ID: 1092145605

View in Genome Browser
Species Human (GRCh38)
Location 12:6212559-6212581
Sequence GGGGTGCTAGTGCAGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 0, 3: 30, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092145605_1092145620 26 Left 1092145605 12:6212559-6212581 CCCCCCAGCTGCACTAGCACCCC 0: 1
1: 1
2: 0
3: 30
4: 226
Right 1092145620 12:6212608-6212630 GGCAGGCTAAGCATGTGCTTAGG 0: 2
1: 0
2: 1
3: 15
4: 164
1092145605_1092145621 27 Left 1092145605 12:6212559-6212581 CCCCCCAGCTGCACTAGCACCCC 0: 1
1: 1
2: 0
3: 30
4: 226
Right 1092145621 12:6212609-6212631 GCAGGCTAAGCATGTGCTTAGGG 0: 2
1: 1
2: 3
3: 15
4: 130
1092145605_1092145617 5 Left 1092145605 12:6212559-6212581 CCCCCCAGCTGCACTAGCACCCC 0: 1
1: 1
2: 0
3: 30
4: 226
Right 1092145617 12:6212587-6212609 AGGGAGGCCACAGAGTCAGTAGG 0: 1
1: 0
2: 2
3: 43
4: 296
1092145605_1092145618 9 Left 1092145605 12:6212559-6212581 CCCCCCAGCTGCACTAGCACCCC 0: 1
1: 1
2: 0
3: 30
4: 226
Right 1092145618 12:6212591-6212613 AGGCCACAGAGTCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092145605 Original CRISPR GGGGTGCTAGTGCAGCTGGG GGG (reversed) Intronic
900942722 1:5811412-5811434 GGCGTGCTGGTGCTGATGGGCGG - Intergenic
901866978 1:12112782-12112804 GGGGTGCTGCTGGCGCTGGGAGG - Intronic
902362826 1:15951413-15951435 GGGGTGCAAGAGCAGCTCGAGGG + Intronic
902919647 1:19658192-19658214 AGGGTTAAAGTGCAGCTGGGAGG - Intronic
904043638 1:27598195-27598217 GGGCTGCTTCTGCAGCTGGCTGG - Intronic
904282676 1:29432429-29432451 GGGGTCCCAGTGGAGGTGGGAGG - Intergenic
904353936 1:29926451-29926473 GGGTTACTAGTGCCCCTGGGAGG + Intergenic
904484258 1:30814440-30814462 GGGGTGGAAGAGCAGCTGGGAGG - Intergenic
905180205 1:36160892-36160914 GTGGTAATAGTCCAGCTGGGGGG + Intronic
907697081 1:56742051-56742073 GGGGTGGCAGTGGGGCTGGGGGG + Intronic
909170290 1:72284690-72284712 GGAGTGCCAGTTCAGCAGGGAGG - Intergenic
910549769 1:88462860-88462882 GGGGTGCCAGGGGCGCTGGGCGG - Intergenic
911054284 1:93697314-93697336 GAGGGGATAGTCCAGCTGGGAGG + Intronic
911789707 1:101997696-101997718 GGGGGGATATTTCAGCTGGGGGG - Intergenic
912418978 1:109530805-109530827 GGGGTGCTACCGCAGCTGGAGGG - Intergenic
918057353 1:181033489-181033511 TGGGTGCTAGAGTAGCAGGGAGG + Intronic
918180363 1:182081786-182081808 GGGGTGGTAGTGGAGGTGGGCGG + Intergenic
918423498 1:184386834-184386856 GGGCTGCTAGGGCTGCGGGGCGG - Intergenic
919878594 1:201888332-201888354 AGGGAGCCAGTGCAGCTGGCAGG + Intergenic
920273768 1:204788206-204788228 GTGGGGCTTGTGCAGTTGGGTGG + Intergenic
922891119 1:229062539-229062561 GGGGTCCGAGTTGAGCTGGGAGG + Intergenic
1067527822 10:47048841-47048863 GGGGGGTTACTGCAGCTGGCCGG + Intergenic
1067698513 10:48552451-48552473 GGGTGGCAAGTGCATCTGGGGGG - Intronic
