ID: 1092143791

View in Genome Browser
Species Human (GRCh38)
Location 12:6201025-6201047
Sequence GTGCCCGCACCCTCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 279}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092143791_1092143793 0 Left 1092143791 12:6201025-6201047 CCAGGAAGGGAGGGTGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1092143793 12:6201048-6201070 GGCGAGAGCTCAGCCAAGAGCGG 0: 1
1: 0
2: 1
3: 17
4: 174
1092143791_1092143795 18 Left 1092143791 12:6201025-6201047 CCAGGAAGGGAGGGTGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1092143795 12:6201066-6201088 AGCGGCTCTCACTTTTACGCAGG 0: 1
1: 0
2: 0
3: 2
4: 42
1092143791_1092143796 23 Left 1092143791 12:6201025-6201047 CCAGGAAGGGAGGGTGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1092143796 12:6201071-6201093 CTCTCACTTTTACGCAGGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 65
1092143791_1092143799 29 Left 1092143791 12:6201025-6201047 CCAGGAAGGGAGGGTGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1092143799 12:6201077-6201099 CTTTTACGCAGGAGCGGCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 88
1092143791_1092143798 28 Left 1092143791 12:6201025-6201047 CCAGGAAGGGAGGGTGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1092143791_1092143797 27 Left 1092143791 12:6201025-6201047 CCAGGAAGGGAGGGTGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1092143797 12:6201075-6201097 CACTTTTACGCAGGAGCGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092143791 Original CRISPR GTGCCCGCACCCTCCCTTCC TGG (reversed) Intronic
900292657 1:1930046-1930068 GGGCCCACACCCACCTTTCCTGG + Exonic
900497924 1:2984775-2984797 GTTCCTGCAACCGCCCTTCCGGG + Intergenic
900604934 1:3519739-3519761 CTGCCAGCAGCCTCCCCTCCCGG + Intronic
900888762 1:5433840-5433862 GAGCCAGCACCCTGCCCTCCGGG - Intergenic
900989650 1:6092454-6092476 GTTCCCTCACTCTCCCTCCCCGG - Intronic
901026256 1:6280187-6280209 GTTCCCGCATCCTCGCTCCCCGG + Intronic
901764122 1:11489158-11489180 GTACCCGCAGCCTCACTGCCTGG - Intronic
902222778 1:14977425-14977447 GTGCCCCGACCCTGCCTTTCTGG + Intronic
902374595 1:16024314-16024336 CTGCCCACACCCCCTCTTCCAGG - Intronic
902379538 1:16046086-16046108 CTGCCCACACCCCCTCTTCCAGG - Intronic
902542943 1:17167208-17167230 CTCCCCCCTCCCTCCCTTCCTGG + Intergenic
904162973 1:28535028-28535050 GTGCCCTGTCCCTCCCTTCTAGG + Exonic
904757731 1:32778019-32778041 TTGCCCACTCCCTCCTTTCCTGG - Intronic
905394370 1:37657678-37657700 GCTCCCGCACCCTGCCATCCCGG + Intergenic
905853430 1:41290993-41291015 TTGCCCTCACTCTCCCTTCCTGG + Intergenic
906168990 1:43707824-43707846 GTGCCCCGACCCCGCCTTCCCGG - Intronic
907403700 1:54241016-54241038 GGGCCGGCATCCTCCCTCCCTGG + Intronic
907488384 1:54792855-54792877 GTGACTGCCCCCTCCCCTCCTGG + Intronic
910936473 1:92486863-92486885 GTGGGCGCACCCTCCCTGCGCGG + Intronic
