ID: 1092161982

View in Genome Browser
Species Human (GRCh38)
Location 12:6320255-6320277
Sequence GATGTGAGCAGATAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092161980_1092161982 3 Left 1092161980 12:6320229-6320251 CCAGTGAAGGAGTCGGGCAGGGG 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1092161982 12:6320255-6320277 GATGTGAGCAGATAAAAAGCAGG 0: 1
1: 0
2: 2
3: 22
4: 248
1092161974_1092161982 21 Left 1092161974 12:6320211-6320233 CCTTTGGATGACAGAGGGCCAGT 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1092161982 12:6320255-6320277 GATGTGAGCAGATAAAAAGCAGG 0: 1
1: 0
2: 2
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092161982 Original CRISPR GATGTGAGCAGATAAAAAGC AGG Intronic
901027873 1:6288537-6288559 GCTGTGAGCAGAGGAATAGCAGG + Intronic
901221167 1:7584668-7584690 CATGTAAGCAGATAAATAACTGG + Intronic
901661439 1:10800319-10800341 GATGTGAGCCGATACAACCCAGG + Intergenic
903266212 1:22159595-22159617 AATGTCAGCAGATAAACAACTGG + Intergenic
903333621 1:22610428-22610450 GATGTGAGTAGATGACTAGCAGG + Intergenic
904429060 1:30450266-30450288 GATGGGGGAAGAGAAAAAGCTGG + Intergenic
906120739 1:43388923-43388945 GATGAGAGCAGATGGAAAGCTGG - Intronic
910320992 1:85944194-85944216 GATGAGTGCAGTTATAAAGCTGG + Intronic
910476908 1:87617146-87617168 GATTTAAGCAGAGAGAAAGCAGG + Intergenic
910510020 1:87993008-87993030 CATGTGCCCAGAAAAAAAGCGGG - Intergenic
913940246 1:125096594-125096616 TATGTGAGGACATAGAAAGCAGG + Intergenic
914093081 1:144521428-144521450 GAAATGAGCAGATAGAATGCAGG - Intergenic
915651465 1:157314956-157314978 GATATGAGTAGATAAAAATTGGG + Intergenic
923259136 1:232250069-232250091 GATGTCAGCAGATCAGAGGCTGG - Intergenic
923955463 1:239013428-239013450 GAGGAGATCAGATAAGAAGCTGG + Intergenic
1063385586 10:5614314-5614336 GGCGTGAGCAGCTAAAATGCAGG - Intergenic
1064132354 10:12721426-12721448 GTTGGGAGCAGATCAAAATCTGG + Intronic
1064272511 10:13878311-13878333 GATCTGAGCTGCTTAAAAGCTGG + Intronic
1065887042 10:30087738-30087760 AATGTGGGAAGAGAAAAAGCAGG + Intronic
1068790343 10:61023394-61023416 GATATGAGCAGCTTAATAGCAGG + Intergenic
1071342316 10:84660274-84660296 GATATGCACAGATACAAAGCCGG - Intergenic
1071426840 10:85565703-85565725 GCTGAGAGCAGAGAAAGAGCTGG + Intergenic
1071511126 10:86263215-86263237 TATTTAAGCAGATAAAATGCAGG - Intronic
1071757222 10:88556581-88556603 GATGAGAGCAGAGAGGAAGCAGG - Intronic
1074307470 10:112292348-112292370 GATGTGAGCACAGTAACAGCAGG - Intronic
1075389188 10:122080145-122080167 TATGTGAGAACATCAAAAGCAGG - Intronic
1079529356 11:21431121-21431143 GATGTCAGCAGAAATAAAGCAGG - Intronic
1081227623 11:40543876-40543898 GATGTGAGAAGATAAATTCCTGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083104230 11:60342653-60342675 CATGTGTGCAGCAAAAAAGCAGG - Intronic
1084114702 11:67035298-67035320 AACGTTAGCAGTTAAAAAGCAGG - Intronic
1084427959 11:69095880-69095902 GATGACAGCAGAGAAAAGGCTGG + Intergenic
1084460572 11:69294566-69294588 GATCTGAGCAGGTAAGAAGCAGG + Exonic
1084576719 11:69993363-69993385 GATGTGAGCAATTAGAAAGGAGG + Intergenic
1086218241 11:84408961-84408983 GATGTGATCAGATTAGCAGCAGG - Intronic
1086654935 11:89342636-89342658 TATGTGAACAGAAAAATAGCAGG + Intronic
1087546967 11:99597205-99597227 GATATAAGCAAATATAAAGCTGG + Intronic
1088264694 11:107977997-107978019 GCTGCGAGCAAATATAAAGCAGG + Intergenic
1089226395 11:116926438-116926460 AATTTGAGAAGACAAAAAGCTGG + Intronic
1089915025 11:122145928-122145950 GATATTAGCAAATACAAAGCAGG + Intergenic
1090429729 11:126635668-126635690 GACGTGAGCAGATATCCAGCTGG - Intronic
1090561514 11:127937929-127937951 GATGCAACCAGAAAAAAAGCAGG - Intergenic
1091779924 12:3207397-3207419 AATGTGAGCAGAGACAAAGCTGG - Intronic
1092059695 12:5538307-5538329 GATGTGAGCAGCTGAAAGGGTGG + Intronic
1092161982 12:6320255-6320277 GATGTGAGCAGATAAAAAGCAGG + Intronic
