ID: 1092160447

View in Genome Browser
Species Human (GRCh38)
Location 12:6312678-6312700
Sequence GGCTCCCGCCTCTGCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092160439_1092160447 -2 Left 1092160439 12:6312657-6312679 CCCCAGAGCTGGCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 34
4: 371
Right 1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG 0: 1
1: 0
2: 2
3: 11
4: 209
1092160442_1092160447 -4 Left 1092160442 12:6312659-6312681 CCAGAGCTGGCGCCTCCCAGGCT 0: 1
1: 0
2: 1
3: 33
4: 306
Right 1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG 0: 1
1: 0
2: 2
3: 11
4: 209
1092160441_1092160447 -3 Left 1092160441 12:6312658-6312680 CCCAGAGCTGGCGCCTCCCAGGC 0: 1
1: 0
2: 1
3: 23
4: 264
Right 1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG 0: 1
1: 0
2: 2
3: 11
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092160447 Original CRISPR GGCTCCCGCCTCTGCTTGGC AGG Intronic
900127336 1:1074382-1074404 GGCTTCATCCTCTCCTTGGCGGG + Intergenic
900174267 1:1284913-1284935 AGCTCCCGCTTCTGCTGGCCTGG + Intronic
900534220 1:3169083-3169105 GTCTCCAGCCTCTACTTGGAAGG + Intronic
900600211 1:3499614-3499636 GGCTCCTGCCTCTGCCCCGCTGG - Exonic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901879650 1:12186205-12186227 GTCTCCCACCTCAGCCTGGCAGG - Intronic
902360429 1:15939492-15939514 AGCTTCTTCCTCTGCTTGGCTGG - Exonic
903046242 1:20566304-20566326 GACTCTGGCCTCGGCTTGGCAGG - Intergenic
904300423 1:29550209-29550231 GGCTCCTGCCTCTGCCTGGGTGG + Intergenic
906769493 1:48471759-48471781 GGGTCAGGCCTCTGCGTGGCCGG + Intronic
912437115 1:109669410-109669432 GGCCTCCTCCTCGGCTTGGCTGG + Intronic
913088720 1:115461587-115461609 GCCTCCAGCCTCTTCTTTGCGGG - Intergenic
913203936 1:116518320-116518342 GGCCCTCTTCTCTGCTTGGCTGG + Intronic
913271181 1:117095028-117095050 TGCTCCAGCCTCTGCTTCTCTGG - Intronic
914255926 1:145961225-145961247 TGCTCCCGCCTCTCCTAGCCCGG - Exonic
918107002 1:181424176-181424198 TGCTCCGGTCTCTTCTTGGCTGG - Intronic
919923598 1:202180564-202180586 GTCTCCCCACTCTGCTCGGCAGG - Intergenic
920631810 1:207659844-207659866 GACTCCCTCCTGTGCCTGGCTGG + Intronic
922731163 1:227949373-227949395 GGCTCCCGGCCCTGCTTCCCTGG + Intergenic
1066255915 10:33678819-33678841 GGCTCACAGTTCTGCTTGGCAGG + Intergenic
1066386023 10:34941884-34941906 GGCTCCCACCCCTGCCTAGCTGG + Intergenic
1071255829 10:83870716-83870738 GGCTCCAGGCTGTGCTGGGCTGG - Intergenic
1071294236 10:84207703-84207725 GACTCCAGGCTCAGCTTGGCTGG + Intronic
1072676519 10:97470353-97470375 GGCTCTGGTCACTGCTTGGCAGG - Intronic
1073363431 10:102918234-102918256 GGCACCCGCTTGTGATTGGCTGG + Intergenic
1073715034 10:106095053-106095075 GCCTTCAGCCTCTGATTGGCTGG + Intergenic
