ID: 1092143794

View in Genome Browser
Species Human (GRCh38)
Location 12:6201061-6201083
Sequence GTAAAAGTGAGAGCCGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092143794_1092143805 19 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143805 12:6201103-6201125 CTCGGCCGCGGGTCCGGCCCCGG 0: 1
1: 0
2: 0
3: 23
4: 272
1092143794_1092143801 7 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143801 12:6201091-6201113 CGGCAGGGGTGCCTCGGCCGCGG 0: 1
1: 0
2: 0
3: 18
4: 152
1092143794_1092143797 -9 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143797 12:6201075-6201097 CACTTTTACGCAGGAGCGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1092143794_1092143799 -7 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143799 12:6201077-6201099 CTTTTACGCAGGAGCGGCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 88
1092143794_1092143803 13 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143803 12:6201097-6201119 GGGTGCCTCGGCCGCGGGTCCGG 0: 1
1: 0
2: 1
3: 12
4: 142
1092143794_1092143802 8 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143802 12:6201092-6201114 GGCAGGGGTGCCTCGGCCGCGGG 0: 1
1: 0
2: 3
3: 22
4: 219
1092143794_1092143806 20 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143806 12:6201104-6201126 TCGGCCGCGGGTCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 18
4: 127
1092143794_1092143800 1 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143800 12:6201085-6201107 CAGGAGCGGCAGGGGTGCCTCGG 0: 1
1: 0
2: 1
3: 29
4: 430
1092143794_1092143798 -8 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092143794 Original CRISPR GTAAAAGTGAGAGCCGCTCT TGG (reversed) Intronic
907222285 1:52915686-52915708 GTAAACATGAGGGCCACTCTGGG - Intronic
909658436 1:78056138-78056160 ATAAGATTGAGAGCCACTCTGGG + Intronic
913294755 1:117308479-117308501 GGAAAAGTGAGAGCCACACTTGG + Intergenic
920904165 1:210144894-210144916 GTAAATGTGAGAGCATTTCTGGG + Intronic
920904299 1:210146519-210146541 GTAAATGTGAGAGCATTTCTGGG + Intronic
921055751 1:211541303-211541325 GGAAATGGGAGAGCAGCTCTCGG - Intergenic
922906946 1:229180679-229180701 TTAAAATTTGGAGCCGCTCTTGG - Intergenic
923804151 1:237239843-237239865 GAAAAAGTGAGATGTGCTCTTGG - Intronic
1064483822 10:15765404-15765426 GTAGAACTGAGAGCCTCTTTTGG + Intergenic
1067422301 10:46163741-46163763 TTAAAAGTGAGAGCTGATGTAGG - Intergenic
1067507607 10:46869639-46869661 TTAAAAGTGAGAGCTGATGTGGG - Intergenic
1069948362 10:72002540-72002562 GTATAAGTGACAACCTCTCTGGG - Intronic
1070859734 10:79643056-79643078 TTAAAAGTGAGAGCTGATGTAGG - Intergenic
1075370533 10:121931111-121931133 TTCAAAATGAGAGCCGGTCTGGG - Intergenic
1076479889 10:130778023-130778045 GTCCAACTGAGAGCCGCTCCAGG - Intergenic
1081278482 11:41179965-41179987 GTAAATGTAAGGGCCGCTGTGGG + Intronic
1084879060 11:72156811-72156833 GTTAAAGTCAGAGCTGCTCAAGG - Intergenic
1088606508 11:111538722-111538744 GTAAGAGACAGAGCTGCTCTAGG - Intergenic
1089563096 11:119355725-119355747 ATAAAAGGGAGAGAAGCTCTAGG + Exonic
1092143794 12:6201061-6201083 GTAAAAGTGAGAGCCGCTCTTGG - Intronic
1101402015 12:104396798-104396820 GGAAAAGTTTGAGGCGCTCTAGG + Intergenic
1101496734 12:105261830-105261852 GTAAAAGTAGCAGCCGCTTTAGG + Intronic
1106591275 13:31100799-31100821 GTAATAGTTAGAACAGCTCTTGG + Intergenic
1110151013 13:72253224-72253246 GTAAAAGTGACAGCTGATTTTGG - Intergenic
1117790847 14:59340307-59340329 GTTAAAATGAGAACAGCTCTTGG + Intronic
1118742742 14:68752193-68752215 GTAAAAGTGAGAGGCAATGTGGG - Intergenic
1119472378 14:74908081-74908103 GGAAAAGAGAGAGCCACTCTGGG + Intronic
1130298671 15:82664435-82664457 GCAGCAGTGAGAGCGGCTCTGGG - Exonic
1130897044 15:88179379-88179401 TTAAAAGTCAGAGCCTCTCTGGG + Intronic
1134134685 16:11670702-11670724 GCAAAAGTGAGTGCTGGTCTGGG + Intronic
