ID: 1092160552

View in Genome Browser
Species Human (GRCh38)
Location 12:6313156-6313178
Sequence GCTGCACGCCCCTGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092160547_1092160552 -3 Left 1092160547 12:6313136-6313158 CCCAGCTGGATGGGATGCAGGCT 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1092160552 12:6313156-6313178 GCTGCACGCCCCTGGGGAGAAGG 0: 1
1: 0
2: 2
3: 22
4: 222
1092160548_1092160552 -4 Left 1092160548 12:6313137-6313159 CCAGCTGGATGGGATGCAGGCTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1092160552 12:6313156-6313178 GCTGCACGCCCCTGGGGAGAAGG 0: 1
1: 0
2: 2
3: 22
4: 222
1092160545_1092160552 2 Left 1092160545 12:6313131-6313153 CCACTCCCAGCTGGATGGGATGC 0: 1
1: 1
2: 2
3: 19
4: 237
Right 1092160552 12:6313156-6313178 GCTGCACGCCCCTGGGGAGAAGG 0: 1
1: 0
2: 2
3: 22
4: 222
1092160541_1092160552 22 Left 1092160541 12:6313111-6313133 CCTTTCACACAGAAGGGCAGCCA 0: 1
1: 0
2: 4
3: 14
4: 221
Right 1092160552 12:6313156-6313178 GCTGCACGCCCCTGGGGAGAAGG 0: 1
1: 0
2: 2
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092160552 Original CRISPR GCTGCACGCCCCTGGGGAGA AGG Intronic
900102258 1:966892-966914 TCTGAACGCCCCGGGGGCGAGGG - Intronic
900111102 1:1005974-1005996 GCTGCACACCTTTGGGGAGCAGG - Intergenic
901054016 1:6440392-6440414 GCTGCACGCCGCGGCGCAGATGG + Exonic
901061304 1:6473218-6473240 GCTGCCTGACCCTGGGCAGATGG + Intronic
901066922 1:6498615-6498637 TCTGCATGACCCTGGGGAGGGGG + Intronic
901221543 1:7586563-7586585 GCTGCAGGCCCATGGGGACGGGG - Intronic
901762431 1:11479608-11479630 GCTGCAGTCCCGCGGGGAGATGG - Intronic
902636953 1:17740895-17740917 GGTGCACAAGCCTGGGGAGAGGG - Intergenic
903681944 1:25103174-25103196 GCTGCCTGCCCTTGGGGAGTGGG - Intergenic
903963260 1:27070568-27070590 GCTCCTGGGCCCTGGGGAGATGG + Intergenic
906088549 1:43157315-43157337 GCTGCACGTCCCTGAGGAAAGGG + Intergenic
911146042 1:94553411-94553433 GCTGCAAGCCCCTGTGGGGGTGG + Intergenic
912511830 1:110195024-110195046 TCAGCAGGCCCTTGGGGAGAGGG - Intronic
912523965 1:110266970-110266992 GCTGCAGGCCTCTTGGCAGATGG - Intronic
912710839 1:111948681-111948703 GCTGCTCCCCTCTGGGGAGCTGG + Intronic
913318863 1:117575063-117575085 GATGCAAGCCCCTGGGCAGATGG - Intergenic
920129807 1:203723492-203723514 GCTGCACTCCCCCTGGGGGAGGG - Intronic
921674861 1:217965942-217965964 GCTGCACCCCTCTTGGGAGAGGG + Intergenic
923355398 1:233150062-233150084 GCTGCAGCCCTCTGGAGAGATGG - Intronic
923641592 1:235767163-235767185 GCTGCTACCCACTGGGGAGATGG - Intronic
1064436100 10:15312538-15312560 GCTGCACAGCCCTGGGGGTATGG - Intronic