1074137952 10:110644237-110644259 GGCCCCCGCCCCCGCGTGGCCGG + Intergenic
1074153024 10:110775409-110775431 GGCTCCTGCTTCTGGATGGCTGG + Intronic
1075960986 10:126567589-126567611 GGCTTCCGACCCTGCTTTGCTGG - Intronic
1076581457 10:131514738-131514760 CGCGCCCTCCTTTGCTTGGCGGG + Intergenic
1076581967 10:131517849-131517871 GGCTTCCTCCGCTGCGTGGCAGG - Intergenic
1077026264 11:441402-441424 GGCCCCCACCTGTGCTGGGCGGG + Intronic
1077289796 11:1783721-1783743 GGTTCCCTCCTCTGCCTGGAGGG - Intergenic
1077444658 11:2585398-2585420 GGCCCCTGCATCAGCTTGGCTGG + Intronic
1078144074 11:8711200-8711222 GCCTCTCGCATCTGCTTGGTGGG + Exonic
1078508580 11:11969097-11969119 GGCTGCCAGCTCTGCCTGGCTGG + Intronic
1079131382 11:17748820-17748842 GGCTCCTGCTTCTGCATGGAGGG + Intronic
1079340634 11:19608895-19608917 GGCTGCCCACACTGCTTGGCTGG + Intronic
1081144279 11:39542345-39542367 GGCTACCGTCTCAGCTTTGCAGG + Intergenic
1083329979 11:61892965-61892987 AGCTCCTGCCTTTGCTTGTCAGG + Intergenic
1084487065 11:69454692-69454714 GGCCCCAGCCTCTGCGTGGATGG - Intergenic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1088401181 11:109423550-109423572 GGCTCCGTCCTCTTCTTGGCTGG + Exonic
1088706765 11:112470952-112470974 GGCTCCAGCTCCTGCTGGGCAGG + Intergenic
1089732347 11:120527163-120527185 TGATCCCGCCTCGGCTTGCCGGG + Intronic
1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG + Intronic
1092256434 12:6928577-6928599 GGCCCCCGACTCTCCTCGGCGGG - Intronic
1096030551 12:48410237-48410259 GATTCCCTCCTGTGCTTGGCTGG - Intergenic
1096710464 12:53452103-53452125 GGCTGCTGCCTCTGCTGGTCTGG - Intronic
1096773701 12:53951699-53951721 GGCTCCCGCCGCAGCTGGCCAGG - Intergenic
1097188493 12:57208427-57208449 GGATCTGACCTCTGCTTGGCCGG + Intronic
1097867288 12:64569339-64569361 CGCTGCAGCCTCAGCTTGGCTGG + Intergenic
1102646845 12:114409193-114409215 GGCTCCCGCCGCAGCTCTGCCGG - Intergenic
1103592840 12:122004445-122004467 GGCCCCGGCCTCTGCTGGGCGGG - Intergenic
1104289735 12:127456152-127456174 CGCTCCTGCCTCACCTTGGCTGG - Intergenic
1104990058 12:132619775-132619797 GGACCCCGCCTCAGCTAGGCGGG + Intronic
1105074605 12:133264632-133264654 TGCTGCCGCCTCACCTTGGCTGG - Intergenic
1105333157 13:19436888-19436910 GGCTGCAGCATCTCCTTGGCAGG - Intronic
1105389263 13:19959354-19959376 GGCTGCTGCCTCTGCTCCGCCGG + Intronic
1105878551 13:24582892-24582914 GGCTGCAGCATCTCCTTGGCAGG + Intergenic
1105921296 13:24966168-24966190 GGCTGCAGCATCTCCTTGGCAGG - Intergenic
1106021017 13:25915510-25915532 TGCTCCCGCCCCTGCTGGACTGG - Intronic
1106405786 13:29471715-29471737 TGCTCCAGCCTCTGCTCTGCAGG + Intronic
1106690022 13:32104924-32104946 GGCTCACGGTTCTGCATGGCTGG - Intronic
1107482552 13:40796677-40796699 GGGTCTCACCTCTGCTTGGTGGG + Intronic