1067727331 10:48780131-48780153 GTGGGGCAAGTGCAGCTTGGAGG - Intronic
1068583799 10:58773633-58773655 GGGGTGCTGGTCCAGCTTGCTGG + Intronic
1069793751 10:71039753-71039775 GGGGTGCCAGTCCAGGTGTGCGG - Intergenic
1070606501 10:77902051-77902073 GTGGTGTGAGTGCAGCTCGGTGG - Intronic
1070802161 10:79250213-79250235 GGGCTGGTGGTGGAGCTGGGTGG - Intronic
1071511287 10:86264148-86264170 GGGGTGGTACTGCAGCTGCTGGG - Intronic
1072611291 10:97019121-97019143 AGGGTGCTAGTGCAGGGGGAGGG + Intronic
1073266287 10:102230388-102230410 GGGGTGTTTGGGCAGCTGGGGGG - Exonic
1073635269 10:105191648-105191670 TGGGTGAGAGTGCAGGTGGGGGG + Intronic
1075277820 10:121110911-121110933 GGGGTGTGGGTGAAGCTGGGTGG + Intergenic
1075874569 10:125795647-125795669 GGGATGCTGGTGGAGCTGGAGGG - Intronic
1076554616 10:131312972-131312994 GGCGTGTCAGTGCCGCTGGGTGG - Intergenic
1076908886 10:133377757-133377779 GGGGAGCTGGGGCAGGTGGGTGG + Intergenic
1077500614 11:2908293-2908315 GGGGTGCTGCAGCTGCTGGGCGG + Exonic
1078823959 11:14908156-14908178 GAGGTCCCAGTGCAGCTGGAAGG + Intronic
1079129957 11:17741540-17741562 GAGGTGGGAGAGCAGCTGGGGGG - Intronic
1080659534 11:34284865-34284887 GGGGTGTTAATGAGGCTGGGTGG + Intronic
1081389603 11:42514376-42514398 GAGGAGCTAGTGCAGCTGTTTGG + Intergenic
1081855041 11:46297523-46297545 AGGGCGCTAATGCAGCAGGGAGG - Intronic
1083757681 11:64800450-64800472 GGGGTGGTAGGGCAGCTGGCAGG - Intronic
1084494889 11:69497994-69498016 GGGGTGCAAGTGTAGGTGGAGGG + Intergenic
1089108371 11:116034373-116034395 GGGGTGGTGGTGCTGGTGGGCGG + Intergenic
1089395407 11:118133515-118133537 GGTGTGCGAGTGCCTCTGGGAGG - Exonic
1090277488 11:125430096-125430118 GGGGTGCTGCAGCAGCAGGGCGG + Exonic
1091140825 11:133233218-133233240 AGGGTGGTATAGCAGCTGGGAGG - Intronic
1091396424 12:156464-156486 GGGGAGCTGGGGCAGCTGTGGGG + Intronic
1091396432 12:156483-156505 GGGGAGCTGGGGCAGCTGGGGGG + Intronic
1091715837 12:2775555-2775577 GGGGTGCTGTTCCAGCTGGTGGG - Intergenic
1092145605 12:6212559-6212581 GGGGTGCTAGTGCAGCTGGGGGG - Intronic
1092552152 12:9514713-9514735 GAGGTTCTAGGGCAGCAGGGAGG + Intergenic
1093369717 12:18352915-18352937 GGGGTGGCAGAGCAGCTGAGTGG - Intronic
1093790131 12:23239076-23239098 GGGCAGCTAGAGAAGCTGGGAGG - Intergenic
1094025582 12:25957937-25957959 GGGTTGGGAGTGCAGCGGGGCGG + Intergenic
1094791846 12:33924357-33924379 GCTGTGCTAGAGCAGCAGGGTGG - Intergenic
1095990872 12:48033705-48033727 GGGGTATGAGGGCAGCTGGGAGG - Intergenic
1099958989 12:89378929-89378951 GGAGTGCTACTGGAGGTGGGAGG - Intergenic
1100967895 12:100032999-100033021 GGGGTGCAAGTGCAGGTAGGTGG + Intronic
1103737629 12:123070579-123070601 GGGCAGCCAGTGGAGCTGGGAGG - Intronic
1104197817 12:126558119-126558141 GAGGTGCTAGTGCTGGAGGGTGG - Intergenic