1067427282 10:46219863-46219885 GCAGGAAGACCCTGGGGAGAGGG + Intergenic
1069415544 10:68197418-68197440 CCTGCAGGCTCCTGGGGATATGG + Exonic
1069660111 10:70117821-70117843 GCTGCACGCCCTTCCGGAGGAGG + Exonic
1071492400 10:86144669-86144691 CCTGCAAGCCCAGGGGGAGAGGG - Intronic
1072553390 10:96495814-96495836 GCTGCTCCTGCCTGGGGAGATGG + Intronic
1072710671 10:97713901-97713923 GCCGCACGCGCCTGGGGCGGCGG - Exonic
1076326436 10:129626981-129627003 GCTGCCCGCCTCTGAGGGGACGG + Intronic
1076840032 10:133041330-133041352 GCTGCCGGCCCTTGGGGAGTTGG - Intergenic
1077282940 11:1753762-1753784 GCCGCACGCCCCAGGTGAGCGGG - Intronic
1078263672 11:9736494-9736516 ACAGCAGGCCTCTGGGGAGAGGG - Intronic
1079284561 11:19117231-19117253 GCTGTGGGCTCCTGGGGAGATGG + Exonic
1080474041 11:32573231-32573253 GCTTCATTCCCCTGGGGAGAGGG + Intergenic
1084157509 11:67322366-67322388 GGAGGATGCCCCTGGGGAGAGGG + Intronic
1087076145 11:94128826-94128848 GCTCCACGCCCCTGGGTACTTGG + Intergenic
1089673269 11:120071915-120071937 GCTGCAAGCCCCGGGGGAGGGGG + Intergenic
1091228304 11:133971465-133971487 GCTGCAGGCCTGTGGGCAGATGG - Intergenic
1092160552 12:6313156-6313178 GCTGCACGCCCCTGGGGAGAAGG + Intronic
1092198331 12:6563620-6563642 GCTGCCCCCTGCTGGGGAGATGG - Exonic
1094509527 12:31088031-31088053 GCTGTGCACCCCTGGGGAGGAGG + Intronic
1094536564 12:31326436-31326458 GCTGCAGGCCGCGGCGGAGAGGG + Intronic
1096700624 12:53380493-53380515 GCCGCCCGCCCCGGGGGAGGGGG + Intronic
1100113047 12:91269069-91269091 GCTGCTTGCCCCTGGAGAGCAGG - Intergenic
1100565278 12:95789649-95789671 GCTGGCCGCCCCTGGGGAATTGG - Intronic
1101873618 12:108584179-108584201 CCTGGACGCCCCTGGGGAGAGGG + Intergenic
1102208284 12:111105557-111105579 ACTGCACACCCCCAGGGAGATGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103749320 12:123148909-123148931 GTTGAAGGCACCTGGGGAGAGGG + Intronic
1104727209 12:131085400-131085422 GCTCCAAGGCCCTGGGGAGGCGG + Intronic
1105673056 13:22642183-22642205 GCTGCATGTCCCTGGGCAGGGGG - Intergenic
1106619556 13:31360426-31360448 GGTGCACGTCCCTTGGGGGAGGG - Intergenic
1108435940 13:50401616-50401638 CCTCCACGCCCCAGGGGAAAAGG + Intronic
1112924313 13:104655267-104655289 GCTGCACGCCCCAGGTGCCAAGG + Intergenic
1113404375 13:110024268-110024290 ACTGCACGGCCCTGGAGAGCTGG + Intergenic
1114193872 14:20460815-20460837 GCTGGATGCCCCTCGGGAAACGG + Exonic
1114620780 14:24094823-24094845 GCAGCAGGGCCCTGGGGACAAGG + Intronic
1115180709 14:30622451-30622473 GCTGCACGCACCAGAGGAGAAGG - Intronic
1118175764 14:63438544-63438566 GCTGCCAGCCACTGGGGGGAGGG + Intronic
1118722537 14:68604546-68604568 GCTGCACACCCATGAGGACATGG - Intronic