1108624374 13:52212659-52212681 GGGTCTCACCTCTGCTTGGGTGG + Intergenic
1118225162 14:63891804-63891826 GGCACCAGCTGCTGCTTGGCCGG - Intronic
1118807389 14:69250111-69250133 GGCTCCAGCCTTTTCTGGGCAGG + Intergenic
1119484440 14:74978638-74978660 GGCTGCCCACTCTGCCTGGCTGG - Intergenic
1119703060 14:76768251-76768273 GGCTCCCCCCTCTTCCTGTCTGG - Intronic
1122296556 14:100709323-100709345 CGCTCCCGCCTCCACTTGCCGGG + Intergenic
1122686082 14:103507358-103507380 TGGCCCAGCCTCTGCTTGGCAGG - Intergenic
1123033395 14:105461649-105461671 GTCTCCAGCCTCTGCTGCGCTGG - Intronic
1123058573 14:105584124-105584146 GGCTCCCACCTGTGCCTTGCCGG + Intergenic
1123082905 14:105704358-105704380 GGCTCCCACCTGTGCCTTGCCGG + Intergenic
1124368237 15:29088928-29088950 TGCTCCCGCCTCAGCCTGGGAGG + Intronic
1125887200 15:43237943-43237965 GCCTCCGGCCTCATCTTGGCTGG - Intronic
1128636490 15:69305698-69305720 CTCTCCCTCCTCTGCTTGGTGGG - Intronic
1129161884 15:73752132-73752154 GGCCCCCGACGCTGCTTGGAGGG - Exonic
1129424462 15:75454090-75454112 CGCCCCCGCCTCTGATTGGTGGG - Intronic
1129521116 15:76186870-76186892 GGCTCCAGGCTCTGCCTGGTGGG + Intronic
1129698998 15:77756950-77756972 GGCCCCCACCTCTGCTGTGCAGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132886360 16:2184002-2184024 TGCCGCCTCCTCTGCTTGGCCGG + Intronic
1137754306 16:50889340-50889362 GGCTCCAGCTCCTGCTTGCCTGG - Intergenic
1138517368 16:57543644-57543666 GGCTCCAGACTGTGGTTGGCAGG + Intronic
1139694748 16:68666155-68666177 AGCTTCCTCTTCTGCTTGGCTGG + Intronic
1140233512 16:73138261-73138283 AGCTCCACTCTCTGCTTGGCTGG + Intronic
1142233297 16:88909852-88909874 AACTCCAGCCTCTACTTGGCCGG + Intronic
1142264470 16:89057451-89057473 GGCTCCCGCGTCCACTTGGGAGG - Intergenic
1142290152 16:89190409-89190431 GGGTGCCCCCTCTGCTAGGCTGG - Exonic
1143597295 17:7922995-7923017 GGCTCCGGCCGCTGCGTGGAGGG + Exonic
1144449482 17:15364318-15364340 GGCACCCACCTGTGCTTGGGTGG + Intergenic
1145066656 17:19766169-19766191 GGGGCCTGCCTCTGCTCGGCAGG - Intergenic
1145094188 17:20009934-20009956 CGCTCCCGCCCCTTCCTGGCCGG + Intronic
1145282312 17:21476999-21477021 GGCTCCTGACTGTGCTGGGCTGG + Intergenic
1145395127 17:22488602-22488624 GGCTCCTGACTGTGCTGGGCTGG - Intergenic
1146185658 17:30722561-30722583 GGGCCCAGCCTCAGCTTGGCAGG - Intergenic
1147400575 17:40178075-40178097 GGCTCCAGCCCCGGCTCGGCGGG - Intronic
1148578340 17:48726708-48726730 GGCCCCAGCCTGGGCTTGGCAGG + Exonic
1148740642 17:49890615-49890637 GGCGCCCGGCACTGCTGGGCTGG - Intergenic
1150567546 17:66355323-66355345 GGCTCCTTCCTCTCCTTGCCTGG + Intronic
1151547425 17:74801644-74801666 GACTCCCAGCTCTGCTTGGGTGG - Intronic
1151585239 17:75004650-75004672 GGCTTCCTGCTCTGCATGGCAGG - Exonic
1151671450 17:75573698-75573720 GGCTCCCACTGCTGCCTGGCTGG + Intronic
