ID: 1092146276

View in Genome Browser
Species Human (GRCh38)
Location 12:6216795-6216817
Sequence CTGTGATCGGAGAAGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092146276_1092146283 4 Left 1092146276 12:6216795-6216817 CCAGCCGCCTTCTCCGATCACAG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1092146283 12:6216822-6216844 ACACAACAGCCGTCCACAGAGGG 0: 1
1: 0
2: 2
3: 15
4: 152
1092146276_1092146282 3 Left 1092146276 12:6216795-6216817 CCAGCCGCCTTCTCCGATCACAG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1092146282 12:6216821-6216843 GACACAACAGCCGTCCACAGAGG 0: 1
1: 0
2: 1
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092146276 Original CRISPR CTGTGATCGGAGAAGGCGGC TGG (reversed) Intronic
901825399 1:11858172-11858194 CTGGAATGGGGGAAGGCGGCCGG + Intronic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
902189898 1:14754996-14755018 CTGTGAGCGGCCAAGGCGGGAGG + Intronic
904010944 1:27390280-27390302 CTGCGATGGGTGAAGGCTGCTGG - Intergenic
905752365 1:40477261-40477283 CTGTGGGCGGAGCCGGCGGCCGG + Exonic
907187415 1:52620497-52620519 CTGAGATCAGAGAAGGAGGTAGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
915815992 1:158965536-158965558 CTGTGTTCTGAGAAGGTGGTTGG - Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
924754996 1:246932319-246932341 CTGCAATCGCAGCAGGCGGCTGG - Intergenic
1066479850 10:35785387-35785409 CTGTTTTTGGAGAAGGCAGCAGG - Intergenic
1067383661 10:45798569-45798591 TTGTGATAGGAGAAGGCTGTGGG + Intergenic
1067880518 10:50040232-50040254 TTGTGATAGGAGAAGGCTGTGGG - Intergenic
1067891363 10:50139136-50139158 TTGTGATAGGAGAAGGCTGTGGG + Intergenic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069613862 10:69793647-69793669 ATGTGCTCGGAGAAGGACGCAGG - Intergenic
1070508362 10:77137519-77137541 CTGTGATGGCAGAAGGGTGCAGG - Intronic
1076790441 10:132774445-132774467 CTGTGCTCAGAGGAAGCGGCAGG - Intronic
1076823415 10:132953720-132953742 CTGTGATGGGAGCAGGGAGCTGG - Intergenic
1076923475 10:133467571-133467593 CTGTGGTGGGAGAAGAGGGCTGG + Intergenic
1077245356 11:1534375-1534397 GTGTGAGCAGAGAAGCCGGCTGG - Intergenic
1077458938 11:2699292-2699314 CTGTGATCTGGGACGGCCGCGGG + Intronic
1078007101 11:7540305-7540327 CTCTGATGGGAGATGACGGCAGG + Intronic
1078064931 11:8072110-8072132 CTGTGATCGGACCAGGAGTCGGG + Intronic
1084072585 11:66745662-66745684 TTGTCATCAAAGAAGGCGGCGGG + Intronic
1084453193 11:69252117-69252139 CTGTGGTCGGGGCAGACGGCGGG - Intergenic
1085267505 11:75245961-75245983 GTGTGATCAGAGGAGGAGGCTGG - Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1090843536 11:130513062-130513084 CTGTGAGGGGAGAAGAGGGCAGG + Intergenic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1097386491 12:58955977-58955999 ATGTGATGAGAGAAGGCAGCAGG + Intergenic
1099713802 12:86264789-86264811 CTGAGATCGGAGAGGGCGCCGGG - Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1106391640 13:29339820-29339842 CTGGGAGCGGAGAAGGGGCCTGG + Intronic
1107542251 13:41401960-41401982 CTGTGATCTGAGAATGTGGTTGG + Intergenic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1132478410 16:153806-153828 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1132480495 16:164396-164418 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1135436176 16:22428240-22428262 CTGTGATAGGCCAAGGCGGGAGG - Intronic
1135843087 16:25894209-25894231 CTGTGTTCTGTGAAGGGGGCAGG + Intronic
1136500616 16:30668186-30668208 CTGTGATGGGTCCAGGCGGCTGG + Intronic
1140196489 16:72859731-72859753 CAGTGAGGGGAGAATGCGGCAGG + Intronic
1142815362 17:2420780-2420802 CTGCGCTCGGAGACGGCGGAAGG - Exonic
1143499240 17:7329302-7329324 GTGTCAGCGGAGATGGCGGCAGG - Exonic
1145101631 17:20081958-20081980 CTGTGATGGAAGGAGGCAGCGGG - Intronic
1145973073 17:28968307-28968329 CTGGGAGCTGAGAAGGAGGCAGG + Intronic
1146688886 17:34859587-34859609 CTCTGCTCGGAGAAGGCACCTGG - Intergenic
1147168510 17:38605444-38605466 CTGGGACCAGAGAAGGGGGCAGG - Intronic
1151377624 17:73701751-73701773 CTTTGATAGGACAAGGCGGGCGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1157535972 18:48457536-48457558 CTGTGATCTGAGAAGAGGGGAGG - Intergenic
1159623788 18:70669272-70669294 CTGAGATTGGAGAAGGAGTCAGG - Intergenic
1160579219 18:79874131-79874153 CTGTGATGGGGAAAGGCGGGAGG - Intronic
1160701817 19:511205-511227 CTGGGCTCGGAGGAGGAGGCCGG - Intronic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1161435255 19:4259021-4259043 CTGTGTCCTCAGAAGGCGGCTGG - Intronic