1119189380 14:72670014-72670036 GCTCAAGGCCCCTGGGGCGATGG - Exonic
1122185421 14:99989303-99989325 GTATCACGGCCCTGGGGAGATGG - Intronic
1122197768 14:100102292-100102314 GATGCACGCACCTGGGGAGAGGG - Intronic
1122799911 14:104224377-104224399 GCTCCAGGGCCCTGGGGAGGGGG + Intergenic
1122884240 14:104703516-104703538 GCTGCATCCACCTGGGGAGGTGG + Intronic
1122884683 14:104705776-104705798 CCCGCACGCCCCTGGGGAAGGGG - Intronic
1123538548 15:21262521-21262543 CCTGCACGCCTCTGGGGGCAAGG - Intergenic
1124973477 15:34513478-34513500 GCAGCCAGCCCCTGGGGAGAGGG + Intergenic
1125511706 15:40295670-40295692 GCTGAACACGTCTGGGGAGAGGG + Intronic
1125728328 15:41879489-41879511 GCTGCCCCCACCTGGGCAGAGGG + Exonic
1127119444 15:55758502-55758524 CTTTCAGGCCCCTGGGGAGAAGG - Intergenic
1128745593 15:70111867-70111889 GCTGCACTCTCCAGAGGAGAGGG - Intergenic
1129450888 15:75650617-75650639 TCTGCTGGGCCCTGGGGAGATGG + Intronic
1129616390 15:77101677-77101699 GCTGAAGGACCCTGGGGAGGAGG + Exonic
1129873961 15:78960233-78960255 GCTGCAGGTCCCAGGGGAGGCGG + Exonic
1130561569 15:84963323-84963345 GATGCCCACTCCTGGGGAGAGGG - Intergenic
1131157718 15:90085164-90085186 GCTGCCCGCCCCTGGGCTGGTGG + Intronic
1132525029 16:410197-410219 GCTGCTGGAGCCTGGGGAGAGGG - Intronic
1132652749 16:1028974-1028996 GCTGCACGGCGCTGGGCTGAGGG - Intergenic
1132652823 16:1029219-1029241 GCTGCAGGCCCCAGAGGGGACGG - Intergenic
1132889504 16:2196803-2196825 GCTGCGCGCACGTGGGGAGGGGG - Intergenic
1136383138 16:29906314-29906336 GGTGCTGGCTCCTGGGGAGAGGG - Exonic
1136568400 16:31083051-31083073 TCTGCAGGCCACTGGGGTGAAGG - Exonic
1137027512 16:35492560-35492582 GCCGGACACCCCTGGGGAGCAGG + Intergenic
1137523871 16:49216726-49216748 CCTACACGCCCCTGTGGAGAGGG + Intergenic
1137545007 16:49396685-49396707 GCTGCCACCCCCTGGGCAGATGG + Intronic
1139290984 16:65857637-65857659 GTTGTAGGCCCCTTGGGAGATGG - Intergenic
1139367374 16:66441776-66441798 GCTGCAGGCCCTGGGGGAGCAGG + Intronic
1139570099 16:67806437-67806459 GCTGCCGTCCCCTGGGGAGCAGG - Exonic
1141732132 16:85829860-85829882 GCTGCACCCGCCTGGGAAAAGGG + Intergenic
1141958937 16:87392008-87392030 GCTGCCCGGCCCTGAGGAGATGG - Exonic
1142741933 17:1936570-1936592 GCTGCACCCCGCTGGGGGCACGG + Exonic
1142967354 17:3589965-3589987 GCTGCACGCCCTGGTGGAGGTGG - Exonic
1143731859 17:8886089-8886111 GAGGTAGGCCCCTGGGGAGACGG - Intronic
1144677955 17:17173904-17173926 GCAGCTCCTCCCTGGGGAGAGGG - Exonic
1144778183 17:17795333-17795355 GGAGGACCCCCCTGGGGAGAAGG + Exonic
1147166656 17:38596958-38596980 GCTGCATGCCCCAGGGTAAAAGG - Intronic
1147967438 17:44200477-44200499 GCTGCACGCCTCGGGGTAAAGGG - Intergenic
