ID: 1092161931

View in Genome Browser
Species Human (GRCh38)
Location 12:6319944-6319966
Sequence GCTGATGTCTGAGCACCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092161931 Original CRISPR GCTGATGTCTGAGCACCATT TGG Intronic
903310020 1:22447841-22447863 GCTGAAGACTGAGCTTCATTTGG + Intergenic
910293154 1:85617988-85618010 GCTGTTGTCTGTACACAATTAGG + Intergenic
910504516 1:87934654-87934676 GCTGATGTCTGATTTTCATTAGG - Intergenic
911723253 1:101213991-101214013 GCAGATGTTACAGCACCATTTGG - Intergenic
913660433 1:121002110-121002132 GCTGCTGCCTGGCCACCATTGGG - Intergenic
914011797 1:143785267-143785289 GCTGCTGCCTGGCCACCATTGGG - Intergenic
914166036 1:145175867-145175889 GCTGCTGCCTGGCCACCATTGGG + Intergenic
914650425 1:149693926-149693948 GCTGCTGCCTGGCCACCATTGGG - Intergenic
914792518 1:150890938-150890960 GGTGATGGCTGAGCTCTATTTGG - Intergenic
915633459 1:157170253-157170275 GCAGATGTCTGAGGCCCATAAGG + Intergenic
919493581 1:198236455-198236477 GATGATTGCTGAGCAGCATTAGG - Intronic
920502800 1:206496134-206496156 CCTGATGTCTGAGCTCCATGGGG + Exonic
921276484 1:213525756-213525778 GCTGATGTCTGAGGATGATAAGG + Intergenic
923882852 1:238122680-238122702 GCTGATGTCTCAGCTCAAGTAGG + Intergenic
1066299235 10:34082228-34082250 GCTTTTGTCTCAGCTCCATTTGG - Intergenic
1068787486 10:60991817-60991839 GTTGATGCCTGTGCATCATTTGG + Intronic
1069888826 10:71640399-71640421 ACTAATGTCTGAGAACCATCAGG - Intronic
1070689662 10:78515306-78515328 GCTGAGGTCTGAGCAGGCTTGGG - Intergenic
1070741072 10:78903662-78903684 GCAGAGGTCTGACCACCACTTGG + Intergenic
1073538576 10:104299816-104299838 GCTAATGTCAGAGCACATTTTGG + Intronic
1079017142 11:16878827-16878849 TCTGATGGCTGATGACCATTAGG - Intronic
1080419672 11:32098776-32098798 GCTGTTCTCTGAGCACAGTTGGG + Intronic
1080897985 11:36462029-36462051 GCTGCTGCCTGAGCTTCATTGGG - Intronic
1083698633 11:64459131-64459153 TCCCATGTCTGAGCACCAGTGGG - Intergenic
1085304371 11:75476837-75476859 GCTGATGTCAGAGGCCCAGTAGG - Intronic
1087141856 11:94771790-94771812 CCTGATGTGTGAGCCCCTTTAGG - Intronic
1088788079 11:113200650-113200672 GGTGATGTCTGAGACCCCTTTGG + Intronic
1089109675 11:116045425-116045447 GCTGATGTCTGATCGCCAAGTGG + Intergenic
1089588509 11:119524950-119524972 GGTGATGTTTGAGCATCACTAGG + Intergenic
1089615091 11:119690731-119690753 GCTTATGTCTGAGTAGCATCTGG + Intronic
1091668004 12:2433081-2433103 GCTGATGACTCTGCACCATATGG + Intronic
1092161931 12:6319944-6319966 GCTGATGTCTGAGCACCATTTGG + Intronic
1094755398 12:33462988-33463010 ACTGCAGTCTGAGCTCCATTGGG + Intergenic
1096525555 12:52208008-52208030 GCTCGTGTCTGAGCCCCATGGGG + Intergenic
1100322120 12:93505579-93505601 GCTGATGGCTGAGCTCAATTGGG - Exonic
1102556546 12:113730568-113730590 GATGATGTCTCAGAATCATTAGG - Intergenic
