ID: 1092152852

View in Genome Browser
Species Human (GRCh38)
Location 12:6263004-6263026
Sequence CTAAGGTGCTTAAGTTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092152852_1092152858 3 Left 1092152852 12:6263004-6263026 CCCAGACAACTTAAGCACCTTAG No data
Right 1092152858 12:6263030-6263052 GACATTAGACTTGCCAAGTGGGG No data
1092152852_1092152856 1 Left 1092152852 12:6263004-6263026 CCCAGACAACTTAAGCACCTTAG No data
Right 1092152856 12:6263028-6263050 AAGACATTAGACTTGCCAAGTGG No data
1092152852_1092152859 4 Left 1092152852 12:6263004-6263026 CCCAGACAACTTAAGCACCTTAG No data
Right 1092152859 12:6263031-6263053 ACATTAGACTTGCCAAGTGGGGG No data
1092152852_1092152857 2 Left 1092152852 12:6263004-6263026 CCCAGACAACTTAAGCACCTTAG No data
Right 1092152857 12:6263029-6263051 AGACATTAGACTTGCCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092152852 Original CRISPR CTAAGGTGCTTAAGTTGTCT GGG (reversed) Intergenic
No off target data available for this crispr