1148950331 17:51305348-51305370 GCTGCAGGCTGGTGGGGAGAGGG + Intergenic
1149650981 17:58276338-58276360 GCAGCCTGCCCCAGGGGAGAGGG + Intronic
1152556955 17:81058157-81058179 GCTGCACGCCTCAGGGGACGGGG - Intronic
1152588887 17:81201418-81201440 GCCGCTTGCCCCTGGGGAGCTGG - Intronic
1152786661 17:82251614-82251636 GCTGCACACTCAAGGGGAGAAGG + Intronic
1153163112 18:2230750-2230772 TCTGAACTCCCCTGGGGAAAGGG + Intergenic
1155508062 18:26550080-26550102 GCTGCGAGTCCCTGGGGTGAGGG + Intronic
1156405551 18:36779335-36779357 TCTGGAAGTCCCTGGGGAGAAGG + Intronic
1157716534 18:49891693-49891715 GCTCCACACCTTTGGGGAGAAGG + Intronic
1159947959 18:74457697-74457719 GCTGCAGCCCCCTGGGGCGAGGG - Intronic
1160256498 18:77251774-77251796 ACTGCGCACCCCGGGGGAGAGGG - Intronic
1160722267 19:602937-602959 CCTGCAGGCGCCTGGGGGGAAGG + Intronic
1160722296 19:603016-603038 CCTGCAGGCGCCTGGGGGGAAGG + Intronic
1160762281 19:791718-791740 GCTGAACTCCCCCGGGGGGAGGG + Intergenic
1160762314 19:791804-791826 GCTGAACTCCCCTGGGGGTAGGG + Intergenic
1160836002 19:1124695-1124717 GCGGCCCCACCCTGGGGAGAAGG + Intronic
1161272624 19:3398438-3398460 GCTGCACAACCCTGAGCAGAGGG - Intronic
1162379070 19:10321303-10321325 GCTGGAGGGCCCTGGGGAGAGGG - Intronic
1163061375 19:14764562-14764584 GCTGGAGGCCCCTGGGGACCTGG - Exonic
1163458750 19:17424054-17424076 GCTGCAGCCCCCTGGTGAGTCGG + Exonic
1163687102 19:18717858-18717880 GCAGAGGGCCCCTGGGGAGAAGG + Intronic
1163861336 19:19744509-19744531 GCTGGAGAGCCCTGGGGAGATGG + Intergenic
1166159859 19:40944449-40944471 GGGGCACACCCATGGGGAGAAGG - Intergenic
1166168810 19:41012416-41012438 GGGGCACACCCATGGGGAGAAGG - Exonic
1167124813 19:47542211-47542233 GCTGCCAGGCCCTGGGGGGAGGG + Intronic
1168253509 19:55154794-55154816 GCTCCACGCCCGTGTGGACAAGG - Exonic
927191976 2:20523311-20523333 GCTGAAGGCACCTGGGGATAGGG - Intergenic
927888469 2:26732923-26732945 GCTGATCACCCCTAGGGAGATGG - Exonic
927936790 2:27080652-27080674 GCTGCCCACCCCTGAGGACAGGG + Intronic
927937353 2:27083290-27083312 GCTGCAGGCCCATGGGGATGAGG + Exonic
928128211 2:28630476-28630498 GCTGCAGGCCCCTGGGGTAGTGG + Intronic
932334517 2:70922501-70922523 GCAGCCCACCCCTGGGGAGGGGG + Intronic
932760468 2:74436250-74436272 GCTGCACTGGCCTGGGGAGCCGG + Intronic
933713487 2:85344211-85344233 GCTGCACGTCCCGGGTGAGGGGG - Intronic
936165112 2:110114359-110114381 CCTGCAAGCCCCTGGTGACAGGG - Intronic
937249111 2:120512152-120512174 GCTGTGCTCCCCAGGGGAGAGGG - Intergenic
938081311 2:128371536-128371558 GCTGTACGCCCATGGGAGGAGGG + Intergenic