911659785 1:100488415-100488437 GTGCCCTCAGCCACCCTCCCGGG + Intronic
912902735 1:113670040-113670062 CTACTCCCACCCTCCCTTCCTGG + Intronic
915308563 1:154995082-154995104 GTGCCCTCTTCCTCCCTGCCTGG + Intergenic
916750508 1:167719465-167719487 ATGACCGCAGCCTCCTTTCCTGG + Intergenic
920671642 1:208008196-208008218 GTGGCCACTCCATCCCTTCCTGG + Intergenic
922567087 1:226607950-226607972 GAGCCCACACCCCCTCTTCCAGG + Exonic
923342392 1:233018989-233019011 GGGCCCCCACCCTCCCTCTCTGG + Intronic
923400688 1:233613732-233613754 CCTCCCGCTCCCTCCCTTCCTGG - Intergenic
1064103974 10:12485589-12485611 GAAGCCCCACCCTCCCTTCCAGG - Intronic
1064298917 10:14104496-14104518 GTGGCCTCACCTTCCCTTTCTGG - Intronic
1066460290 10:35607556-35607578 ATGCCCGCTTCCTCTCTTCCAGG + Exonic
1067689178 10:48490386-48490408 CTGCCCACTCCCTCCCTCCCAGG + Intronic
1068558124 10:58481699-58481721 GTTCCCTCATCCTCCCTTTCTGG - Intergenic
1068647296 10:59481823-59481845 GTCCCTGCACCCTCCCTTTTTGG + Intergenic
1069913625 10:71774232-71774254 GTGCACCCGCCCTCCCTCCCTGG + Intronic
1070641717 10:78175214-78175236 GTCTCCGCATCCTGCCTTCCTGG - Intergenic
1070912766 10:80132709-80132731 CTGCCCGCAGCCGCCCTTCCCGG - Exonic
1071983183 10:91024235-91024257 CTCCCCGCCCCCTCCCTTGCTGG + Intergenic
1073373945 10:103016803-103016825 TTGCCCGTAGCCTCCTTTCCTGG + Intronic
1073721048 10:106172047-106172069 GTGACCGCTCCTTCCCTTGCTGG - Intergenic
1074160732 10:110834427-110834449 TTGTCCTCACCCTCCCTTCTGGG - Intronic
1075169306 10:120098329-120098351 CTGCTCTCACCCTCCCTTTCTGG - Intergenic
1075596137 10:123730603-123730625 GTGCCCGCAGCCTCCAGTCAGGG - Intronic
1075861744 10:125683143-125683165 GCACCCGCACCTTCCCCTCCTGG - Exonic
1076347330 10:129788409-129788431 GAGCCCGGACCCTCCTATCCCGG + Intergenic
1076840053 10:133041394-133041416 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840072 10:133041450-133041472 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840084 10:133041480-133041502 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840100 10:133041521-133041543 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840112 10:133041551-133041573 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840129 10:133041592-133041614 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840143 10:133041637-133041659 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840149 10:133041652-133041674 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840176 10:133041723-133041745 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840186 10:133041753-133041775 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840203 10:133041794-133041816 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840217 10:133041839-133041861 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840250 10:133041936-133041958 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840265 10:133041981-133042003 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840286 10:133042037-133042059 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840307 10:133042093-133042115 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076903444 10:133350997-133351019 GTGTCTGCACCACCCCTTCCTGG - Intronic
