ID: 1092143798

View in Genome Browser
Species Human (GRCh38)
Location 12:6201076-6201098
Sequence ACTTTTACGCAGGAGCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092143794_1092143798 -8 Left 1092143794 12:6201061-6201083 CCAAGAGCGGCTCTCACTTTTAC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1092143791_1092143798 28 Left 1092143791 12:6201025-6201047 CCAGGAAGGGAGGGTGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 279
Right 1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092143798 Original CRISPR ACTTTTACGCAGGAGCGGCA GGG Intronic
900177024 1:1295460-1295482 ACTTCGACGCAGGGGCCGCAGGG - Exonic
908784309 1:67720025-67720047 ACTTGTAGGAAGGAGCAGCAAGG - Intronic
910587831 1:88898882-88898904 ACTCTTACTCAGGCGGGGCATGG - Intergenic
912565797 1:110586355-110586377 ACTTTTATGCAGGGTGGGCAGGG - Intergenic
1080859789 11:36143255-36143277 ACTTTTAAGCAGGGGAAGCAAGG - Intronic
1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG + Intergenic
1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092987895 12:13864752-13864774 ACATTAACGCAGGAGAGGCTAGG + Intronic
1102934165 12:116882754-116882776 ACCTTTAGGCAGCAGAGGCAAGG - Intergenic
1104948245 12:132427064-132427086 ACAAATAAGCAGGAGCGGCAGGG + Intergenic
1106804202 13:33289553-33289575 ACTATTACACAGGAGAGACAGGG + Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1118597458 14:67446928-67446950 GCTTTTACGCTGCAGTGGCAGGG + Intergenic
1129627671 15:77220300-77220322 ACTTTTACTCAGAAGCTTCAAGG + Intronic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG + Intergenic
1132273616 15:100547130-100547152 ACTTGTACGCAGGAGTTTCAAGG + Intergenic
1135789143 16:25377414-25377436 ACTATTACACAGGAGAGGCCGGG - Intergenic
1136390730 16:29962473-29962495 ACTTTAACACAGGAGGGGTAGGG - Intronic
1136615880 16:31398063-31398085 ACTTCTACCCTGGAGCAGCAGGG - Intronic
1140246921 16:73258872-73258894 ACTCTTACCCGGGAACGGCATGG - Intergenic
1148578320 17:48726627-48726649 ACTGTTCCTCAGGAGCGGCCTGG - Exonic
1152245532 17:79182994-79183016 ACTTTTCCGAAGGCGCGGGAGGG - Intronic
1153332450 18:3887793-3887815 ACTTTTACGCAAAAGTGCCATGG - Intronic
1168102192 19:54147253-54147275 AATGTTAGGCAGGAGCAGCATGG + Intronic
925121148 2:1419475-1419497 ACTTTTAGGCAATAGAGGCAGGG - Intronic
949017069 2:241719545-241719567 ACTTTCACGCAGAAAAGGCACGG - Intronic
1176050094 20:63114478-63114500 ACTTTCCCGCCGGAGGGGCAAGG + Intergenic
1176904236 21:14480409-14480431 ACTTTTACCCGGGGGCTGCATGG - Intergenic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
955061294 3:55493671-55493693 ACTTTTGCTCAGCAGTGGCATGG - Intergenic
955942658 3:64161080-64161102 ACTTTTAAGTAGGAGCGTCAGGG - Intronic
960585127 3:119314139-119314161 ACTTGGAGGCAAGAGCGGCATGG - Intronic
969567011 4:7984665-7984687 ACTTTTGGCCAGGAGAGGCAGGG + Intronic
969663225 4:8542562-8542584 ACTTGCACCCAGGAGCGGAAGGG - Intergenic
989196178 5:38718785-38718807 ACTTTCTCCCAGGAGGGGCAGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998209712 5:140185721-140185743 ACTTTAACACAGGAGCCCCAGGG - Intronic
1000295372 5:159908922-159908944 ACTTTTAGACAGGAGCAGCCTGG - Intergenic
1001566485 5:172702759-172702781 ACTTTTATGCAGGTCAGGCAAGG - Intergenic
1010472998 6:76251896-76251918 TCATTTACGCAGGAGGGCCAGGG + Intergenic
1015735922 6:136400080-136400102 ACTTTTTTGTAGGAGGGGCAGGG - Intronic
1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG + Intronic
1021526260 7:21592392-21592414 ACTTTGAGGCAGGAGCAGCCTGG + Intronic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1041533928 8:58904634-58904656 ACTCTTAAGCAGTAGCAGCAGGG + Intronic
1057810989 9:98256305-98256327 ACTATGACCCAGGAGTGGCATGG - Intergenic
1061913647 9:133738062-133738084 ACTTGTGGGGAGGAGCGGCAGGG + Intronic
1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG + Intronic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1190200533 X:48356965-48356987 ACTTTTTCGCAGTGGCGACAAGG - Intergenic
1195357144 X:104049408-104049430 ACTTTTACCCGGCAGAGGCAGGG + Intergenic