938299697 2:130201252-130201274 GATTCACCCTCCTGGGGAGAAGG - Intergenic
938457011 2:131473234-131473256 GATTCACCCTCCTGGGGAGAAGG + Intronic
938855710 2:135308266-135308288 GCTGCCTACCCCTGGGGAGTGGG - Intronic
940985903 2:160052083-160052105 GGTCCACGGCCCTGTGGAGATGG - Intronic
940988483 2:160073983-160074005 GCTGCAGGCACCTAGAGAGAGGG + Intergenic
946025646 2:216670363-216670385 GCAGCATACCACTGGGGAGAGGG + Intergenic
947219276 2:227777652-227777674 GCTGCACGGCCCAGGGAGGAAGG + Intergenic
949035835 2:241815400-241815422 GCAGGACGGTCCTGGGGAGAGGG - Intronic
1171391350 20:24803476-24803498 GCCGCACGCCCCTGTGTCGAAGG - Intergenic
1173188907 20:40861582-40861604 GCTGCACGTCCCTGGGGTGGGGG - Intergenic
1173465751 20:43279955-43279977 GCTGCATGCCCATGAGGAAAAGG + Intergenic
1174331434 20:49822171-49822193 GCTGCACCCAGCTGGGGAGCAGG + Intronic
1175267277 20:57710220-57710242 GCTGACCGCCGTTGGGGAGAGGG - Intronic
1175336433 20:58199225-58199247 GCTGCAGGCCCCTTGGGGCAGGG - Intergenic
1175785489 20:61709160-61709182 CTTGCACTCCCCTGGAGAGAGGG - Intronic
1176299335 21:5091147-5091169 GCTGCACGCCTAAGGGCAGAGGG - Intergenic
1177766444 21:25462845-25462867 GGTGCACGTGCCTGGAGAGAAGG - Intergenic
1178887092 21:36493124-36493146 TCTGCCCGCCCCCGGGGAGGAGG + Intronic
1179061629 21:37984671-37984693 GCTGCACCCCCCTGTAAAGAGGG + Intronic
1179721752 21:43320319-43320341 GCTGCAGGCCCCTGTGGGCAGGG - Intergenic
1179857691 21:44170800-44170822 GCTGCACGCCTAAGGGCAGAGGG + Intergenic
1180609482 22:17085906-17085928 GCTTCGCGCCTCTGGGGAGGTGG - Intronic
1181862386 22:25829044-25829066 GCTGCAGGCTCCTGGGGAATGGG - Intronic
1182303477 22:29351962-29351984 GCTGCAAGCTCCTGGGTAGAGGG + Intronic
1183424776 22:37733555-37733577 GCTGCTGGCCGTTGGGGAGAGGG - Intronic
1184280784 22:43436330-43436352 GCGGGACGCCCCTGGGGAGGCGG - Intronic
1184569650 22:45314113-45314135 GCTGCAGGCTCCTTGGGGGAAGG - Intronic
1185097588 22:48819950-48819972 GCTGCAGGCCCCTGGAAACACGG - Intronic
1185275607 22:49949140-49949162 GCTGCACCCGCCTGTGGACAAGG + Intergenic
1185397826 22:50601484-50601506 GCTCCAGGCCCCTGGGGTCAGGG - Intronic
950530149 3:13548656-13548678 GCTGCATGTGCCTGGGCAGACGG - Intergenic
954581585 3:51706170-51706192 GAAGGACGCCCCTGGGTAGAGGG - Intergenic
954638517 3:52084686-52084708 GCAGGAGGCCCCTGGGAAGAGGG - Intronic
955137971 3:56238608-56238630 GCTGCAGGGCCCAGGAGAGAAGG + Intronic
956826017 3:72997206-72997228 GCTCCCCGCCCCTGGGGAGGTGG - Intronic
961103813 3:124223923-124223945 GCTGGAGGATCCTGGGGAGATGG + Intronic
961508944 3:127389702-127389724 TGTGCAAGCCCCTCGGGAGAGGG + Intergenic
961796225 3:129411052-129411074 GCTGCAGAACCCTGGGGAGGGGG - Intronic