1077404657 11:2377635-2377657 GTGCCTGCCCCCTCCCGCCCCGG - Intronic
1077529057 11:3086689-3086711 GTGCCCCCACCCCGCCTTCAGGG + Intergenic
1078087732 11:8244168-8244190 GTGACCCCAGCCTCCTTTCCCGG - Intronic
1078443577 11:11387334-11387356 GTGGCCACACCCCTCCTTCCTGG + Intronic
1078714380 11:13825995-13826017 GTGCCAGGACCCTTCCTACCTGG - Intergenic
1081596120 11:44460780-44460802 GTTCCAGCACCCTCCCTGCCAGG - Intergenic
1083213544 11:61204263-61204285 TTGCCCGCACACTCACATCCAGG - Exonic
1083216427 11:61223099-61223121 TTGCCCGCACACTCACATCCAGG - Exonic
1083219309 11:61241925-61241947 TTGCCCGCACACTCACATCCAGG - Exonic
1083308755 11:61773945-61773967 GTGCCCTCACCCGCCCCCCCAGG + Exonic
1083895205 11:65616276-65616298 CTGCCCGCGCCCCCCCTCCCGGG - Exonic
1083933275 11:65857573-65857595 GCGCCAGCACCCGCCCCTCCCGG + Intronic
1084003750 11:66312782-66312804 GTGCCCGCCCCCTGCCCTCTTGG - Intergenic
1084404096 11:68961039-68961061 GTGCCCGAGCCCTTCCATCCTGG - Intergenic
1084958051 11:72702003-72702025 GTTCCAGCACCTCCCCTTCCAGG + Intronic
1085305189 11:75481783-75481805 GCACCCGCCTCCTCCCTTCCTGG - Intronic
1088174190 11:107032611-107032633 GTCCCCCCACCCCCACTTCCAGG + Intergenic
1088522270 11:110712478-110712500 GGGCCCGCCCCCTCCGCTCCGGG + Intronic
1089378457 11:118011369-118011391 GTACCCGCACCCTGCCTAGCAGG - Intergenic
1089474608 11:118748696-118748718 GTGCAGACACCCTCCCTTCTGGG + Exonic
1089978794 11:122755449-122755471 GTGGCCACACCCTCCTGTCCCGG - Intronic
1091214830 11:133894315-133894337 GTGCCCCCAGCCTCCCTTTTTGG - Intergenic
1091587251 12:1823245-1823267 GTGTCCGCACCCTTCCTCTCAGG - Intronic
1092143791 12:6201025-6201047 GTGCCCGCACCCTCCCTTCCTGG - Intronic
1092501365 12:9050964-9050986 GGGCCCGCCCCCTTCCTCCCAGG - Intergenic
1093194181 12:16110831-16110853 GTTTCCACATCCTCCCTTCCAGG + Intergenic
1094357656 12:29595540-29595562 GTCCCAGGTCCCTCCCTTCCTGG + Intronic
1095479881 12:42623920-42623942 GTGCCCCATCCCTCACTTCCAGG + Intergenic
1096195170 12:49645020-49645042 GGGCCCCCACATTCCCTTCCAGG + Exonic
1098024748 12:66189560-66189582 GAGCCGGCCCCCTCCTTTCCTGG + Intronic
1101247958 12:102902890-102902912 CTTCCCCCACCCTCCCTTCCAGG + Intronic
1102419331 12:112791611-112791633 GTGCGCCCAACCTCCCCTCCCGG + Intronic
1104893606 12:132151595-132151617 GCGCCGGCACCCTGCCTGCCGGG + Exonic
1105938103 13:25120538-25120560 ATGCCCCCACCCTCCCCTGCAGG + Intergenic
1106400820 13:29428574-29428596 CTGCCTGTCCCCTCCCTTCCTGG + Intronic
1114046473 14:18880631-18880653 GTGCCCGCAGCCGCCCTTCCCGG - Intergenic
1114117739 14:19638819-19638841 GTGCCCGCAGCCGCCCTTCCCGG + Intergenic