1104921548 12:132293165-132293187 GGGGGGCTCAGGCAGCTGGGAGG + Intronic
1104984186 12:132587380-132587402 AGGGTGGCAGTGCAGCTGGAGGG + Intergenic
1108434278 13:50386445-50386467 GAGGTGCTAGAGCTGCTGTGAGG - Intronic
1110682684 13:78334933-78334955 GGGTTTCTTGTACAGCTGGGTGG - Intergenic
1110915615 13:81016725-81016747 GGGCTGCTAATACAGCTGAGTGG + Intergenic
1113379383 13:109787613-109787635 GGGGTGCTCCTGCAGCGGTGGGG - Intergenic
1118316759 14:64730462-64730484 GGGGAGCCAGGGCTGCTGGGTGG + Intronic
1118893056 14:69925006-69925028 GGGGAGGTAGGGGAGCTGGGGGG + Intronic
1118893083 14:69925091-69925113 GGGGAGGTAGGGGAGCTGGGGGG + Intronic
1118893108 14:69925176-69925198 GGGGAGGTAGGGGAGCTGGGTGG + Intronic
1119526005 14:75323114-75323136 GGTGGGACAGTGCAGCTGGGGGG - Intergenic
1119774081 14:77237785-77237807 TGGGTGCTGGTCCAGATGGGTGG - Intronic
1119974889 14:79014690-79014712 GGGGAGCTAGTGCAGTTGTTTGG + Intronic
1121443984 14:93967173-93967195 GAGGTACCTGTGCAGCTGGGTGG + Intronic
1122015311 14:98790087-98790109 GGGCTGGGAGTGCAGCTGTGAGG + Intergenic
1122346863 14:101066257-101066279 GGGGAGCTAGTCCCGCTGGAAGG + Intergenic
1122824573 14:104363302-104363324 GGGCTGCCAGGGCAGCTTGGGGG + Intergenic
1124661435 15:31553755-31553777 GGGGTGGTAGTGCAGGTGAGGGG - Intronic
1124685963 15:31782267-31782289 GGTGTGCAGGAGCAGCTGGGAGG + Intronic
1125717031 15:41825194-41825216 GGGGTGCTATTTCAGGTGGCTGG + Exonic
1126315080 15:47361560-47361582 GAGCTGCTAGTCTAGCTGGGAGG - Intronic
1127694642 15:61433302-61433324 GGGGTGCTTTCTCAGCTGGGAGG - Intergenic
1128610221 15:69067176-69067198 GGGGTGCAAGTGCAAGTTGGAGG - Intergenic
1128672740 15:69586543-69586565 GGTGTGCATGTGGAGCTGGGAGG + Intergenic
1129060293 15:72855752-72855774 GAGATGCAAGTGCCGCTGGGTGG + Intergenic
1129412883 15:75359580-75359602 GGGTTGCTACTGCAGCAGGAAGG - Intronic
1129727344 15:77908340-77908362 GTGGAGCTGGTGCAGCGGGGCGG - Intergenic
1129885180 15:79032339-79032361 GGGTGGCTAGGGCAGCTTGGTGG + Intronic
1131747296 15:95462950-95462972 GGGGTGGTGGGGCAGCTGTGGGG - Intergenic
1132383863 15:101386216-101386238 GGGGAGCTGCTGCAGCTGAGGGG + Intronic
1132756241 16:1486845-1486867 GGGGCGCTGGCTCAGCTGGGTGG - Intronic
1137236944 16:46624676-46624698 GGGGTGAGAGTGGAGCTGAGTGG - Intergenic
1138090061 16:54166529-54166551 GGGGTCCTGGCACAGCTGGGAGG + Intergenic
1138477970 16:57283415-57283437 TGGGTGCTAGCGCTGCTGCGAGG - Intronic
1138511822 16:57513130-57513152 GTGGTGCCAGAGCAGCTGGGCGG + Intronic
1139101264 16:63770316-63770338 GGGTTGCTTGGGCAGCTGGAGGG - Intergenic
1139925068 16:70481480-70481502 TGGGTTCTCCTGCAGCTGGGTGG - Exonic
1141882822 16:86871118-86871140 GGGGTGCTGGGGCAGGTGGCCGG + Intergenic