967900171 3:194441817-194441839 GCTACACGCCCTTGGGAAAAGGG + Intronic
968129013 3:196181387-196181409 GCTGAAGGCCGCTGAGGAGATGG - Intergenic
968518116 4:1023361-1023383 TCTGCAGGCCCCGGGGGAGGAGG - Intronic
968519516 4:1029255-1029277 GCAGCCCCTCCCTGGGGAGACGG - Intergenic
968982317 4:3856933-3856955 GCTGCACCTCCCAGAGGAGACGG - Intergenic
969239112 4:5887978-5888000 GCGGCAAGCCCGCGGGGAGAGGG + Intronic
969610862 4:8227209-8227231 CCTGAACGCCCCTGGGTACAAGG + Exonic
969704126 4:8782855-8782877 GCTCCCAGCCCCTGGTGAGAGGG + Intergenic
970419359 4:15890899-15890921 GCTGCATCCACCAGGGGAGAGGG + Intergenic
970439893 4:16071607-16071629 GGTGCAGGCTCCTGGAGAGAGGG - Intronic
972471354 4:39407708-39407730 TATGCATGCCCCTGGAGAGAAGG + Exonic
973716613 4:53683087-53683109 GGTGCAGGTACCTGGGGAGAGGG - Intronic
973770025 4:54197827-54197849 CTTTCAGGCCCCTGGGGAGAAGG - Intronic
974027526 4:56746761-56746783 GGTGCCAGCCCCTAGGGAGAGGG - Intergenic
974553763 4:63415954-63415976 GTTGCCAGCACCTGGGGAGAGGG - Intergenic
975622090 4:76306313-76306335 GCTGAGCTTCCCTGGGGAGAAGG + Intronic
975710842 4:77158177-77158199 ACTGCAGTCCCCTGGGCAGAAGG + Intronic
980541655 4:134203019-134203041 TCTGCACACACCTGGGGAAAAGG + Intergenic
984898130 4:184560248-184560270 GCTGCATGACTCTGGGTAGATGG + Intergenic
985833692 5:2255019-2255041 GCTGGAGCCCCCTGGGGTGACGG + Intergenic
986337440 5:6766159-6766181 GATGGACTCCCCTGGGGAGCAGG - Intergenic
987083370 5:14446263-14446285 GCTGCCAGTGCCTGGGGAGAAGG - Intronic
987221328 5:15793043-15793065 GCTGCATGCCTCTGGGGACAGGG + Intronic
988681735 5:33490167-33490189 TCTGCACCCCACTGGGGAGTTGG - Intergenic
990169822 5:53035645-53035667 GCTGCCCGTCTCTGGGAAGAAGG - Intronic
990649232 5:57879264-57879286 GCTAAACTCCCTTGGGGAGAAGG + Intergenic
991071731 5:62490583-62490605 ACTGCAAGTCTCTGGGGAGACGG + Intronic
992248379 5:74852403-74852425 GCAGCAGGCCCATGGGAAGAAGG + Intronic
992639426 5:78756082-78756104 TCTGCACCTCCCTGGGGAGCTGG - Intronic
995066852 5:107872274-107872296 GCTGCAAGCCCCTGGGGATCAGG - Intronic
998143207 5:139711229-139711251 GCTGCGCGCGCCTGGAGAGATGG - Intergenic
999280089 5:150359393-150359415 GCCAGATGCCCCTGGGGAGATGG + Intronic
1001328458 5:170745912-170745934 GCTGCACGCCCTTAGGCAGGTGG + Intergenic
1001598392 5:172913229-172913251 GCCGCACGGCACTGGGAAGAGGG + Intronic
1002057928 5:176609618-176609640 GCTTCCCGCCACTGGGGGGAGGG - Intronic
1002183069 5:177441447-177441469 TCTGCCAGCCCCAGGGGAGAGGG + Intronic
1004216748 6:13711177-13711199 GCTGCAAGGCCCGGGGGAGCGGG + Exonic
1004566653 6:16804183-16804205 GCTGCTACCCCCTGAGGAGAAGG + Intergenic