1102606728 12:114073520-114073542 GCTGATGACTGAGCACAGTAGGG + Intergenic
1103640062 12:122343576-122343598 ACTAATGTCTGAGAACCACTGGG - Intronic
1105407145 13:20142304-20142326 GCTGATGACTGAGCAGAACTGGG - Exonic
1105926264 13:25011544-25011566 GCTGAAGCCTGAGCACCACCAGG - Intergenic
1105988102 13:25589286-25589308 GCTGATTTAGGGGCACCATTGGG + Intronic
1106038722 13:26069433-26069455 GCTGAAGCCTGAGCACCACCAGG + Intergenic
1107012096 13:35679670-35679692 GCTGATGTCTGCCCACACTTGGG + Intergenic
1108845346 13:54671854-54671876 GCACATGTCTGAGCACCACCTGG - Intergenic
1110069543 13:71156672-71156694 TCAGATCTCTGAGCACTATTTGG + Intergenic
1110142900 13:72152905-72152927 GCTGATGTCTGGGCAGAAATCGG - Intergenic
1111493418 13:89016046-89016068 GCTGTTTTCTGAGCCACATTTGG + Intergenic
1113927364 13:113949181-113949203 ACTGATCTCTGAGCACCGTGGGG - Intergenic
1114128327 14:19757731-19757753 GGGGATGACTGAGCACAATTTGG + Intronic
1114716232 14:24828001-24828023 GCTGATGTCGGAACACCCTTAGG - Intronic
1115488541 14:33936578-33936600 GCTGATGTAGGGGCCCCATTTGG + Intronic
1121253769 14:92517148-92517170 AGTGATGAGTGAGCACCATTGGG + Intronic
1121756182 14:96404042-96404064 GCTGAGGTATGAGAACCACTTGG + Intronic
1124203350 15:27697159-27697181 GCTGAGCTCTGAGCACCCTGGGG - Intergenic
1127624779 15:60769666-60769688 TCTGATGTCTGATATCCATTTGG + Intronic
1131770397 15:95730370-95730392 GATGATGTCTCACCACCACTTGG - Intergenic
1133192929 16:4147603-4147625 GCTGCTGTCGGAGCAGCCTTGGG - Intergenic
1142887970 17:2924982-2925004 CCTGAGGTCAGGGCACCATTGGG - Intronic
1147544314 17:41388572-41388594 GGTGAAGTTTGAGCACCACTGGG - Intronic
1148875952 17:50687362-50687384 GCAGAGGTCTGGACACCATTGGG - Intronic
1152807970 17:82366156-82366178 GCTGATGGCTGAGCTCTAGTTGG + Intergenic
1155261735 18:24050064-24050086 GCTGGTGCCTGGACACCATTTGG + Intronic
1155265216 18:24085904-24085926 GCTGCTGTCTGGGCACCTTGGGG - Intronic
1155544938 18:26904944-26904966 CCTTATGGCTGAGGACCATTGGG + Intergenic
1155645593 18:28073639-28073661 GATGATGTATGAGAAGCATTTGG + Intronic
1156905021 18:42342129-42342151 ACTGATATCTGGGCACCATATGG - Intergenic
1157271417 18:46279262-46279284 GCTGATGACAAAGCACCAGTTGG + Intergenic
1157492004 18:48130020-48130042 GCTGATGGCAGAGCCCCAGTAGG + Intronic
1162206786 19:9062217-9062239 GCTGAGGTCGGAGGATCATTTGG - Intergenic
1166748767 19:45154690-45154712 GCTGAGGTCTGAGCTCCAGCAGG + Intronic
1167812226 19:51843764-51843786 GCTAATATGTGAGCACAATTAGG + Intergenic
1167981148 19:53276775-53276797 CCTGAGGTCTGGGCAGCATTTGG - Intergenic
927471832 2:23383525-23383547 GGTGTTGTCTGAGGACCCTTGGG + Intergenic
930781556 2:55229049-55229071 GCTGAGGTATGAGAATCATTTGG + Intronic
932198009 2:69801002-69801024 GCTGATGTCTGATCTACATAGGG + Intronic
936377459 2:111954145-111954167 CCTGAAGTCTGAGACCCATTGGG + Intronic
