTCTCTGGCATTCGGAGG - Intergenic
1075001046 10:118798133-118798155 CCTTCCTCTGGGCCACTCGCTGG + Intergenic
1076535880 10:131177379-131177401 CATTCTTTTCTGGCACACGGAGG - Intronic
1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG + Intergenic
1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG + Intergenic
1076966908 11:96508-96530 CCTTTCCCTCTGTCACTCTGTGG - Intergenic
1077297205 11:1831835-1831857 CCTTCCTCTCAGACACCCGAAGG - Intronic
1077995282 11:7447258-7447280 TCTTTCTCTCTGGCTCTCCGTGG + Intronic
1078453076 11:11454694-11454716 CCTGACTCTCTGGCTCTCTGTGG - Intronic
1078469744 11:11577451-11577473 GCTTCCTTTCTGGCACACAGTGG - Intronic
1078924785 11:15864875-15864897 ACTTCCTCTCTGGAACTGTGTGG - Intergenic
1079524330 11:21366240-21366262 CTTTCCTCTCTGGAACTCAGCGG - Intronic
1080587090 11:33692104-33692126 CTTTCCTGTCTGGCACTGAGTGG + Intergenic
1082002972 11:47403860-47403882 CCCTCCACTCTGGCAATCGAGGG - Intergenic
1084961119 11:72717239-72717261 CCTTCCTCTTGGGCTCTGGGAGG - Intronic
1085545062 11:77310706-77310728 CCTTCCTCACTGGCATTTCGGGG - Intergenic
1087358493 11:97125525-97125547 CCTTGCTTTCTGGCACTACGAGG + Intergenic
1089357064 11:117861014-117861036 CCCTCCTCTCTGCCACTCAGTGG + Intronic
1089689602 11:120179103-120179125 CTTCCCTCTCTGGCCCTTGGTGG - Intronic
1092143752 12:6200901-6200923 CCTTCCTCTCTGGCACTCGGAGG - Intronic
1093839161 12:23874880-23874902 CCTTCTTCTATGGTACTCAGTGG - Intronic
1094619314 12:32065031-32065053 ACTTCCTCTCTGGCACCTGCTGG + Intergenic
1097085959 12:56468659-56468681 CCTACCTCTCTGGGCCTCTGTGG - Exonic
1097693554 12:62756253-62756275 TCTTCCTCTCTCGCTCTCGCTGG - Intronic
1101045259 12:100798996-100799018 ACTCCCTCTCTGACACTCAGAGG - Intronic
1103887164 12:124211161-124211183 CCTTCCTCCCTGGTCCTTGGGGG + Intronic
1104902021 12:132194619-132194641 CCCTCCTCCCTGGCACCAGGAGG - Intergenic
1106780066 13:33050487-33050509 ACTCCCTCCCTGGCACACGGAGG - Intronic
1107668333 13:42716183-42716205 CCCTCCTCTCTGTCACTCTGTGG - Intergenic
1107717738 13:43217175-43217197 ACTGCCTCTCTGGCCCTGGGTGG + Intronic
1112183126 13:97104594-97104616 CCCTCATCTCTGGCTCTAGGTGG - Intergenic
1114394193 14:22342077-22342099 CCTTCCTTTCTGGTATTAGGAGG - Intergenic
1117911602 14:60642581-60642603 CTCTCCTCTCAGGCACTCCGCGG + Intergenic
1119694027 14:76698410-76698432 CCTTCCCTTCTCGCACTGGGTGG + Intergenic
1121547327 14:94771560-94771582 TCTCCCTCTCCGGCTCTCGGGGG - Intergenic
1124007397 15:25805595-25805617 CATTCCTCTCTGGCACTTCCTGG + Intronic
1124162890 15:27290053-27290075 CCTTGCTTTCTGGCACTAGAAGG - Intronic
1124613144 15:31222940-31222962 TCTTCCTCTCTGCCACCCTGAGG - Intergenic
1129936380 15:79453590-79453612 TCTTCCTCTCTGGTTCTCGTTGG + Intronic