1007448759 6:41927207-41927229 ATTGCAAGCCCCTGGGGACAGGG + Intronic
1011599848 6:89049804-89049826 TCTGCAAGCACCTGGGGATAAGG - Intergenic
1011617378 6:89209579-89209601 GCTCCACTCCCCAGGCGAGAGGG - Intronic
1011682165 6:89793761-89793783 GCTGCCAGCCCCTGGAGAGCTGG - Exonic
1012909388 6:105102165-105102187 GCTGAACTCAGCTGGGGAGAAGG + Intronic
1019167680 6:170109432-170109454 TCTGACCGCCCCTGGGGAGATGG + Intergenic
1023189011 7:37559298-37559320 GCTGCAGGAGCCTGGGGAGATGG - Intergenic
1024042718 7:45567686-45567708 TCTGCTGGCCCCAGGGGAGAAGG + Intergenic
1024189833 7:46994688-46994710 GCTGCATGGCCCTGGGTATAGGG - Intergenic
1024953336 7:54888667-54888689 CGAGCACGGCCCTGGGGAGAGGG - Intergenic
1029116658 7:98241166-98241188 GCTGGACACCCCCGGGGAGGTGG - Exonic
1031253723 7:119421016-119421038 GCTGCATGCATCTGGGGAGAGGG - Intergenic
1031402792 7:121345591-121345613 GCTGCACTCCCCAGGTAAGAAGG + Intergenic
1032090062 7:128907116-128907138 GGTGCAGGCATCTGGGGAGAAGG + Exonic
1032128690 7:129212230-129212252 GCTGCAGGTGCCTGGGGAGCTGG + Exonic
1033785657 7:144727154-144727176 TCTGAACTCCCCTGGGGAAAGGG - Intronic
1035127089 7:156616579-156616601 GCTGCAGGCCTCTGCGGTGACGG + Intergenic
1035260567 7:157659219-157659241 GCTGCAGGCTCCTGGAGAGTGGG - Intronic
1037902161 8:22694658-22694680 GCTGCGCGCGCCTCGGGAGCAGG - Intergenic
1038497523 8:28014416-28014438 GCTGCACCACCCCGTGGAGATGG + Intergenic
1039991224 8:42489552-42489574 GCTGCAGGCCTCTGGGAAGTGGG - Intronic
1047275565 8:123402401-123402423 GCTGCCTGCCCCTGGGGTGGGGG - Intronic
1048972598 8:139653617-139653639 GCTCCAGGCCCTTGGGGTGAGGG - Intronic
1049675643 8:143887703-143887725 GCTCCAAGCCCCTGGGAGGAAGG + Intergenic
1051419018 9:16871616-16871638 TCCGCGCGCCGCTGGGGAGAAGG + Intergenic
1053145204 9:35707243-35707265 GCAGCCCGACCCTGGGGAGAGGG + Exonic
1054350396 9:64014287-64014309 GCAGAAGGCCCCTGAGGAGAAGG - Intergenic
1057314198 9:93958487-93958509 ACTGCACCCCACTGGGGAGGAGG - Intergenic
1060401960 9:123354625-123354647 GCTTCTCCCACCTGGGGAGAGGG + Intergenic
1060794622 9:126505347-126505369 GCTGCAGGCCCCTGTCGAGCTGG + Exonic
1062170967 9:135134391-135134413 GCGCCTCGCCCCTGGGGAGCAGG + Intergenic
1062589727 9:137268096-137268118 GCTGCAGGTCCCCTGGGAGATGG + Intronic
1062645477 9:137545935-137545957 TCTGAACTCCCCTGGGGAAAGGG - Intronic
1203770482 EBV:47615-47637 GTTGCAGGCCCTTGGGGAGCGGG + Intergenic
1203774085 EBV:63132-63154 GCTGCTGGCCCCGGGGGAGGTGG + Intergenic
1186471496 X:9825611-9825633 TCTGCACGGCCCTTGGGAAATGG + Intronic
1202111068 Y:21421413-21421435 ATTGCACGCCCCGCGGGAGAGGG - Intergenic