1163284084 19:16335463-16335485 CTGTGGGCTGAGCAGGCGGCGGG - Intergenic
1163341440 19:16710097-16710119 CTGTGAGCGGGGAAGCAGGCAGG - Intergenic
1163768033 19:19174191-19174213 CTGTGGACGGAGCAGGGGGCAGG + Intronic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1167676033 19:50886556-50886578 CTGTGATTGGAGATGGAGACAGG - Intergenic
1168525947 19:57088883-57088905 CTGTAATCGAGGAAGGCCGCAGG + Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
927639052 2:24835241-24835263 CTGTAATCGGAGACAGCTGCTGG + Intronic
936522472 2:113219938-113219960 TTGTGATGGAAGAAGGCAGCAGG - Intronic
945036049 2:205704830-205704852 CTGGGTTCGGAGAAGGTGCCAGG - Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946397133 2:219448817-219448839 CGCTGCTCGGAGAGGGCGGCTGG - Exonic
946923585 2:224603979-224604001 CTGTACTCGGAGCAGCCGGCGGG - Intergenic
1168743224 20:212898-212920 GTGTGATCAGAGAAGGTGGTAGG - Intergenic
1168927548 20:1595322-1595344 CTATGAGCAGAGAAGGTGGCAGG + Intronic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1182060369 22:27392934-27392956 CTGTGATGGGATTAGGCTGCTGG - Intergenic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
954186279 3:48919199-48919221 CCGAGAGCTGAGAAGGCGGCGGG - Exonic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
961864663 3:129944914-129944936 GGGTGAGCGGTGAAGGCGGCTGG + Intergenic
962351366 3:134658829-134658851 CTCTGATCGGAGCAGGGAGCAGG - Intronic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
967191704 3:186990595-186990617 GAGGGATGGGAGAAGGCGGCTGG - Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968224900 3:196967415-196967437 CGCTTATGGGAGAAGGCGGCGGG + Intronic
971196221 4:24473126-24473148 AGGAGGTCGGAGAAGGCGGCCGG - Intergenic
972217112 4:36909716-36909738 TTGTGATGGGAGACGGAGGCTGG - Intergenic
977735193 4:100406583-100406605 CTGTGGTCGGAGAATGTGGCTGG + Intronic
981170349 4:141615797-141615819 CTGTGAGAGGTGAAGCCGGCTGG + Intergenic
981563490 4:146073320-146073342 CTGGGATGGGAGAAGGCTGTGGG - Intergenic
982805208 4:159754942-159754964 CTGTGATGGGAGAAGCTGCCTGG - Intergenic
984593052 4:181637642-181637664 CTGTGATTGTAGGAGGAGGCAGG - Intergenic
988986957 5:36629861-36629883 CTGTGGTCAGAGAAGGCTGATGG - Intronic
993563450 5:89441839-89441861 ATTTGATTGGAGAAGGAGGCAGG - Intergenic
997248277 5:132369921-132369943 CTGGGGTCGGGGAACGCGGCGGG - Exonic
1000189935 5:158900432-158900454 CTGTCATCGGAGATGGAGGAGGG + Intronic
1000255139 5:159530356-159530378 CTGAGGTGGGAGAAGGCGCCTGG - Intergenic
1002289059 5:178187367-178187389 CTGTGCTCGGGGAAGGCTGGCGG - Intergenic
1002685055 5:181003591-181003613 TGGAGATGGGAGAAGGCGGCTGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006910372 6:37559521-37559543 CTGTGGTCGGAGGAGGCTGCAGG - Intergenic
1007558262 6:42783734-42783756 TTGTGATGGAAGAAGGGGGCTGG + Intronic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1019140221 6:169938109-169938131 CTGTTAACGGAGGAGGCGGCGGG - Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1021757967 7:23873834-23873856 CTGAGATGAGAGAAGACGGCAGG + Intergenic
1027471945 7:78584673-78584695 GTGTGATTGAAGAAGGTGGCTGG + Intronic
1031253498 7:119417762-119417784 CTTTGATCGAAGAAGGAGACTGG + Intergenic
1031786487 7:126040564-126040586 CTGAGATCAGAGCAGGCGCCAGG - Intergenic
1033360801 7:140637767-140637789 CTGTGGTCTGAGAAGGGGACAGG - Intronic
1035133310 7:156675680-156675702 CTGTGAACTGAGGAGGAGGCGGG - Exonic
1035263388 7:157675426-157675448 AGGTGTTCGGAGAAGGCGCCCGG - Intronic
1035450933 7:158976416-158976438 CTGAGATCGGAGCAGGCGCTAGG - Intergenic
1049206593 8:141366475-141366497 CTGCGCTGTGAGAAGGCGGCAGG - Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1055645353 9:78357357-78357379 CTGAGATTGGAGCAGGCAGCAGG - Intergenic
1060819344 9:126652322-126652344 CTGTGATCAGATAAGCAGGCCGG - Intronic
1061922231 9:133788533-133788555 CTCTGCTCCGAGGAGGCGGCAGG + Intronic
1062598541 9:137309960-137309982 CTGGGATTGGAGAGGGCAGCTGG - Intronic
1062623860 9:137434320-137434342 CTGGGATCGGGGCAGGCGGCCGG - Exonic
1062710145 9:137971098-137971120 CTGTGCTCCTAGAAGGTGGCTGG + Intronic
1190323688 X:49193521-49193543 CTGTGATCCGAGGAGGCCCCAGG - Intronic
1198015069 X:132602216-132602238 CTGGGATGGGAGAAAGCAGCAGG + Intergenic
1198699535 X:139382402-139382424 CTGAGATCGGAGCAGGCACCAGG + Intergenic
1200361019 X:155606402-155606424 CTGTGGTCTGAGAATGTGGCTGG - Intronic