1132441268 15:101867327-101867349 CCTTTCCCTCTGTCACTCTGTGG + Intergenic
1132569234 16:636963-636985 CCTTCCCCTCCGGCACTGGGGGG - Intronic
1132712091 16:1273472-1273494 CCTTCCTCCCTCACACTGGGAGG - Intergenic
1133998614 16:10765913-10765935 CCTTCCTTTCTGGCACTCCCTGG - Intronic
1134487227 16:14668076-14668098 CCTTCCTCACAGGGACTAGGAGG + Exonic
1135173489 16:20207786-20207808 CCTTCCTCTCTGTCATTTAGGGG + Intergenic
1137801804 16:51268329-51268351 TCTTCATCTCTGTCACTCTGAGG + Intergenic
1138184633 16:54966994-54967016 CCTTCCCCTCTGACATTCCGAGG + Intergenic
1138454983 16:57115980-57116002 ACTTCCTCTCTGGGTCTCAGGGG - Intronic
1139469809 16:67172091-67172113 CCTCCTTCTCTGGCTCTAGGAGG - Intronic
1144424564 17:15129782-15129804 CCAGCCTCCCTGGCACTCAGAGG + Intergenic
1146819279 17:35971595-35971617 CCCTCCCCTCTGGCTCTCAGGGG + Intergenic
1147176235 17:38657877-38657899 CCTTCTTTTCTTCCACTCGGAGG - Intergenic
1148676800 17:49450523-49450545 ACTTCCTCACGGGCACTGGGTGG - Intronic
1151687980 17:75660840-75660862 CCTTCCCCTCTAGCCCTCGAAGG + Intronic
1152077643 17:78168989-78169011 CCTGCCTCGCTGGCAGTGGGAGG + Intronic
1152350924 17:79783860-79783882 CCTTCTTCTGCGGCACTGGGTGG - Exonic
1156447948 18:37250675-37250697 CCTCCCTCGCTGGCAGTCCGAGG + Intronic
1158045703 18:53153029-53153051 CCCTCCTCTCTGGCACTCCCTGG + Intronic
1160643711 19:166131-166153 CCTTTCCCTCTGTCACTCTGTGG - Intergenic
1161684749 19:5697217-5697239 CCTTCCTCACTGTCTCTCGTGGG - Intronic
1163633720 19:18429211-18429233 CCTTCCTCTCTCGCCCTCCGAGG + Intronic
1165749801 19:38252971-38252993 CCTCCCTCCCTGGCCCTAGGAGG - Exonic
1166258300 19:41620917-41620939 CCTTCCTCTCAGGCAAACGCAGG - Intronic
925189099 2:1868671-1868693 CCCCCTTCTCTGGCACTCGTGGG + Intronic
925964653 2:9052770-9052792 TCTTTCTCTCTGGGACTCTGGGG - Intergenic
926027064 2:9555106-9555128 CCTTCCTTTCTGGCTCTGGTAGG + Intronic
926055708 2:9772764-9772786 CTTTCCTCCCGGGCACACGGGGG + Intergenic
926222695 2:10946614-10946636 CCTTGCTCTCTGGGCCTCCGTGG - Intergenic
926321033 2:11748572-11748594 CCCTCCTCGCTGGCACCCTGTGG - Intronic
929038323 2:37718691-37718713 CCTTTTTCTCTGGCACTCACAGG - Intronic
929798866 2:45082587-45082609 CCTTCCTCTCAGGTCCTGGGGGG + Intergenic
930219521 2:48732236-48732258 CCTTCCTCTCTGCCAGTCCTTGG - Intronic
931868217 2:66433961-66433983 TCTTTTTCTCTGGCACTGGGAGG + Intronic
933775963 2:85771399-85771421 ATTTCCTCTCTGGCACTCACCGG - Intronic
934163073 2:89270678-89270700 CCTCCCTCTTTGGCACTAGTAGG - Intergenic
934204200 2:89911846-89911868 CCTCCCTCTTTGGCACTAGTAGG + Intergenic
936433234 2:112482157-112482179 CTTTCCTCTCCGGCACCCGGCGG + Exonic
936654312 2:114467005-114467027 TCTTCCTCTCTCGCCCTGGGAGG - Intronic
940219606 2:151337930-151337952 CCTTCCTATTTGTCACTCTGGGG - Intergenic