1115508209 14:34112772-34112794 TTCCCCACACCCTCTCTTCCAGG + Intronic
1117895890 14:60485968-60485990 ACGCCCACACCCTCCCTCCCTGG + Exonic
1118283516 14:64450359-64450381 GTGCCCCCACGTTCACTTCCTGG + Intronic
1118775495 14:68971513-68971535 GTGCCAGCACCTTCATTTCCAGG + Intronic
1118848260 14:69564692-69564714 ATGTCCCCACTCTCCCTTCCTGG - Intergenic
1119101466 14:71883883-71883905 TTGCCCCCATCCTCCTTTCCTGG + Intergenic
1119738807 14:77000574-77000596 CTGCCGCCTCCCTCCCTTCCTGG + Intergenic
1121208819 14:92191083-92191105 GTGCCAGCACTCGCCCTTCTGGG - Intergenic
1121255975 14:92530782-92530804 GTTCCAGCAGCATCCCTTCCAGG - Intronic
1121284775 14:92726676-92726698 ATGCCCTCACCCTACCTTGCCGG + Intronic
1122275124 14:100587211-100587233 GCGCCCGCGCCCTGCCCTCCCGG + Intronic
1122601138 14:102922610-102922632 GTGCCCCCACCCGACCTGCCTGG + Intergenic
1122905691 14:104800587-104800609 GTCCCCGCGCCCTCCCCGCCGGG + Intronic
1125460740 15:39904521-39904543 GCACCCCCACCCTTCCTTCCTGG - Intronic
1126251456 15:46572651-46572673 GTGCCTGCAGGCTCTCTTCCTGG + Intergenic
1126425285 15:48520944-48520966 GCGCTCGCAGCTTCCCTTCCGGG - Intronic
1128943927 15:71809048-71809070 TTGCCAGCCCCCTCCCTGCCCGG - Intronic
1129351369 15:74957550-74957572 GTGGCCGCCCCCTTCCTCCCAGG + Intronic
1129745043 15:78012738-78012760 CTGGCAGCTCCCTCCCTTCCTGG - Intronic
1129878410 15:78992036-78992058 CTGCCCTCACCCACCCTGCCAGG + Intronic
1131189316 15:90301209-90301231 GTGCTGGCATCCTGCCTTCCCGG - Intronic
1132888024 16:2190992-2191014 GGGCCCACGCCCTCCCTTCAGGG + Intronic
1133103955 16:3494924-3494946 GTGACTGCACCCTCCCCTCATGG - Intronic
1134156934 16:11851590-11851612 GTTCCCGCCCCCTCGCTTCCGGG - Intergenic
1135891941 16:26365326-26365348 CTGCCCAGACCCTCCCTCCCAGG - Intergenic
1136247012 16:28982010-28982032 GAGACCCCACCCTGCCTTCCCGG + Exonic
1136366533 16:29811723-29811745 GTCCCCGCTCCGTCCTTTCCAGG + Intronic
1136672013 16:31866879-31866901 GTGTGGGCACCCTACCTTCCAGG + Intergenic
1137970945 16:52984147-52984169 CTCCCCGCAACCTCGCTTCCCGG - Intergenic
1138567643 16:57845287-57845309 GTGCCCCCACCATCCCTCCCTGG + Intronic
1139652313 16:68368535-68368557 GTGCCCGACCCATCCATTCCAGG - Intronic
1141412853 16:83847256-83847278 ATGCCCGGGCCCTGCCTTCCTGG + Intergenic
1141622133 16:85241923-85241945 GGGCCAGCTCCCTCCCCTCCCGG - Intergenic
1141673147 16:85503312-85503334 CTGCCCACACCCTTCCCTCCTGG - Intergenic
1141841693 16:86577842-86577864 TCTCCCACACCCTCCCTTCCAGG - Intronic
1141857188 16:86691409-86691431 CTGCCCTCTCCCTGCCTTCCAGG - Intergenic
1142197073 16:88743920-88743942 GGGGCTGCAGCCTCCCTTCCTGG - Intronic
1142205152 16:88779456-88779478 GGGCCCCCAACCTCCTTTCCTGG + Intronic
1142341255 16:89524268-89524290 GTGCCCACACCCTCACTCACAGG - Intronic
1203141782 16_KI270728v1_random:1771679-1771701 GTGCCCACACTCTCCCCTCTGGG - Intergenic
