ID: 1092144570

View in Genome Browser
Species Human (GRCh38)
Location 12:6205575-6205597
Sequence CAGGATCTATGTGTGTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092144570 Original CRISPR CAGGATCTATGTGTGTAAGG GGG (reversed) Intronic
900731006 1:4259740-4259762 CAGCACATATTTGTGTAAGGGGG + Intergenic
903364717 1:22798936-22798958 CAGTATCTACATGTCTAAGGTGG + Intronic
904043232 1:27596054-27596076 CAGGGTTTGTGTGTGTTAGGGGG + Intronic
909341549 1:74537665-74537687 CAGGAGCTATCTGTGTAATGAGG + Intronic
910624836 1:89295398-89295420 TAGGATCTTTGTGTGGTAGGAGG + Intergenic
915950734 1:160188409-160188431 CAGGGTATATGTGAGTGAGGTGG + Intergenic
917622537 1:176811463-176811485 TAGGATCTATGAGTGAAAAGGGG + Intronic
919316884 1:195981998-195982020 CAGGATATATGTGTATATGAAGG - Intergenic
923419144 1:233795581-233795603 CAGGTTCACTGTTTGTAAGGTGG - Intergenic
1069652206 10:70057614-70057636 GAGGTTGTATGTGTGTAAAGGGG - Intronic
1070775722 10:79108654-79108676 CACGATCTGTGTGTATTAGGGGG - Intronic
1070813243 10:79308792-79308814 CAGGATGTGTGTGTGTCGGGGGG - Intronic
1072719698 10:97772800-97772822 CAGGATCTTTATCTGTAAGGTGG - Intergenic
1073006454 10:100329093-100329115 GAGCATCTATCTGTGTAAGCAGG - Intronic
1073239493 10:102046844-102046866 GAGGTTCTAGGTGAGTAAGGGGG + Intronic
1073555112 10:104442226-104442248 TAGGATTTCTGTGTTTAAGGAGG + Intronic
1073765278 10:106675592-106675614 CAGGATTTATGGTTGTAAGAAGG - Intronic
1074188177 10:111114696-111114718 CAGGTTCTATGGGTGTGATGGGG + Intergenic
1076152324 10:128172540-128172562 CAGGGGGTATGTGTGTATGGGGG + Intergenic
1076819625 10:132931883-132931905 CAGGCTCTATGTGGGGAATGTGG - Intronic
1076819747 10:132932337-132932359 CAGGCTCTATGTGGGGAATGTGG - Intronic
1079043620 11:17080677-17080699 CAGGATGTCTGTGTGTAATTTGG + Intronic
1084229924 11:67744242-67744264 CAGGATCTAAGGGTGGAAAGGGG - Intergenic
1087642891 11:100774590-100774612 CAGGCTTTCTGTGTGTAAGTTGG + Intronic
1091235362 11:134018622-134018644 CAGGATCTATGAGTCTACGTAGG - Intergenic
1091615707 12:2050077-2050099 CAGAGTGTATGTGTGTTAGGGGG - Intronic
1092144570 12:6205575-6205597 CAGGATCTATGTGTGTAAGGGGG - Intronic
1093307422 12:17538091-17538113 AAGTATCTATGTCTGTTAGGAGG + Intergenic
1097572298 12:61349205-61349227 CATGATTTATGTGTGGATGGGGG - Intergenic
1100363370 12:93897978-93898000 CAGGGTCAATGTGTTTGAGGAGG + Intergenic
1102513986 12:113434423-113434445 CAGTTTCTATGTGTGTAAAATGG + Intronic
1104364195 12:128162149-128162171 CAGGATCTGTATCTGGAAGGTGG - Intergenic
1107608483 13:42087169-42087191 CAGGATCTCTGTGTATTATGAGG - Intronic
1108533294 13:51347142-51347164 CAGGATCTGTGTGTCTGTGGAGG - Exonic
1110534731 13:76638311-76638333 CAGTATCTAAGTGTCTAAAGAGG + Intergenic
1110615347 13:77535348-77535370 CAGGTACTATGGGTGTATGGGGG + Intergenic
1114556342 14:23564500-23564522 CAGGACCTGTGTGGGTGAGGTGG + Intronic
1116225610 14:42148101-42148123 CAGCAACCATGTGGGTAAGGAGG - Intergenic
1121952044 14:98179700-98179722 CAGAATCTGTGTTTGTAAGTGGG - Intergenic
1127290058 15:57562183-57562205 AAGGTTCTATGTGTGTGGGGAGG + Intergenic
1130287950 15:82571219-82571241 CATGTTGTATGTGTGTATGGTGG + Intronic
1131066520 15:89438321-89438343 CAGGATCTAGGTGTATGATGTGG - Intergenic
1137249916 16:46733739-46733761 CGGGGTCTATGTGTGTTAGGGGG + Intronic
1142470635 17:161522-161544 TAGGATCTCTGTGTGTGACGAGG - Exonic
1147426921 17:40350334-40350356 CTGGACTTATGTGTGTATGGGGG + Intronic