1152070551 17:78131874-78131896 GGCTCCCGCAGCTGCCTGGACGG - Exonic
1153654916 18:7273715-7273737 CTCTCCCGCCACTGCTAGGCTGG - Intergenic
1154000198 18:10476110-10476132 GGTTCCAGCCTCTCCTGGGCAGG - Intronic
1156298974 18:35818438-35818460 AGCTCCCGCCTCAACTTGGAGGG + Intergenic
1159012934 18:63075294-63075316 GGCCCCCGTGTCTGATTGGCAGG + Intergenic
1160563213 18:79771776-79771798 CGCTCCAGCCTCTGCCAGGCCGG - Intergenic
1160860571 19:1235750-1235772 GGCCCCCACCTCGGCTGGGCAGG - Intronic
1161270095 19:3385029-3385051 CCCTCCCGCCTCTGCTCAGCAGG + Intronic
1162973121 19:14193159-14193181 GGAACCAGCCTCAGCTTGGCAGG + Intronic
1162998164 19:14349617-14349639 GGCTCCAGACTCGGCATGGCTGG - Intergenic
1163012216 19:14433363-14433385 GGCTCCCGCCTCGCCTGGCCAGG - Intronic
1163427253 19:17246183-17246205 GGCTCCCGCCGCGGCCCGGCAGG - Intronic
1167559097 19:50214878-50214900 GGGCCCCGCCTCGGCCTGGCTGG + Intronic
1167579670 19:50334067-50334089 GACGTCCGCCTCTGCTTGTCCGG - Intronic
1167583244 19:50358746-50358768 GGCGTCCGCCTCTGCTTGTCCGG - Exonic
1167952320 19:53037442-53037464 GGCTGCGTCCTCTGCCTGGCGGG - Intergenic
925693760 2:6552394-6552416 GGCTCCCAGTTCTGCATGGCTGG + Intergenic
927956818 2:27212536-27212558 GGCTCCCCCTTCTCCTCGGCGGG + Intronic
928947151 2:36781892-36781914 GGCTCCCGCCTCTGATTTAAGGG + Intronic
932065328 2:68551884-68551906 GGATACCACCTCTACTTGGCAGG + Intronic
932231283 2:70086555-70086577 GGCTCCCGCGGCTGCTTTTCGGG - Intergenic
934054765 2:88242263-88242285 GTCTCCCCCTTCTTCTTGGCAGG + Intergenic
935064582 2:99636721-99636743 GGCTCCCGGCTGTGGCTGGCTGG - Intronic
937016167 2:118607953-118607975 GGATCCTGCCTCTGCTTTGCTGG - Intergenic
937224462 2:120360256-120360278 GGGTTCCGCCTCTGCTTAGGAGG - Intergenic
940698388 2:157009576-157009598 GGCTCCCAGTTCTGCATGGCTGG - Intergenic
945995259 2:216431057-216431079 GGCTGCCCCCTCTCCTAGGCAGG + Intronic
946334344 2:219027533-219027555 GGCTCCATCCTCTGCGTGCCAGG - Intronic
947751267 2:232533968-232533990 GGGTCCATCCTCTGCTGGGCGGG - Exonic
948795866 2:240401846-240401868 GGCTCCCGCCCCTTCTTGCGGGG - Intergenic
1169679583 20:8195925-8195947 GGCTCACAGTTCTGCTTGGCTGG + Intronic
1171432282 20:25090689-25090711 GGTTCCTGCCTCTGCTTGCTGGG + Intergenic
1173909130 20:46651262-46651284 GGATCCCGCCTGTGGTTGACCGG + Intronic
1174272816 20:49381790-49381812 GGCTCCTGCCTCTGCTCCCCGGG - Intronic
1174476965 20:50802431-50802453 GGCTCCCCCCACTCCTGGGCAGG - Intronic
1176205124 20:63883986-63884008 GGCCATCCCCTCTGCTTGGCAGG - Intronic
1176242192 20:64080209-64080231 GGCCCCCGACTCTGCTCGGCGGG + Intronic
1176302723 21:5106232-5106254 GGCTCCCGCCTCTGCCTGGTGGG - Intergenic
1176739879 21:10591685-10591707 GGCTGCAGCATCTCCTTGGCAGG + Intronic