1142711676 17:1727039-1727061 GTGGCCTCAGCCTCCCGTCCAGG + Exonic
1143152750 17:4817340-4817362 CTGCCCACACTCTCCTTTCCTGG + Intronic
1143655136 17:8289440-8289462 GTCCCCGCTACCGCCCTTCCAGG - Exonic
1143779472 17:9221810-9221832 GTGACCTCAGGCTCCCTTCCCGG + Intronic
1143832903 17:9666538-9666560 GGGCCCGCATCATCCCTTTCTGG - Intronic
1143882423 17:10039898-10039920 GTGTCCGCATCCCACCTTCCTGG + Intronic
1144592376 17:16535706-16535728 GAGCGCGCACGCACCCTTCCGGG - Intergenic
1145094114 17:20009692-20009714 GTGGCCGCCTCCTCCCCTCCGGG + Intronic
1145939828 17:28737539-28737561 GTGCCCACACCCTGCCGCCCAGG - Intronic
1146906866 17:36623612-36623634 GTGCCCCCACCCTCCCCTTCAGG - Intergenic
1147424990 17:40342120-40342142 CTGCGCGCCCCCTCCCCTCCGGG - Intronic
1147930390 17:43977066-43977088 GTCCCCCCACCCTGCCTTCCTGG + Intronic
1151605244 17:75131482-75131504 GGGCCCGCTCGCTCCGTTCCGGG - Intronic
1151650928 17:75469001-75469023 CAGCCCTCACCCTCCCGTCCTGG - Intronic
1151758666 17:76088693-76088715 GTGGCCGCCCCATCCCTCCCTGG - Intronic
1151874549 17:76859518-76859540 CTGCCCTCACCCTCCATTGCTGG - Intergenic
1152245664 17:79183424-79183446 GTGCGCGCGCCCTGCCTCCCGGG + Intronic
1152467376 17:80473952-80473974 GTGCCCACACACTTCCCTCCAGG + Intronic
1152842368 17:82578290-82578312 GCACCAGCTCCCTCCCTTCCGGG - Intronic
1153805289 18:8705254-8705276 GTGCCCGCCCCCGCCGCTCCCGG - Intergenic
1156596772 18:38556608-38556630 GTGCACGGACCCTCTCTTCCAGG - Intergenic
1158648766 18:59268935-59268957 GTACCCGCATCCTCTCTCCCAGG - Exonic
1158752548 18:60280238-60280260 ATGCCTGCACGCTCCCTTCAAGG - Intergenic
1160130826 18:76223548-76223570 GTGCACCCACCCTCCCTGACAGG + Intergenic
1160560256 18:79751313-79751335 GTGCCCAGCCCCTCCCTCCCTGG - Intronic
1160599312 18:80000726-80000748 CTCACCACACCCTCCCTTCCTGG + Intronic
1160824134 19:1071526-1071548 GTCCCCGCACACCCCCTACCCGG - Intronic
1161081462 19:2312631-2312653 GCCCCCGCAGCCTCCCTCCCTGG + Intronic
1161105543 19:2441985-2442007 GAGCCCGCACCCTGCCTTCTGGG - Intronic
1161237592 19:3205511-3205533 GTGCACCCACCCTCATTTCCTGG - Intronic
1161885359 19:6990532-6990554 CTCCCCACACCCTCCTTTCCTGG + Intergenic
1162405114 19:10468620-10468642 CTGGCCGCACCCCCCTTTCCAGG + Exonic
1162558444 19:11402051-11402073 GAGCCCCCACCCGCCCATCCTGG - Exonic
1164146909 19:22518039-22518061 GGGGCAGCACCCACCCTTCCGGG - Intronic
1165461060 19:35944716-35944738 GGCGCCGCACGCTCCCTTCCTGG + Exonic
1165806530 19:38584293-38584315 GTGCCCCCCCCCACCCATCCCGG + Intronic
1165899699 19:39163344-39163366 GGGCCAGCCCCCTCCCTTCCAGG + Intronic
1166213860 19:41323510-41323532 CTGCCCCCATCCTCCCTGCCTGG - Exonic
1168073094 19:53963418-53963440 CCGCCCGCACCCTACCTTCCAGG - Exonic
926117782 2:10224285-10224307 GTGCCCGTTCTCTCCCCTCCTGG - Intergenic
926228656 2:10986261-10986283 GTGCCCACGCCCTCTCCTCCTGG - Intergenic
928248592 2:29653982-29654004 CTCACCGCAACCTCCCTTCCTGG - Intronic