942484422 2:176424158-176424180 CCTTAGTGTCTGGCACTCCGGGG + Intergenic
946244879 2:218381787-218381809 CCTTCCTCTGTGGCCCTCAAAGG + Intergenic
946347514 2:219123002-219123024 CCTACGTCCCTGGCACTGGGGGG + Intronic
947619803 2:231582607-231582629 CCTTGCTCTGTGGGACTCTGGGG + Intergenic
948547058 2:238740210-238740232 CCCGGCTCTCTGGCCCTCGGAGG - Intergenic
1168935852 20:1664842-1664864 CCTTCCACGCAGGCACTCAGAGG + Intergenic
1169350888 20:4867111-4867133 CCTTCCACTCAGGCAGTCTGTGG + Intronic
1171010946 20:21509132-21509154 CCTTCCTCTCTGGAAACCTGAGG + Intergenic
1171495806 20:25554297-25554319 CTGTCCACTCTGGCACTCAGGGG - Intronic
1172292000 20:33783608-33783630 CCTTCCTTTCTGGCTATCAGGGG - Intronic
1173670151 20:44793374-44793396 CATTCATCTGTGGCACTTGGAGG - Intronic
1174456324 20:50651220-50651242 CCTTCCTAGCTGTCACTGGGGGG - Intronic
1175950900 20:62582469-62582491 CCTTCCTCTCCGTCCCTCCGAGG - Intergenic
1179797074 21:43791286-43791308 GCTTCCTTTCTGGCACTCGAAGG + Intronic
1180877462 22:19181352-19181374 CCTCGCTCTCTGGCAGTGGGTGG - Intronic
1182557947 22:31139172-31139194 CCTTTCTCACTGGCACAAGGAGG + Intronic
1183666635 22:39249973-39249995 CCTGCCTCCCTGGCACTCACAGG - Intergenic
1184212050 22:43041907-43041929 GCTTCCTCTCTGGCTCTCGAAGG + Intronic
1184880476 22:47301072-47301094 CCTTCCTCAGTGGCGCTGGGAGG + Intergenic
1185029219 22:48432791-48432813 CCTCCCTCTCTGCCACTGAGGGG + Intergenic
950076438 3:10190610-10190632 CCTTCCTCTCTGAAACACTGGGG - Intronic
950399527 3:12759628-12759650 CCTTCCCCTCTGGGACGCGCAGG - Intronic
950613698 3:14142063-14142085 CCTTCCTCTCTTGGACTGAGTGG + Exonic
952907906 3:38155192-38155214 CCTTCCTCTCTTTCACTCTGAGG - Intergenic
953785354 3:45907131-45907153 TCTTCCTCTCTGGGTCTAGGTGG + Intronic
954429670 3:50463825-50463847 CCTCCCTCCCTGGGACTCAGGGG - Intronic
954755964 3:52840145-52840167 CCTTCCACCTTGCCACTCGGTGG + Exonic
959390727 3:105770289-105770311 TCTTCCCCTCTCGCACTCTGAGG - Intronic
960054773 3:113269311-113269333 CCTTCCCCTCTGGCATTCTGTGG - Intronic
968669722 4:1842622-1842644 GCCTGCTCTCTGGCCCTCGGTGG - Intronic
970852393 4:20617126-20617148 CCATCCTTCCTGGCACTCGCAGG - Exonic
972006849 4:34120150-34120172 TCTTGCTGTCTGCCACTCGGTGG - Intergenic
980053671 4:128061111-128061133 TCGTCCTCCCTCGCACTCGGAGG + Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
987048827 5:14132322-14132344 CCTTCCTCTCTGACTCCCGGTGG + Intergenic
989283278 5:39669340-39669362 ACTTCCACTCTGGGACTCAGGGG - Intergenic
990988214 5:61660642-61660664 CCTTCCTCTCTGGCCATGGAGGG - Intronic
993786095 5:92139099-92139121 CCTTACCCTGTGGGACTCGGAGG + Intergenic
994681162 5:102889206-102889228 CCTTGCTCTCTGGCTTTCAGTGG + Intronic
994883138 5:105523907-105523929 CTTTACTCTCTTGCACTCAGGGG - Intergenic