937048021 2:118862966-118862988 GCTGATGTCTGAGAACTTTTAGG + Intergenic
938370925 2:130767970-130767992 CCAGATGTCAGAGCACCCTTGGG + Exonic
940595958 2:155793374-155793396 GCTGATCTTTGAACAGCATTAGG - Intergenic
941039676 2:160607017-160607039 GCTTATGTCTGCCCAACATTGGG - Intergenic
1170403491 20:16012085-16012107 GCTGGCGTCTCAGCATCATTAGG - Intronic
1170585456 20:17730807-17730829 CCTGATGTCTGAGCCCCACAAGG + Intronic
1171310304 20:24140076-24140098 GCTCATTTCTGGGCACCTTTAGG + Intergenic
1171326008 20:24293468-24293490 GCTGAGATCTGAGCAGCTTTGGG + Intergenic
1177822042 21:26041641-26041663 GCTGCTGTCTGAGCTACATCTGG - Intronic
1177824979 21:26072850-26072872 GCTTATTGCTGAGTACCATTTGG - Intronic
1178762237 21:35414166-35414188 GCTGATGTTTGAGAACCCTCAGG + Intronic
1178815708 21:35927526-35927548 GCTGATTCCTGAGCAGCAATGGG - Intronic
1183476036 22:38036302-38036324 GCTGATGTCACGGCACCATGAGG + Intronic
1183948776 22:41341117-41341139 GCTGGTTTCTGAGCACCGCTAGG - Exonic
949578501 3:5362480-5362502 GCAGATGCCTGAGCACTATATGG - Intergenic
950333949 3:12178959-12178981 GCTGATGTGGGAGCACCAAAAGG - Intronic
952445584 3:33377821-33377843 GCTGATGTCTGCGAGCCACTGGG + Intronic
961309705 3:125988185-125988207 CCTGCTATCTCAGCACCATTTGG - Intergenic
962738355 3:138345480-138345502 GCTGATGACTGAGCCACATCTGG - Intergenic
963525825 3:146412424-146412446 TCTGAAGACTAAGCACCATTTGG + Intronic
964188398 3:153974870-153974892 TGTGACTTCTGAGCACCATTTGG - Intergenic
971980763 4:33747189-33747211 GCCAATGACTGAGCACCATAGGG - Intergenic
972296691 4:37745931-37745953 CCTGATGTTGAAGCACCATTAGG - Intergenic
973774352 4:54231138-54231160 CCTGAGGTCTTAGCACAATTCGG - Intronic
978831605 4:113092511-113092533 ACTAATGTCTGAGAAGCATTGGG + Intronic
981137772 4:141231980-141232002 GATAATGCCTGAACACCATTTGG - Intronic
985344186 4:188985564-188985586 ACTGAGGTCAGGGCACCATTAGG + Intergenic
987433345 5:17863404-17863426 GCTGAGGTCAGAAGACCATTGGG - Intergenic
988108537 5:26782597-26782619 TCTCATGTTTGAGCCCCATTTGG + Intergenic
988734968 5:34011281-34011303 GCTGAGGTCTGAGGATCACTTGG + Intronic
990415784 5:55585241-55585263 GCTGAAGTCTGAACACCAGTGGG - Intergenic
995657645 5:114444733-114444755 ACTGATGAGAGAGCACCATTTGG + Intronic
997715083 5:136036592-136036614 GCTACTGTCTGACCACCATACGG + Intronic
997786211 5:136716247-136716269 GCTGCTGCCTCAGCACCACTAGG - Intergenic
1001604328 5:172949191-172949213 GCAGTTGTCAGAACACCATTTGG - Intronic
1003991303 6:11489108-11489130 GCTGAGTTCTGAGCAGCTTTTGG + Intergenic
1004163560 6:13235751-13235773 GCTGTTGTCTGACCACAAATAGG - Intronic
1005786757 6:29251873-29251895 ACTGGTGTCTGATCACCATGAGG - Intergenic
1009589843 6:65653444-65653466 ACTGATTTCAGAGCCCCATTAGG + Intronic
1015292194 6:131549939-131549961 GCTGATGGCATAACACCATTTGG + Intergenic
1015840578 6:137472521-137472543 AATGATGTCTAAGCACAATTTGG - Intergenic