928593027 2:32836612-32836634 AGGCCCACTCCCTCCCTTCCAGG + Intergenic
929218071 2:39437000-39437022 GTGCCCCCCGCCTCCCTCCCGGG + Exonic
930071293 2:47368948-47368970 GTTCCCGCACCCTTCCCCCCAGG + Intronic
930691147 2:54366218-54366240 GTGCCTACATCCTCCCTTCAAGG - Intronic
931590861 2:63881778-63881800 TTGCCCTTTCCCTCCCTTCCAGG + Intronic
931625005 2:64249591-64249613 ATGACCTCTCCCTCCCTTCCAGG - Intergenic
931657669 2:64524645-64524667 GTCCCCGCACCCTCTTTCCCCGG - Intronic
936347285 2:111684854-111684876 GTGCCTGCATTCTCCCTTCAGGG + Intergenic
938200152 2:129366264-129366286 GTGGCCCCACCCTCCCTGTCTGG + Intergenic
938266887 2:129934274-129934296 GCGACCGCAGCCGCCCTTCCCGG + Intergenic
941911868 2:170771355-170771377 TGGCGCGCATCCTCCCTTCCCGG - Intergenic
946176984 2:217928177-217928199 GTCCCCACACCCTCCCTCCATGG - Intronic
947915354 2:233828845-233828867 CAGCCTGCACCCTCCCTCCCAGG - Intronic
948902483 2:240963552-240963574 GTGCCCGCAGCCTCTCAGCCTGG - Intronic
1169118634 20:3082861-3082883 GGGCCCACACCCTCCCTGCCGGG + Intronic
1170604300 20:17864084-17864106 CTCCCCGCACCCTGCCTGCCTGG - Intergenic
1174957795 20:55119746-55119768 TTCCCTGCACCCTCCCTTCCTGG + Intergenic
1175604240 20:60299262-60299284 GAGCCCGCACCCTGCATTCCTGG - Intergenic
1175823833 20:61925841-61925863 GTGCCCGTGCCCTCCCTGCAAGG - Intronic
1176030059 20:63007442-63007464 GAGCCCGCACACTCCCTGCTCGG + Intergenic
1176072615 20:63234978-63235000 GAGCCTGCACGCTCCCATCCAGG + Intergenic
1176126633 20:63478467-63478489 CTGCCCCCGTCCTCCCTTCCTGG + Intergenic
1179470943 21:41609929-41609951 TTGCCTGCCCCCTCCCTTCCAGG - Intergenic
1180054017 21:45347891-45347913 GTGCCAGCATCCTGCCCTCCAGG + Intergenic
1180465009 22:15603267-15603289 GTGCCCGCAGCCGCCCTTCCCGG - Intergenic
1181006138 22:20014615-20014637 GGACCCCCACCCTCCATTCCTGG + Intronic
1181172447 22:21017295-21017317 CAGCCCTCACCTTCCCTTCCTGG + Intronic
1181464945 22:23105947-23105969 GTGCCCACGGCCTCCCTTTCTGG + Intronic
1181639803 22:24190489-24190511 GTGCCCGCTCCCTCATGTCCAGG - Intergenic
1183056166 22:35307516-35307538 GTGCCAGCTCCGCCCCTTCCCGG + Intronic
1183507923 22:38219803-38219825 GTGTCTGCACCCACCCTCCCGGG + Exonic
1184112791 22:42405101-42405123 GTCCCTGCTCCCTCCCCTCCAGG - Intronic
1184387429 22:44184056-44184078 GTTCCTGCAACCTCCCTTCTAGG + Intronic
1184593840 22:45502763-45502785 CTGCCGGGACCCTCCCTCCCCGG - Intronic
1185218702 22:49618048-49618070 CTGCCTGCCCCCTGCCTTCCCGG + Intronic
1185259675 22:49854261-49854283 GTGCCCGCGCCGTTGCTTCCGGG + Intronic
950724506 3:14907703-14907725 GTGGCGGCACTCACCCTTCCTGG - Exonic
951869163 3:27341192-27341214 TTGCACTCACCCACCCTTCCTGG - Intronic
953732874 3:45465084-45465106 GAGCCCTCAGCCTCCCTGCCAGG + Intronic
953883026 3:46701286-46701308 GGGCCCGCCCCCTCCTTCCCGGG - Intergenic
953908424 3:46880191-46880213 GTGCCCACATCCTCCGTTACTGG - Intronic
955060245 3:55487199-55487221 GTCCGCGCCCCCTCCATTCCTGG - Exonic
