ID: 1092155442

View in Genome Browser
Species Human (GRCh38)
Location 12:6278939-6278961
Sequence CCAGCTCGGCGCTCCGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092155442_1092155449 11 Left 1092155442 12:6278939-6278961 CCCTCCTCGGAGCGCCGAGCTGG No data
Right 1092155449 12:6278973-6278995 GGCGAGAAAGCGCCAATCGGCGG No data
1092155442_1092155446 -10 Left 1092155442 12:6278939-6278961 CCCTCCTCGGAGCGCCGAGCTGG No data
Right 1092155446 12:6278952-6278974 GCCGAGCTGGCTTTGAGCTCTGG No data
1092155442_1092155448 8 Left 1092155442 12:6278939-6278961 CCCTCCTCGGAGCGCCGAGCTGG No data
Right 1092155448 12:6278970-6278992 TCTGGCGAGAAAGCGCCAATCGG No data
1092155442_1092155451 20 Left 1092155442 12:6278939-6278961 CCCTCCTCGGAGCGCCGAGCTGG No data
Right 1092155451 12:6278982-6279004 GCGCCAATCGGCGGCAACCCGGG No data
1092155442_1092155450 19 Left 1092155442 12:6278939-6278961 CCCTCCTCGGAGCGCCGAGCTGG No data
Right 1092155450 12:6278981-6279003 AGCGCCAATCGGCGGCAACCCGG No data
1092155442_1092155453 29 Left 1092155442 12:6278939-6278961 CCCTCCTCGGAGCGCCGAGCTGG No data
Right 1092155453 12:6278991-6279013 GGCGGCAACCCGGGAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092155442 Original CRISPR CCAGCTCGGCGCTCCGAGGA GGG (reversed) Intergenic
No off target data available for this crispr