997709110 5:135988399-135988421 CCTTCTACTCTGTAACTCGGTGG + Intergenic
998206793 5:140163002-140163024 CTTTCTTCTCTGACACTCAGTGG + Intergenic
998380484 5:141721492-141721514 CCTTCCTCTAAGCCACTCCGAGG - Intergenic
999324377 5:150634388-150634410 CATTCCTCTAGGGCACTTGGAGG - Intronic
1002472011 5:179440898-179440920 CCTTCCTCTCTAGGACACAGGGG + Intergenic
1002733211 5:181358649-181358671 CCTTTCCCTCTGTCACTCTGTGG + Intergenic
1002751328 6:115458-115480 CCTTTCCCTCTGTCACTCTGTGG - Intergenic
1005989259 6:30893079-30893101 AATTCCTCTCCGGCACTGGGAGG + Exonic
1006385524 6:33728715-33728737 CTTCCCTCACTGGCACTCTGAGG - Intronic
1007507382 6:42346436-42346458 TCTTCCTCTCTGGCTCTGGTTGG - Intronic
1007794625 6:44337586-44337608 CCTTCCTCTATGGGATTTGGGGG + Intronic
1013304848 6:108838507-108838529 CCTTCCCCTAGGGCACTCTGAGG - Intergenic
1013419450 6:109952751-109952773 CCTGCTTCTCTGGGACTCAGTGG + Intergenic
1013588705 6:111602412-111602434 CCTTCCTCTCCTTCACTCCGTGG - Intronic
1014987866 6:128033949-128033971 GCATCCTCTTTGGCACTCAGAGG - Intronic
1015970935 6:138741877-138741899 CCCTCCTTACTGGCACTTGGAGG + Intergenic
1016618403 6:146079367-146079389 CTTTCCTCTCTTGCACTCAATGG - Intronic
1018812477 6:167307931-167307953 CCTTCCTCTGTGGCAGCAGGGGG + Intronic
1019126135 6:169841178-169841200 CCGTCCTCTCTGGAACTCCCTGG - Intergenic
1019237461 6:170630971-170630993 CCTTTCCCTCTGTCACTCTGTGG + Intergenic
1019299868 7:297483-297505 ACTTCCTCTCCTGCACACGGTGG + Intergenic
1019843750 7:3475828-3475850 GCTGCCTCTCTGGCTCTCTGTGG + Intronic
1021016396 7:15540426-15540448 CTTTTCTGTCTGGCACTTGGAGG - Intronic
1028570434 7:92280514-92280536 CCTTTATCCCTGGCACTTGGAGG + Intronic
1033316033 7:140298466-140298488 CCTTCCTCTCTAGCTCCTGGAGG + Intronic
1035510306 8:175640-175662 CCTTTCCCTCTGTCACTCTGTGG - Intergenic
1037889816 8:22618023-22618045 CCTTCCTCTCTGGCCCACTTTGG - Intronic
1038937013 8:32263350-32263372 CCTTCCTGTCTGGCATTCTTGGG + Intronic
1040602220 8:48896540-48896562 CCTTCTCCTCTGGCCCTGGGTGG + Intergenic
1046598323 8:116287645-116287667 CCTTCCACTCTGCCACTTTGTGG - Intergenic
1046857711 8:119052909-119052931 CCTTCCTCTCCGGCTCTCTTTGG - Intronic
1049243024 8:141548376-141548398 CCTCCCTCTCTGGGGCACGGAGG - Intergenic
1049621446 8:143600002-143600024 CCTGCCTCACTGGCACCCTGGGG + Exonic
1061653285 9:132068336-132068358 GCTCCCTCGCTGGCACTTGGAGG - Intronic
1062333987 9:136056927-136056949 CCTTCCTCTCGGCCACCCGTGGG + Intronic
1062757616 9:138310972-138310994 CCTTTCCCTCTGTCACTCTGTGG + Intergenic
1190024548 X:46912144-46912166 TCGTCCTCTCTAGCGCTCGGCGG + Intergenic
1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG + Intergenic
1199849002 X:151711914-151711936 CCTTCCTCTCTGGCGCAGGGAGG + Intergenic