1019402297 7:862469-862491 GTTGATGTCTGTCTACCATTTGG - Intronic
1019812515 7:3175023-3175045 CCTGTTTTCTGAGCATCATTCGG + Intergenic
1019867162 7:3722673-3722695 GCAGCTGTCTGGGCACCATGTGG - Intronic
1020792125 7:12640561-12640583 GCTGATGGCTCAGGTCCATTGGG - Intronic
1023058647 7:36309566-36309588 GCTGCTGGCTTAGCACCCTTGGG + Intergenic
1023551104 7:41370548-41370570 GCTGAATTCTGACCCCCATTAGG + Intergenic
1023595428 7:41824574-41824596 GCTGGTGTCTCAGCAACAGTAGG + Intergenic
1026073186 7:67141426-67141448 TATGTTGTTTGAGCACCATTTGG + Intronic
1026703701 7:72670796-72670818 TATGTTGTTTGAGCACCATTTGG - Intronic
1030631901 7:111905203-111905225 GATGCTTTCTGAACACCATTTGG - Intronic
1033109148 7:138559512-138559534 GCTGAAGCGTGAGCACCATCAGG - Intronic
1035070110 7:156138385-156138407 GCTCATGTCTGAGGACCACTGGG - Intergenic
1036111676 8:5909983-5910005 GCTGCTGTCTGAGAAACACTTGG - Intergenic
1036509550 8:9387708-9387730 TCTGAGGTCTGTGCACCAGTGGG + Intergenic
1036968365 8:13326670-13326692 GCTGAAGTTTGAGAACCACTGGG - Intronic
1037673859 8:21037898-21037920 GCTGATGTCTGCTCACCTGTTGG - Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1041456962 8:58071441-58071463 GCTGATCTCTGAAAACCATCAGG + Intronic
1045266319 8:100621651-100621673 GCTGCTGTGTGAGGACCACTTGG - Intronic
1046225053 8:111267507-111267529 GCTGAGGTGTGAGAACAATTTGG - Intergenic
1047028601 8:120851577-120851599 GCTGATCCCTGAACACCAGTAGG - Intergenic
1047358778 8:124148139-124148161 GCTGAAGTTTGAGAACCACTAGG - Intergenic
1047644661 8:126857451-126857473 TCTGATGTTTGAGCAGCAATGGG - Intergenic
1048443117 8:134474712-134474734 GTTCATGTCTGAGCGCTATTAGG + Intergenic
1049537282 8:143188255-143188277 GCTGATGTGACAGAACCATTGGG + Intergenic
1054151027 9:61605254-61605276 GCAGATCTTTGGGCACCATTTGG + Intergenic
1056854851 9:90117733-90117755 GATGATCTCTTAGCAACATTTGG + Intergenic
1058555366 9:106160974-106160996 CTTGATGTCTCAGCAACATTTGG - Intergenic
1059050496 9:110919389-110919411 GCTGAAGTCTGCGTACCAGTTGG - Intronic
1060590845 9:124815823-124815845 GCTAGTGTCTGAACACCTTTGGG - Intergenic
1060731248 9:126038392-126038414 GCTGAGGTGGGAGGACCATTTGG + Intergenic
1060751590 9:126173335-126173357 GCTGCTGGGTGAGGACCATTGGG + Intergenic
1061235191 9:129337968-129337990 GCTGGTGTGTGTGCACCAGTGGG + Intergenic
1061669860 9:132182618-132182640 GCTGATGCCTGAGCCCCTTGGGG - Intronic
1062501136 9:136852549-136852571 GCTGATGCCTGAGCCCCAAAGGG + Intronic
1062598740 9:137310804-137310826 TCTGATGTCAGAGCACCCTGGGG + Intronic
1190748447 X:53340902-53340924 GTTGTTGTCTGAGTAACATTTGG - Intergenic
1193526240 X:82592928-82592950 TTTGATTTCTGAGCAGCATTTGG + Intergenic
1193778446 X:85672998-85673020 GCATATGTCTGGGCACCTTTGGG + Intergenic
1198929485 X:141838411-141838433 GCTGAGGTGGGAGCACCACTGGG - Exonic