1176985846 21:15434567-15434589 AGCTCCTGCCTGTGCTTGGAGGG + Intergenic
1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG + Intergenic
1180354312 22:11825668-11825690 TGCGGCCGCCTCGGCTTGGCTGG - Intergenic
1180383941 22:12166687-12166709 TGCGGCCGCCTCGGCTTGGCTGG + Intergenic
1180853677 22:19033746-19033768 GGCTCCTGCCTCTGCCTAGGAGG + Intergenic
1181430853 22:22880883-22880905 GGCCCCCGCCTGTGGTGGGCAGG + Intronic
1181547205 22:23608866-23608888 GGCTCCCGCCTCTGCAGTCCAGG + Intronic
1182042761 22:27251100-27251122 GGCTGACACCTCAGCTTGGCTGG - Intergenic
1183675105 22:39294808-39294830 GGCCCCCGCCTCAGCTTGCCTGG - Intergenic
1185291740 22:50030876-50030898 GGGTCCGACCTCTGCGTGGCGGG - Exonic
950043298 3:9933713-9933735 CGGTGCCGCCTCTGGTTGGCTGG + Intergenic
951581439 3:24168790-24168812 TGCTGCCTCCTCTGCTTGACTGG - Intronic
952523684 3:34187326-34187348 GGCACCAGCCTCTGCTTGATAGG - Intergenic
955514124 3:59709806-59709828 AGCTGCCGTTTCTGCTTGGCAGG - Intergenic
960560090 3:119073813-119073835 GGCTCCCGCCTCAGCCAGTCCGG + Intronic
961144715 3:124584552-124584574 GGCTCCGGCCGCTGCTGGCCAGG + Intronic
962864004 3:139431819-139431841 GGCTCCAGCCCCTGCATAGCTGG + Intergenic
967832856 3:193935695-193935717 GTGTCTCCCCTCTGCTTGGCTGG - Intergenic
968051633 3:195658478-195658500 GCCCCTCGCCTCTGCCTGGCGGG + Intergenic
968104183 3:195989855-195989877 GCCCCTCGCCTCTGCCTGGCGGG - Intergenic
968302484 3:197627445-197627467 GCCCCTCGCCTCTGCCTGGCGGG - Intergenic
968913813 4:3488512-3488534 GGCTCCAGCCTCCGCCAGGCTGG + Intronic
968958708 4:3731903-3731925 GCCTCCAGCGTCTGCTTTGCTGG + Intergenic
969508878 4:7605839-7605861 GGCTGCAGCCTCTGCTGGGGTGG - Intronic
971049686 4:22847479-22847501 AGCACCGGCCTCTGCTTGCCTGG + Intergenic
971267439 4:25107853-25107875 GGCCCCCGCCTCTGCTGTCCTGG + Intergenic
981300952 4:143185260-143185282 AGCTCCCGCCCCGGCTTGGATGG + Exonic
985633923 5:1026861-1026883 GGCTGCAGCCTAAGCTTGGCAGG + Intronic
985644684 5:1079350-1079372 GGTTCCAGCCTCTGCCTGGGGGG - Intronic
988848043 5:35149978-35150000 GGCTCACGCCTGTACTTGGGAGG - Intronic
989399263 5:40991912-40991934 GGCTCACAGCTCTGCATGGCTGG + Intergenic
990040963 5:51378544-51378566 AACTCCCTCCCCTGCTTGGCTGG + Intergenic
990990240 5:61676537-61676559 TGCACCCGCCCCTGGTTGGCAGG - Intronic
994012985 5:94929334-94929356 GTCTCCCGCATCTTCATGGCAGG - Intronic
1001542777 5:172551044-172551066 TCCTCCCGCCTCTGCCTGCCCGG + Intergenic
1001550540 5:172599113-172599135 GGGTCCCTCGTCTGCTTGGGAGG + Intergenic
1004183944 6:13406043-13406065 GCCTCCCGCCTCTGCTATTCAGG + Intronic
1006367670 6:33625020-33625042 GGCCCACGCCTGTTCTTGGCAGG + Intronic
1006518668 6:34558875-34558897 GGCTCCCCCATCTGCTCAGCTGG + Intergenic
1007285315 6:40743421-40743443 GGCTCCCTCATCAGCTTGACTGG - Intergenic