1147995885 17:44360125-44360147 CAGGATCTCTGTGGGCAAGATGG + Exonic
1148780872 17:50121108-50121130 CAGGTTCCATGGGTGTGAGGAGG - Intronic
1148921218 17:51036551-51036573 CAGCATCTGTGTGTGGTAGGGGG - Intronic
1149388982 17:56170900-56170922 AGGGATGTATGTGTGTATGGCGG - Intronic
1149745675 17:59095399-59095421 CAGGAGCTATGTGAGTAGTGTGG + Intronic
1151416164 17:73966653-73966675 CATGATCTATGCATTTAAGGAGG - Intergenic
1151427711 17:74041796-74041818 CAGGAACTATCTTTGTTAGGGGG - Intergenic
1153199544 18:2634471-2634493 CAGGAGATATGTGGGTAAGGTGG + Intergenic
1155262953 18:24062404-24062426 CACCTGCTATGTGTGTAAGGTGG + Intronic
1156070190 18:33197433-33197455 CAGGATATTTGTGTGTAGTGGGG + Intronic
1157443201 18:47725728-47725750 AAGGGTCCATGTGTATAAGGAGG - Intergenic
1158475088 18:57772884-57772906 CAGGATCCATCTGTGCAAAGAGG + Intronic
1160630700 18:80245268-80245290 CTGGAGCTATGTGTGTGAGGAGG + Intronic
1160739484 19:679398-679420 CAGTTTCTCTGTGTGTAAAGTGG - Intronic
1164908243 19:31985098-31985120 CAGCATCCATGTTTGTGAGGAGG - Intergenic
1167783154 19:51613713-51613735 CAGTTTCCCTGTGTGTAAGGTGG - Intronic
926606179 2:14900838-14900860 CAGGAAATATCTGTGAAAGGAGG + Intergenic
928214445 2:29349721-29349743 CAGGAGCTATGTCTGTCAGCTGG + Intronic
928951977 2:36821333-36821355 CAGGACCTGTTTGTGTAAGAGGG - Intergenic
931555349 2:63497392-63497414 CAAGATCTGTGTGATTAAGGAGG + Intronic
931776530 2:65545755-65545777 CAGGCTCCATGTGTGGCAGGAGG - Intergenic
935618414 2:105108681-105108703 CAGGATCCCTGTGTGTCTGGGGG - Intergenic
935657856 2:105440121-105440143 CAGGATGTATGTGTGTGTGTGGG - Intergenic
939500386 2:142976208-142976230 CTGGGGCTATGTGTGGAAGGAGG + Intronic
939638387 2:144610377-144610399 CAGTAACTATATGTGTAATGGGG + Intergenic
940413142 2:153389525-153389547 CAGTATCAGTGTGTGTAATGGGG - Intergenic
941018109 2:160379896-160379918 CAGGACCTCTGTGTGTTTGGGGG + Intronic
943990333 2:194682000-194682022 CATGGTATATTTGTGTAAGGAGG - Intergenic
945610531 2:211995738-211995760 AAGGAACTGGGTGTGTAAGGAGG - Intronic
1173455767 20:43200008-43200030 CAGGGTCTATCTGGGTATGGGGG - Intergenic
1173656737 20:44704705-44704727 CAGTCTCTATGTGTGTTAGGGGG - Intergenic
1174417066 20:50374434-50374456 CAGTTTCTTTGTCTGTAAGGTGG + Intergenic
1175453847 20:59094827-59094849 CAGGCTCAATGAGAGTAAGGAGG - Intergenic
1178287029 21:31334473-31334495 CAGCATCAATATGTGTAATGAGG - Intronic
949321594 3:2816977-2816999 CAAGAGCTATGTGTGTAAATGGG - Intronic
949699000 3:6734215-6734237 CAGAATCCATGTGTGTCTGGAGG - Intergenic
951152162 3:19303651-19303673 CAGTATCTGTGTGGGAAAGGAGG + Intronic
956465774 3:69519388-69519410 CAGCATCTGTGTGTGTGTGGCGG + Intronic
960230701 3:115222983-115223005 CATGATCTCTGTGAGTGAGGAGG + Intergenic
962372508 3:134832528-134832550 CAGTTTGTATGTGGGTAAGGGGG - Intronic
964989035 3:162783686-162783708 CAGGATACATTTGTGTCAGGAGG + Intergenic
965247804 3:166297419-166297441 CAGTATATATGTGTGTGGGGGGG - Intergenic
969669908 4:8583895-8583917 CAGGTTTTATGTGAGGAAGGAGG - Intronic
970054541 4:11955827-11955849 AAGATTCTATGTGTATAAGGGGG + Intergenic
970374545 4:15443556-15443578 CAAGGTGTATGTGTTTAAGGGGG + Exonic
974421315 4:61679287-61679309 CAGGATATATTTGTGTCATGGGG - Intronic
975530614 4:75395893-75395915 CAGGAACTAAGTTTATAAGGTGG - Intergenic
977233554 4:94480418-94480440 CAGGATCTATGGGTATATGGTGG + Intronic
983025633 4:162733917-162733939 CAGGATCTAAGAGTTTAAGTAGG + Intergenic