1142477001 17:194482-194504 CGGGTGACAGGGCAGCTGGGTGG + Intergenic
1142479407 17:209070-209092 AGGGTGATGGTGGAGCTGGGTGG - Intergenic
1143402909 17:6657439-6657461 GGGGTGCGAGAGAAGCTGGGGGG + Intergenic
1144735508 17:17553247-17553269 GGGGTGATCTGGCAGCTGGGTGG + Intronic
1146824210 17:36009260-36009282 GGGGCCCTAGTGCAGCTGGCTGG + Intergenic
1151418221 17:73980699-73980721 GGGATGCTATTGCAGCTGAGAGG - Intergenic
1152087798 17:78231281-78231303 GGGGTGCCAGTGGGGGTGGGAGG - Intergenic
1152301419 17:79497126-79497148 GGAGTGGCAGTGCACCTGGGTGG - Intronic
1152784804 17:82242063-82242085 GGGGTGGGAGGGGAGCTGGGAGG + Intronic
1153223683 18:2882234-2882256 GGGCTGCTCGGGCAGTTGGGAGG - Intronic
1154412815 18:14150525-14150547 GGGGTTTGAGTGCAGCTGTGGGG - Intergenic
1156284123 18:35674383-35674405 GGGGTGCTATTGAAGCTCAGCGG + Intronic
1156632347 18:38985222-38985244 GTGGAGCTGGAGCAGCTGGGAGG - Intergenic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1160143113 18:76343421-76343443 GAGGTGCAAGGGCAGCTGAGCGG + Intergenic
1160503063 18:79411635-79411657 GGGCTCCTCGTGGAGCTGGGAGG + Intronic
1160914761 19:1491194-1491216 GCGGTGCGCGTGCAGCGGGGTGG + Exonic
1160935717 19:1593595-1593617 GGGGTGGTCGGGGAGCTGGGGGG - Intergenic
1160936773 19:1599779-1599801 GGGGTGGGAGTGGAGCTGGGGGG + Intronic
1160967888 19:1754506-1754528 GGGCTGCTGGCGCCGCTGGGCGG + Exonic
1161286011 19:3468576-3468598 GGGGTGGGGGGGCAGCTGGGAGG + Intronic
1161572337 19:5037455-5037477 AGGGTGCTGGGGCAGCTGCGGGG - Intronic
1161720137 19:5897862-5897884 GAGGGGCTGGTGAAGCTGGGCGG - Intronic
1161811837 19:6475815-6475837 GGTGAGCGAGGGCAGCTGGGAGG - Exonic
1163129255 19:15262147-15262169 TGAGAACTAGTGCAGCTGGGAGG + Intronic
1163575639 19:18109643-18109665 GGGGTGCAGGTACAGCTTGGCGG + Intronic
1164411841 19:28012685-28012707 GGGGTCCTGGTGCATCTGAGGGG - Intergenic
1165226742 19:34360179-34360201 TGGGGGGTAGTGAAGCTGGGAGG - Intronic
1165466879 19:35979976-35979998 GTGTTGCTAATGCTGCTGGGGGG - Intergenic
1166686621 19:44800401-44800423 GGGGTCCCAGCGCAGCTGGAGGG - Exonic
1167409346 19:49335791-49335813 GGGGGGCTGGGGCAGGTGGGAGG + Intronic
1168380414 19:55915762-55915784 GGGGTGGGAGTGAAGTTGGGTGG - Intronic
1168403637 19:56099814-56099836 GGGGTCCAAGACCAGCTGGGAGG + Intronic
927823272 2:26288025-26288047 GGGAGGCTAAGGCAGCTGGGTGG + Intronic
931700005 2:64901790-64901812 GAGGTGCTAGAGCAGCTATGGGG + Intergenic
931845481 2:66199508-66199530 GGGGTGATAGGGAAGGTGGGTGG + Intergenic
934168185 2:89315763-89315785 TGGATGCTAGTGCAGCAGAGGGG - Intergenic
934199101 2:89866818-89866840 TGGATGCTAGTGCAGCAGAGGGG + Intergenic
938379736 2:130829753-130829775 GGGGTGGTAGTGCAGGTAGATGG - Intergenic
940835732 2:158519474-158519496 GGAGAGAGAGTGCAGCTGGGTGG - Intronic