1007430866 6:41776073-41776095 GGCTCCCTCTTCTGGTGGGCAGG + Intronic
1009369713 6:62883370-62883392 GGGTACAGCCTCTGCTTGCCTGG - Intergenic
1011199757 6:84822844-84822866 CGCTCCCGACCCTGTTTGGCTGG + Intergenic
1014736369 6:125099725-125099747 GCCGCCGGCCTCTGCTTGCCAGG - Intergenic
1015273254 6:131358631-131358653 TGCACCCGCCTCTGCTGGGGTGG + Intergenic
1015732237 6:136360931-136360953 CGCACCCTCCTCTGCTGGGCTGG + Intronic
1017695974 6:157016678-157016700 GGGTCCCGCCTGTGCTCTGCAGG + Intronic
1019597058 7:1863096-1863118 GGCTCCCTCCTCTGGTTGGGGGG - Intronic
1019639678 7:2096798-2096820 GCCCCCAGCCTCTGCTGGGCGGG - Intronic
1022415267 7:30171870-30171892 AGCTCCCACCTCTGCCTGGGAGG - Intergenic
1022522617 7:31017756-31017778 GGCTCCCGCGTCTGCCATGCAGG + Intergenic
1024063224 7:45714082-45714104 GGCTCCCTGCTCTGCTGGTCTGG - Exonic
1024225935 7:47327040-47327062 TGCTCCCTCCTCTGCGTGGCTGG - Intronic
1029438769 7:100576219-100576241 AGCTCCCGCCTCTGCTCACCTGG + Exonic
1029439384 7:100578636-100578658 GGCACCCGCCTCACCTGGGCAGG + Exonic
1033228147 7:139576806-139576828 GGCTCTTGCCCCTGCTGGGCTGG - Intronic
1035496884 7:159335628-159335650 TGCTGCCGCCTCACCTTGGCTGG - Intergenic
1036501782 8:9320774-9320796 GCCTTCAGCCTCAGCTTGGCTGG + Intergenic
1036660768 8:10707016-10707038 GGCTCCCACCTCCCATTGGCTGG - Intronic
1039474841 8:37834156-37834178 GCCTCCCTCCTCTGCATGCCAGG - Intronic
1041678420 8:60561052-60561074 GGCTCCAGCCCCTGCCTGGCAGG + Intronic
1042520087 8:69702356-69702378 GGATCTTGACTCTGCTTGGCTGG - Intronic
1048344284 8:133565365-133565387 GGCCCCCTCCTCAACTTGGCAGG - Intronic
1049294849 8:141827026-141827048 CGTTCCCACCTCTGGTTGGCTGG + Intergenic
1049319335 8:141987620-141987642 GGCTCCAGCCTCTGCTGTTCCGG - Intergenic
1049509220 8:143019189-143019211 GGCTCCCGCCCCTTGCTGGCTGG + Intronic
1050212092 9:3271811-3271833 TGCCCCAGCCTCTGTTTGGCTGG - Intronic
1050575590 9:6991791-6991813 TGCTCCCACCTCTGCTTCCCAGG - Intronic
1059441320 9:114308653-114308675 GCCTCACCCCTCTGCTAGGCAGG - Intronic
1060793142 9:126498941-126498963 GGCCCCCACCTGTGGTTGGCAGG - Intronic
1062342803 9:136101215-136101237 AGCTCCCGCCTCTGCCTGCTGGG + Intergenic
1062385731 9:136310812-136310834 GGCTGTGGCCTCTCCTTGGCGGG - Intergenic
1062569996 9:137180606-137180628 GGCTCCCTGCTCTGCCTGGGGGG - Intronic
1202800250 9_KI270719v1_random:169505-169527 TGCGGCCGCCTCGGCTTGGCCGG + Intergenic
1203697561 Un_GL000214v1:112985-113007 TGCGGCCGCCTCGGCTTGGCTGG + Intergenic
1186276929 X:7949248-7949270 GACTCACGGCTCTGCATGGCTGG - Intergenic
1186660687 X:11665181-11665203 GTCTCCCGCCTCAGCTAGGAAGG - Exonic
1189987000 X:46562323-46562345 GGGTCCAGCTTCTGCTTTGCAGG + Intergenic
1193472674 X:81926010-81926032 GCCTCCCCCCACTGCTTCGCTGG + Intergenic