983160215 4:164403827-164403849 TGGGCTCTATGTGTGTGAGGGGG - Intergenic
984214041 4:176886064-176886086 CAGGACCTTTGTGTGCAAGAGGG + Intergenic
984359756 4:178713235-178713257 CAGGACATATGTATGTGAGGTGG + Intergenic
1202767286 4_GL000008v2_random:158980-159002 GAGGATGTATATGTGTAATGCGG + Intergenic
988828925 5:34968889-34968911 CAGGATGTATTTGTGTAATATGG + Intergenic
989312360 5:40034894-40034916 CAGGCTCTTTCTGTGTAGGGAGG - Intergenic
991362777 5:65838206-65838228 CAGTATCTACATTTGTAAGGAGG + Intronic
993408255 5:87540041-87540063 CAGTATCTATTTGTATGAGGAGG + Intergenic
995228968 5:109736733-109736755 CAGGTTCTAGGAGGGTAAGGTGG - Intronic
995490809 5:112690075-112690097 CAGGATATATCTGTGTACAGGGG + Intergenic
996034498 5:118743004-118743026 CAGCATCTATGTCTTTTAGGTGG - Intergenic
997151162 5:131496963-131496985 CACCATCAATGTGTGTAGGGTGG + Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998148158 5:139742129-139742151 CAGGGTATATGTGGGTATGGGGG + Intergenic
998848461 5:146333298-146333320 CAGGACCTATGGGTGGAGGGGGG + Intronic
1002374364 5:178777674-178777696 AAGGATCAAAGTGTGTCAGGGGG - Intergenic
1003687493 6:8318753-8318775 GAAGATATATGTGTGTATGGAGG - Intergenic
1005442859 6:25889958-25889980 CAAGATCTAGGTCAGTAAGGTGG + Intergenic
1007261670 6:40568344-40568366 TGGGATCTATGTGTCTAAGATGG + Intronic
1011873293 6:91924679-91924701 CAGGATTTATGTGTCTGTGGTGG - Intergenic
1014729069 6:125009363-125009385 CAGGCTCTATGTCTGTGAGAGGG - Intronic
1015070923 6:129091976-129091998 CAGGTTCTATGTGGCTTAGGTGG + Intronic
1016516070 6:144894220-144894242 TAAGATGTGTGTGTGTAAGGGGG + Intergenic
1016899216 6:149084336-149084358 CAGGATCTAAGAGTGTTTGGGGG - Intergenic
1022254591 7:28643486-28643508 GTGTATCTATCTGTGTAAGGTGG - Intronic
1022704118 7:32787244-32787266 CAGGTTGTATGTCTGTATGGGGG - Intergenic
1023857886 7:44196311-44196333 CAGTCTCTATGTCTGTAGGGTGG + Intronic
1025705835 7:63862273-63862295 GTGTATCTATGTGTGTAATGTGG + Intergenic
1027998768 7:85464208-85464230 CAGGGTATATGTGTGTAGGGTGG - Intergenic
1028590479 7:92488160-92488182 CAGGATGTATGTGGATAAAGGGG + Intronic
1029036368 7:97526614-97526636 CAGGATCCATGTTAGTAAAGAGG - Intergenic
1034570894 7:151955560-151955582 CAGGGTCTGTGAGTGGAAGGGGG - Intergenic
1037612593 8:20488915-20488937 GAGCATCAATCTGTGTAAGGTGG - Intergenic
1037774098 8:21821443-21821465 CATCATCTATGTCTGTAAGGGGG - Intergenic
1041354013 8:56980856-56980878 GAGAATATATATGTGTAAGGGGG - Intronic
1041594798 8:59636357-59636379 GAGGATCTATACGTGTTAGGAGG - Intergenic
1042333113 8:67603485-67603507 CAGGATCTATATGTTTAAAATGG + Intronic
1053492812 9:38523380-38523402 AAGGCTCTGTGTGTGTGAGGAGG - Intergenic
1058225377 9:102355211-102355233 CAGGAACTATTTGTATATGGAGG - Intergenic
1185650291 X:1642586-1642608 CAGCCTCTATGTGTGTGATGGGG + Intronic
1185915124 X:4026550-4026572 CAGGATCTAAGTTAGCAAGGAGG + Intergenic
1192024229 X:67431682-67431704 ATGGATCTAAGTGTGCAAGGTGG - Intergenic
1193305377 X:79944558-79944580 CAGGGTTTATGTGTGTCAGTGGG + Intergenic
1195711065 X:107774418-107774440 CAAGAACTATGTGTGGCAGGAGG - Intronic
1197482564 X:127005065-127005087 CAGCATGTATGTGTGTAGGCAGG + Intergenic
1198529269 X:137534038-137534060 CAGGCTCTATGCGTGAAAGAAGG - Intergenic
1198771906 X:140139199-140139221 CAGCATGTGTGTGTGTCAGGGGG + Intergenic
1199004251 X:142676121-142676143 TAGCATCTCTGTGTGAAAGGGGG - Intergenic