955911770 3:63864519-63864541 GCGGCCGCCCCCTTCCTTCCTGG + Intergenic
961197495 3:125015069-125015091 GTGCCCCAAGCCTCACTTCCTGG + Intronic
961663253 3:128481478-128481500 ATGCCAGAACCCGCCCTTCCTGG - Intronic
963368695 3:144369655-144369677 GTGCCCACAGCTTCCCTGCCAGG + Intergenic
968945634 4:3662129-3662151 CTGGCCGCACTCTCCCCTCCCGG - Intergenic
970172671 4:13305217-13305239 GTGCCAGCACCCTCGGTTCCTGG + Intergenic
970195384 4:13546572-13546594 CTGCCCGTCCCCTACCTTCCAGG - Intergenic
970539106 4:17059617-17059639 GTTCCCACACCCTCCCGTGCTGG - Intergenic
973787971 4:54351918-54351940 GTGCCCACATCCTCTCTCCCTGG + Intergenic
974460537 4:62181726-62181748 GTGCCTGCATCCTTACTTCCAGG + Intergenic
974603751 4:64122588-64122610 GTGCCTGCACCCTGCCCTGCCGG - Intergenic
978174148 4:105708976-105708998 GCTCACGCACCCTCCCTGCCTGG + Exonic
978558323 4:110004775-110004797 GTTCCCCCACCCTCCCACCCAGG - Intronic
985634171 5:1027865-1027887 GTGCCTGCACCGGCACTTCCAGG + Intronic
986708641 5:10471571-10471593 GGGCCTGCACCCTCCCTTGTGGG - Intronic
988595325 5:32585660-32585682 GGGCCCCCACCCTCCCAGCCGGG + Intronic
989669210 5:43894762-43894784 GTGCACACACCCACCCATCCTGG + Intergenic
996470974 5:123860123-123860145 GAGTCCACACACTCCCTTCCAGG + Intergenic
997467229 5:134096317-134096339 GTGCCCTCACCCTCCATGCCAGG + Intergenic
999759637 5:154690611-154690633 CTCCACGCACCCTCCCTGCCTGG + Intergenic
1001573837 5:172748822-172748844 TATCCCGAACCCTCCCTTCCGGG + Intergenic
1002054141 5:176589198-176589220 CTCCCCGCAACCTCCCTCCCGGG - Intronic
1002527167 5:179821204-179821226 GTGGCTGCCCCCTCCCTTCTCGG + Intronic
1003179223 6:3777806-3777828 GTGCCCGGGCCTTTCCTTCCTGG + Intergenic
1008251530 6:49245659-49245681 GTGCCCACCCCCTCCATCCCTGG + Intergenic
1010011362 6:71051514-71051536 GTACCCGCACTGTACCTTCCTGG - Intergenic
1014246797 6:119078467-119078489 GGGACCGCCCCGTCCCTTCCAGG - Exonic
1018795572 6:167182707-167182729 GCTCCCCCACCCTCCCTCCCAGG + Exonic
1018820745 6:167372356-167372378 GCTCCCCCACCCTCCCTCCCAGG - Exonic
1018890024 6:167976689-167976711 GTGCTCGCCCCTCCCCTTCCTGG + Intergenic
1018981468 6:168604970-168604992 GTGCCTGGACCCCTCCTTCCGGG - Intronic
1019312894 7:371367-371389 GTTGCCACACCCTCCCTTCCAGG + Intergenic
1019778343 7:2925533-2925555 CTGCCAGCCCCCTCTCTTCCAGG - Intronic
1024747815 7:52428357-52428379 GTGTCCCAGCCCTCCCTTCCAGG + Intergenic
1029361050 7:100088946-100088968 GGCCCCGCCCCCTTCCTTCCCGG - Exonic
1030038721 7:105430965-105430987 GTGCCAGCACGGTCCCGTCCTGG - Intergenic
1030065005 7:105652695-105652717 GTGCCAGCTCCCAGCCTTCCTGG - Intronic
1031973321 7:128078885-128078907 CTGCCAGCTCCCTCCTTTCCCGG - Intronic
1032096007 7:128938834-128938856 GTACCCGCTCCCGCCCCTCCCGG - Intronic
1032506326 7:132437292-132437314 GTGCCAGCTGCCTCCCTTCGTGG + Intronic
1032718638 7:134532189-134532211 ATGGCCTCAACCTCCCTTCCAGG - Intronic