944471266 2:200055672-200055694 GGGGTTCTACTGCTACTGGGAGG - Intergenic
944941609 2:204634119-204634141 GGGGAGCTAGGGCAGGAGGGAGG - Intronic
949031061 2:241797759-241797781 GGGGTGCTAGAACAGCAGGGAGG - Intronic
1170437264 20:16343016-16343038 GGGGTGCTGATGCAGAGGGGAGG + Intronic
1171190633 20:23156712-23156734 GGGGTGCTCGGGCAGCAGGGAGG + Intergenic
1171360226 20:24582133-24582155 GGGGAGGGAGTGCAGCAGGGAGG - Intronic
1171411750 20:24952577-24952599 GGGGTGCAAGTCCAGCTTAGAGG - Intronic
1173667562 20:44773764-44773786 GGGGAGCCAGGGCTGCTGGGAGG - Intronic
1173923988 20:46767234-46767256 GAGGTCAGAGTGCAGCTGGGTGG + Intergenic
1174338760 20:49883075-49883097 GAGCTCCTAGAGCAGCTGGGAGG - Intronic
1174467446 20:50729173-50729195 TGGGTGCCAGTGCACCTGCGTGG - Intergenic
1175546390 20:59780676-59780698 GGGCTGTCTGTGCAGCTGGGTGG + Intronic
1175912943 20:62413363-62413385 GGGGTCAGAGTCCAGCTGGGAGG - Intronic
1176007678 20:62875280-62875302 GGGGTGCGGGTGCGGGTGGGGGG - Intergenic
1178825115 21:36008719-36008741 GGGAGGCTAGTGCACCTGTGTGG - Intergenic
1179923854 21:44521928-44521950 GAGGTGCGAGTGCACCTTGGTGG + Exonic
1179952639 21:44718762-44718784 GGGCTGAAATTGCAGCTGGGTGG - Intergenic
1180717326 22:17880712-17880734 GGCGTGCAAGTGCAGTGGGGAGG + Intronic
1180798382 22:18619259-18619281 GGGCTGCCAGAGGAGCTGGGAGG + Intergenic
1180839762 22:18953866-18953888 GGGGTGGGGGTGCAGCTGGGTGG - Intergenic
1181062138 22:20286613-20286635 GGGGTGGGGGTGCAGCTGGGTGG + Intergenic
1181223336 22:21376006-21376028 GGGCTGCCAGAGGAGCTGGGAGG - Intergenic
1181255404 22:21559620-21559642 GGGCTGCCAGAGGAGCTGGGAGG + Intronic
1181604255 22:23970870-23970892 GGGGTGATGGGGCAGCTGGGAGG + Intronic
1182234687 22:28866050-28866072 TGGGTGTTTGTGGAGCTGGGAGG - Intergenic
1183590802 22:38778318-38778340 GGGGGCCAAGTGCAGCTGGATGG - Intronic
1183693262 22:39403440-39403462 GGGGTGCTGGTGCAGCTGGGTGG + Intronic
1184431031 22:44441685-44441707 AGGGTGCTGGGGCAGCAGGGAGG - Intergenic
1184451293 22:44584281-44584303 AGGGTGCTAGTGGAGCTGGCAGG - Intergenic
1185038599 22:48492414-48492436 GGCTTCCTAGTGCAGCTAGGAGG + Intronic
1185215927 22:49600006-49600028 GGGGTCCGAGTGCCACTGGGCGG - Intronic
1185364871 22:50432848-50432870 GGGGTCTGAGTGCAGCTGTGGGG + Intronic
950182635 3:10926272-10926294 GGGGTGCAAGAGTTGCTGGGAGG - Intronic
950666413 3:14497954-14497976 GGGGTGCTGGAGCTGCTGGGAGG + Intronic
950756245 3:15175152-15175174 AGGGTGCTGGTTCAGCTGGAAGG + Intergenic
952512157 3:34068730-34068752 GGGCTGTTAGTGCAGCACGGAGG - Intergenic
953418171 3:42734798-42734820 GGGGTGGTGGTGGGGCTGGGTGG - Intronic
953980600 3:47411098-47411120 GGGGTGGTTCTGCTGCTGGGGGG - Exonic
954418574 3:50406438-50406460 GGGGTGATAGGGCTGATGGGGGG - Intronic