1136039383 16:27566066-27566088 GTTAAGGTGGGAGCAGCTCTTGG - Intronic
1136083234 16:27866860-27866882 GTGAAAGTGAGGGCCGGTTTCGG - Intronic
1141166825 16:81666527-81666549 ATAAAAATCAGAACCGCTCTGGG + Intronic
1143647206 17:8238484-8238506 CTAAAAGTAACAGCTGCTCTCGG + Exonic
1147733672 17:42620145-42620167 GTAAAAGTGGGAACCCCTTTAGG - Intergenic
1162364073 19:10237368-10237390 GTAAGAGTGTGAGCCACTTTGGG - Intergenic
1167446186 19:49539026-49539048 GTAAGAGTGAGAGGTTCTCTTGG - Intronic
1167856491 19:52245876-52245898 GAAAAAGTAAGAGCCTCTTTTGG - Intergenic
929870170 2:45752574-45752596 ATAAATCTGAGAGCCGGTCTCGG + Intronic
929884224 2:45863972-45863994 GGAAAAGTGAGAGCTAGTCTAGG - Intronic
934707410 2:96493397-96493419 CAAAAGGTGAGAGCAGCTCTAGG - Intergenic
948630872 2:239301756-239301778 TTACAAGTGAGAGCCACTGTAGG + Intronic
1169692052 20:8343069-8343091 CTAAAAGGGAGAGTCGCTGTGGG - Intronic
1170052736 20:12164521-12164543 GTAAATGGCAGAGCAGCTCTTGG + Intergenic
1170895480 20:20409218-20409240 GTAAAAGTGGGAGATGCACTCGG - Intronic
1176431437 21:6578725-6578747 GGAACAGTGAGTGCAGCTCTGGG + Intergenic
1179706831 21:43186187-43186209 GGAACAGTGAGTGCAGCTCTGGG + Intergenic
1183127254 22:35795250-35795272 GGAAAAATAAGAGCCACTCTTGG + Intronic
1184405152 22:44296655-44296677 GCACAAGTGAGTGCCACTCTGGG - Exonic
957409082 3:79814470-79814492 GTAATTTTGAGAGCTGCTCTTGG + Intergenic
957448843 3:80349690-80349712 GTTAAAGTGAGAGCAGTGCTTGG + Intergenic
964534757 3:157708153-157708175 TTAAAAGTGAGAGCTAATCTAGG + Intergenic
966925266 3:184640483-184640505 GTGAAAGTGTGGGCTGCTCTGGG + Intronic
966953290 3:184845185-184845207 GTGAAAATGAGAGCCACTCCAGG - Intronic
973713511 4:53652390-53652412 ATAAAACTGAGAGCAGCTATGGG + Intronic
982496555 4:156101343-156101365 GTAAATGTGAGAGCAGCTCTAGG + Intergenic
983266593 4:165514047-165514069 GGAAAGGTGAGGGCCTCTCTGGG + Intergenic
987242465 5:16014714-16014736 CTAAAAGTCAGATCAGCTCTAGG - Intergenic
991127601 5:63085173-63085195 GCAAAAGTGGCAGCTGCTCTGGG - Intergenic
992541281 5:77766785-77766807 ATAAAAGTGAGAGCCGGGCGCGG - Intronic
992939811 5:81751050-81751072 GTGACAGTGGGAGCTGCTCTCGG - Exonic
997296316 5:132771153-132771175 GTAAAAGGGACAGCTCCTCTTGG - Intronic
997612716 5:135226437-135226459 AGAAAACTGAGAGCCCCTCTGGG - Intronic
1003464239 6:6363208-6363230 GTACAAGTGAGACCATCTCTGGG - Intergenic
1006656104 6:35594322-35594344 GTGAAAGTGAGACCCTGTCTCGG + Intronic
1006872292 6:37262593-37262615 GTAAAAGTCACAGCCTGTCTGGG + Intronic
1007219331 6:40265983-40266005 GGAAAGGTGAGAGCTGCTCTTGG + Intergenic
1011769861 6:90663499-90663521 GTAAAAGTTAGAGCTGGTCAAGG - Intergenic
1013228020 6:108134509-108134531 TTAAAAGGGAGAGCGGCTATAGG + Intronic
1014787380 6:125634249-125634271 ATAAAAGTGAGATTCCCTCTAGG - Intergenic
1014811361 6:125889803-125889825 GAAAAAGGGAGAGCCCCTCCCGG + Exonic
1016052698 6:139546867-139546889 GTAAAAGGGAGAGCACTTCTAGG - Intergenic
1017865461 6:158439390-158439412 GTAGGAGTGAGAGCTGCTCTGGG - Intronic
1017865478 6:158439490-158439512 GAGGAAGTGAGAGCTGCTCTGGG - Intronic
1022598416 7:31734277-31734299 GTAAAGGTTAAAGCGGCTCTAGG + Intergenic
1031835591 7:126677926-126677948 GAAACAGTGAGAGCTGCTATAGG - Intronic
1036112454 8:5918780-5918802 GTCAAAGTCAGAGGAGCTCTTGG + Intergenic
1036607964 8:10324481-10324503 GAAAAGGTGAGAGCAGCTCCCGG - Intronic
1038715593 8:29987988-29988010 GGAGAAGTGAGAGCCCCACTGGG + Intergenic
1047556056 8:125931632-125931654 GTGAAAGAGAGAGCTGTTCTGGG + Intergenic
1049998932 9:1055778-1055800 ATAAAAGTGACATCAGCTCTAGG + Intronic
1055194091 9:73565510-73565532 ATAAAAGTGAGAGCAGGTCTAGG - Intergenic
1187014290 X:15310162-15310184 GTAAGAGTGAGAGACTCTGTTGG - Intronic
1187449197 X:19381800-19381822 GTGAAAGTGACAGCAGCTCCTGG + Intronic