1032802339 7:135327013-135327035 GTGCCAGCTCCATCCCCTCCAGG - Intergenic
1034270138 7:149799765-149799787 GGGCCCCCACCTTCCTTTCCTGG + Intergenic
1035017298 7:155778146-155778168 GCACCCGCACCCTGCCTTGCTGG + Exonic
1035168505 7:157005428-157005450 GCGCCCGCACCCACCCGGCCCGG - Exonic
1035168887 7:157006998-157007020 CTTCCCGGAACCTCCCTTCCTGG - Intronic
1035232225 7:157472235-157472257 GTGCCCACAGCCTCTCCTCCTGG - Intergenic
1035248152 7:157578478-157578500 GTGCCGACACCCTCACTTGCTGG + Intronic
1035263140 7:157674294-157674316 GTCCCCCCACCCTCGCCTCCTGG - Intronic
1036135302 8:6154802-6154824 GTGCCTGCACTCTCCCTTATTGG - Intergenic
1037828768 8:22176415-22176437 GTGCCCACACATTCCTTTCCAGG + Intronic
1037840556 8:22242276-22242298 GTGCCCAGTCCCACCCTTCCTGG - Intergenic
1039566130 8:38553823-38553845 GTGAGTGCACCCTCCCTCCCTGG - Intergenic
1039750460 8:40473759-40473781 GTGCCCCCAACCTGCCTTCTTGG + Intergenic
1039792992 8:40890698-40890720 GTGGCCCCTCCCTCCCTACCTGG + Intronic
1041018671 8:53616487-53616509 GTGCCCGGACTCCCCCCTCCTGG - Intergenic
1041076516 8:54174835-54174857 GCGCCCGCACCCACGCTTCAGGG + Intergenic
1042022239 8:64380062-64380084 GTAGCCGCGCCCTCCCTGCCTGG + Intergenic
1045332351 8:101166371-101166393 GTTCCCTCCCCCTTCCTTCCGGG + Intergenic
1047774935 8:128062146-128062168 GTGCCCCCATCACCCCTTCCAGG - Intergenic
1049340865 8:142112016-142112038 CTCCACGCACCCTCCCTCCCAGG + Intergenic
1049585930 8:143432377-143432399 GCGGCGGCATCCTCCCTTCCCGG - Intergenic
1049782547 8:144435523-144435545 GGCCCCGCCCCCTCCCATCCGGG - Exonic
1049818945 8:144622495-144622517 GTGCCCGGAGCCGCCCTCCCAGG + Intergenic
1053119843 9:35538419-35538441 GTCCCTGCAGCCTCCCTTCTGGG + Intronic
1053299047 9:36935885-36935907 GTGCCAGTGCCCTCCCTGCCTGG + Intronic
1053447571 9:38164703-38164725 ATCCCAGCACCCTCCCCTCCAGG + Intergenic
1056797657 9:89669775-89669797 TTGCCCCCACCCAACCTTCCTGG - Intergenic
1056965302 9:91159989-91160011 CGGCCCGCACCCGCCCTGCCGGG + Intergenic
1060517227 9:124273507-124273529 GGGCCCGTATCCACCCTTCCTGG + Intronic
1060523481 9:124307708-124307730 CTGCCCTCAGCCTCCCTTCCAGG - Intronic
1062108238 9:134767270-134767292 GCGCCCTCACCTTCCCTTTCTGG + Intronic
1062613858 9:137387294-137387316 GTGCCCGCCCCAGCCATTCCAGG + Intronic
1186331021 X:8534366-8534388 GTGGCCGGCCCCTCCCCTCCTGG + Exonic
1189327354 X:40120852-40120874 CTCCCCACACCCTGCCTTCCAGG - Intronic
1192795194 X:74420624-74420646 GTGCCACCTCCCTCCCTTCCTGG + Intergenic
1195114049 X:101678093-101678115 CTGCCAACAACCTCCCTTCCTGG - Intergenic
1196929721 X:120669438-120669460 GTGCCTGCACCCCCTCCTCCTGG + Intergenic
1198112283 X:133512591-133512613 GTGCCCGCCCCCACCCTCCTTGG + Intergenic
1200128729 X:153830096-153830118 CCGTCCGCACCCTCCCATCCTGG - Intronic
1201060145 Y:10037458-10037480 GGCCTGGCACCCTCCCTTCCTGG - Intergenic
1202109737 Y:21406929-21406951 GGTCTGGCACCCTCCCTTCCTGG - Intergenic