954945919 3:54424281-54424303 GGGGTGCAGGTGCAGCTGTGAGG + Intronic
955443595 3:58983212-58983234 GGAGTGCTATGGCAACTGGGTGG + Intronic
956433370 3:69209210-69209232 TGAGTGCAAGGGCAGCTGGGTGG - Intronic
958019761 3:87980980-87981002 GGGCTGCTGCTGCACCTGGGGGG + Intergenic
959392153 3:105788999-105789021 GGGATGCTAGTTCAGCTGGAAGG - Intronic
959743657 3:109750892-109750914 GGCTTGCCAGTGCAGCTGCGGGG + Intergenic
961750063 3:129089373-129089395 GGGGTGAGAGTGGAGCTGAGTGG - Exonic
962429603 3:135307058-135307080 GGGGTGCCAGAGCAGCTTTGGGG + Intergenic
964210418 3:154220584-154220606 GGGGTGCAAGAGGAGCAGGGTGG + Intronic
964414215 3:156430670-156430692 AGGCTGCTAGTGGAGCAGGGAGG - Intronic
966683756 3:182671276-182671298 AGGATGTTAGTGCAGCTTGGGGG - Intergenic
967158915 3:186718113-186718135 GGGGTGGTAGTGGTGGTGGGTGG - Intronic
967159007 3:186718362-186718384 GGGGTGGTAGTGGTGGTGGGTGG - Intronic
969788393 4:9475088-9475110 GGGGGGCAAGTGCGGCTGGCTGG - Intergenic
970607666 4:17695590-17695612 GTGGTGGCAGTGCAGCTGGGAGG + Intronic
973729048 4:53805442-53805464 AGAGTGATAGTGCATCTGGGAGG - Intronic
976607796 4:86998763-86998785 GGGGTGGTAGTGGTGATGGGAGG + Intronic
981331429 4:143514122-143514144 GGGGAGCGGGTGCAGCGGGGAGG + Intronic
985287797 4:188354655-188354677 GGAGTGCTAGTTAAGCTGGATGG + Intergenic
987138586 5:14922321-14922343 GGGGTGCTACTGGAGCTGAGGGG + Intergenic
989461772 5:41708011-41708033 GGGGAGCTAGTGCAGCTGTTTGG + Intergenic
989505951 5:42228155-42228177 GGGGAACTAGTGCAGCTGTTTGG + Intergenic
996071464 5:119136645-119136667 CTGGAGCTAGAGCAGCTGGGAGG - Intronic
998138113 5:139685039-139685061 GGGGAGGTGTTGCAGCTGGGGGG + Intergenic
998153736 5:139772141-139772163 GGAGTGGAAGGGCAGCTGGGTGG + Intergenic
998168530 5:139858395-139858417 GGGGTGCTAGTGTAGCGAAGTGG - Intronic
1000070005 5:157731594-157731616 TGGGTGGTAGTGCGGCTGGACGG + Exonic
1000171615 5:158707996-158708018 TTGGTGCTGGTGCAGGTGGGAGG + Exonic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1002080701 5:176735815-176735837 GGGGTCCAAGAGCTGCTGGGTGG - Intergenic
1002105493 5:176877682-176877704 GTCGTGCGAGGGCAGCTGGGAGG + Exonic
1002312899 5:178325368-178325390 GGAGGGCAAGTGGAGCTGGGCGG - Intronic
1003112393 6:3260933-3260955 AGGGAGCTAATGCGGCTGGGAGG - Intronic
1003392781 6:5727893-5727915 GAGTTGCCCGTGCAGCTGGGAGG + Intronic
1003774867 6:9348937-9348959 GGGGCCCCAGTGCAGCTGGGTGG + Intergenic
1004635383 6:17462558-17462580 TGGGTGCTGGGGCTGCTGGGAGG - Intronic
1005281958 6:24283927-24283949 AGGGTGCTATTTCAGCTGGGTGG - Intronic
1005994655 6:30923925-30923947 GGGGTGGCAGTGGAGCGGGGGGG - Intronic
1006302944 6:33203754-33203776 GAGGTGCTGGGGCTGCTGGGGGG + Exonic
1006602281 6:35233929-35233951 GGGTTGCTGGTGGAGCTGAGAGG - Intronic
1007370257 6:41422227-41422249 GGGATGCTGGGGCAGCTGGCAGG - Intergenic
1010899509 6:81408734-81408756 GGGAAGCTAGTGTATCTGGGTGG - Intergenic
1013115739 6:107102513-107102535 GGGGTGCTGGTGCGGCTGCCTGG + Intronic
1013792945 6:113857049-113857071 GGGGTACTTGTGCATCGGGGCGG - Intergenic
1020111719 7:5451511-5451533 GGGCTGGCAGTGCAGCTTGGTGG - Intronic
1023624925 7:42106404-42106426 GGGTTCCTATTGCAGCTGGAGGG - Intronic
1024670248 7:51587749-51587771 GGTGTGCTAGTGCAGGAGGGCGG - Intergenic
1026858423 7:73769751-73769773 GGGCTGCTAGTGGCGCTGGTGGG - Exonic
1028085101 7:86626415-86626437 GGGGTGGTAGTGTAACTGGAAGG + Intergenic
1030585520 7:111413984-111414006 GGGATGCTAGTGGAACTGGCTGG - Intronic
1032279899 7:130491955-130491977 GCGGTGGTAGAGCGGCTGGGAGG + Intronic
1033228073 7:139576421-139576443 GGGGTGCCAGTGCTGCTGCTTGG + Intronic
1034268546 7:149792522-149792544 GTGGTGGATGTGCAGCTGGGCGG - Intergenic
1034690125 7:153007346-153007368 GGGGTGCTAGTGCTGTCGGGTGG + Intergenic
1037825168 8:22156403-22156425 CTGGTGCAAGAGCAGCTGGGCGG + Exonic
1039608982 8:38904099-38904121 GGGGAGATAGGGCAGCTGAGAGG + Intronic
1045032895 8:98154392-98154414 GAGGTGCTAGTGTAAATGGGTGG + Intronic
1046697439 8:117357665-117357687 GGGGTGCGAGTACAGCTGCAGGG + Intergenic
1046716801 8:117576977-117576999 GAGGTGCTAGTTTGGCTGGGAGG - Intergenic
1049789238 8:144465515-144465537 GCGGGGCTAGAGCGGCTGGGGGG + Intronic
1053280381 9:36816661-36816683 GGGCTGCAAGTGCTGCTGGCTGG + Intergenic
1057133755 9:92672147-92672169 GGGGTGGTGGGGAAGCTGGGTGG + Intergenic
1060725362 9:126002630-126002652 AGGGTGCTAGGACGGCTGGGAGG - Intergenic
1060889533 9:127179311-127179333 TGGGTGCTGCTGCAGCTGTGGGG + Intronic
1061289993 9:129645231-129645253 GGGGTCCCGGTGGAGCTGGGTGG + Intergenic
1062028907 9:134353112-134353134 GGGCTGCTGGTGTGGCTGGGAGG + Intronic
1062094221 9:134694751-134694773 GGGCTGCCAGTGAAGCGGGGAGG + Intronic
1062254541 9:135614801-135614823 GGGGTCCTGGTGCTGCTGGTGGG + Intergenic
1062385339 9:136307137-136307159 TGGGAGCTGGTGCTGCTGGGAGG - Intergenic
1062493919 9:136822635-136822657 GGGGAGGGAGGGCAGCTGGGAGG - Intronic
1186626447 X:11298768-11298790 GGGCTGGTAGGGCTGCTGGGCGG - Exonic
1195626151 X:107007101-107007123 GGGGTGGTAGTGGAGCAGAGGGG - Intergenic
1196189806 X:112782424-112782446 GGGGTGATGGTGGAGCGGGGAGG + Intronic
1196938281 X:120751141-120751163 GGGATGATAGAGCAGGTGGGAGG - Intergenic
1200002421 X:153068883-153068905 GGGGTGTTGGTGGAGCAGGGAGG + Intergenic
1200005303 X:153081127-153081149 GGGGTGTTGGTGGAGCAGGGAGG - Intergenic
1200052887 X:153444234-153444256 GGGGTGACAATGCAGATGGGCGG + Intergenic
1200124009 X:153804737-153804759 GGGGTGTTGGTGGAGCTCGGGGG + Exonic
1201920563 Y:19229342-19229364 GTGGTGCTATTGCAGCTTGCTGG - Intergenic