1092532156 12:9353582-9353604 GAGGTGAGAATTTAAAAAGCTGG - Intergenic
1092886022 12:12925051-12925073 GAAGTGAGCAGATCAAGAGTTGG - Intergenic
1093486571 12:19659356-19659378 AATGTGATTAGAGAAAAAGCTGG - Intronic
1094759537 12:33514999-33515021 GAGGAGAGAAGATAAAAAGGTGG - Intergenic
1096427385 12:51515708-51515730 GAGGTGAGCACACAAAAATCTGG - Exonic
1098245181 12:68509709-68509731 GAAAGGAGCAGGTAAAAAGCGGG + Intergenic
1098383174 12:69890755-69890777 TTTGTGAGAAAATAAAAAGCTGG + Intronic
1102415561 12:112759600-112759622 GAAGTGAGCAGAAAACAAGGTGG - Intronic
1104521101 12:129476112-129476134 GGTATGAGCAGACAGAAAGCAGG - Intronic
1104679352 12:130738672-130738694 AATGTGGCCAGATAAAAATCTGG - Intergenic
1104854109 12:131894314-131894336 GAGGGGAGCAGAGAAGAAGCGGG + Intergenic
1105045619 12:133001040-133001062 GATGTGACCATATTAGAAGCTGG - Intronic
1105579226 13:21677732-21677754 GAGGTGACCACATAAAAAGCTGG + Intronic
1105863379 13:24437555-24437577 GATGTGAACAGATAACACCCAGG + Intronic
1106750045 13:32753924-32753946 AAAGTGAGCAGATGAAAAGTAGG - Intronic
1108079790 13:46723291-46723313 GATGAGAGAAGAGAAAGAGCTGG + Exonic
1110371790 13:74748609-74748631 AATAACAGCAGATAAAAAGCAGG - Intergenic
1111224977 13:85258129-85258151 GATGTGAGTAAAGCAAAAGCTGG + Intergenic
1111343356 13:86916671-86916693 GATGTGAGCACATTAAAAAAGGG + Intergenic
1114948592 14:27717451-27717473 GACGAGAGCAGATGAGAAGCAGG - Intergenic
1115080245 14:29442144-29442166 AATGTGAGCAGATATAAAGAAGG - Intergenic
1116172020 14:41415337-41415359 GATGTGTCCAGATAATAATCAGG - Intergenic
1118812267 14:69284059-69284081 GGTGTGAGCACCCAAAAAGCAGG - Intronic
1120379427 14:83755457-83755479 CATGTGAGCAGGAAAAATGCAGG - Intergenic
1122563964 14:102638248-102638270 GATGGGAGCAGATTTAAAGAGGG + Intronic
1123482417 15:20644494-20644516 TAGGTGAGCAGATAAACAGTCGG + Intergenic
1123965161 15:25448671-25448693 GATGTGAGGAGATTACAATCAGG - Intergenic
1124184616 15:27513084-27513106 GATGAGAGGAGATATCAAGCAGG + Intronic
1125108563 15:36003614-36003636 TATGTGAGCAGAGCAAGAGCAGG - Intergenic
1126801083 15:52297024-52297046 GATGTGAGAAAATAAAAACTTGG + Intergenic
1127209760 15:56761444-56761466 GTTGAGAGCAGAGAAAGAGCAGG - Intronic
1129395191 15:75240467-75240489 CATGTGCCCAGTTAAAAAGCAGG - Intergenic
1130098391 15:80873182-80873204 CATGTGCCCAGATAAAAACCAGG + Intronic
1131499768 15:92950863-92950885 GATTTTATCAGATAAAAAGTAGG - Intronic
1132786162 16:1658079-1658101 GGTGGGAGCGGAAAAAAAGCGGG - Intronic
1134054906 16:11163965-11163987 GAAGTGAGCAGCTATAAAACTGG + Intronic
1135652569 16:24218903-24218925 GATGTGGTCAGGTAAAAATCAGG + Exonic
1135668548 16:24355808-24355830 GATTTGAGCACTTCAAAAGCTGG - Intronic
1136698322 16:32107005-32107027 TATGTGAGGACATAGAAAGCAGG - Intergenic
1136769281 16:32820827-32820849 TATGTGAGGACATAGAAAGCAGG + Intergenic
1136798825 16:33050302-33050324 TATGTGAGGACATAGAAAGCAGG - Intergenic
1139119505 16:63998402-63998424 GATGTGGGCATACACAAAGCTGG + Intergenic
1140081483 16:71751573-71751595 AAGGTGAGAAGCTAAAAAGCAGG + Intronic
1140651311 16:77091353-77091375 GATGTGAGGACACATAAAGCTGG - Intergenic
1141414620 16:83860773-83860795 GATGTGAGCTTATCAAAACCTGG + Intergenic
1141535975 16:84679918-84679940 CATGTGAGCACATAGAAAGATGG + Intergenic
1203071697 16_KI270728v1_random:1082934-1082956 TATGTGAGGACATAGAAAGCAGG + Intergenic
1147391149 17:40110105-40110127 GAGTTTAGCAGATAACAAGCAGG + Intergenic
1149994123 17:61397987-61398009 GAGGTGACCAGATAATAACCAGG - Intergenic
1150551526 17:66215165-66215187 GATGAGGGAATATAAAAAGCAGG + Intronic
1150702652 17:67461160-67461182 GATGGTAGCAGAGAAGAAGCAGG - Intronic
1150739319 17:67766669-67766691 GATTTGAGCTTTTAAAAAGCTGG - Intergenic
1153987852 18:10368918-10368940 GATGTGTGCAGAGAACAAGGGGG - Intergenic
1157833080 18:50875339-50875361 GATCTGAGCAGTGAAAAGGCAGG - Intergenic
1158115537 18:53991277-53991299 GATCTGAGAACATGAAAAGCAGG + Intergenic
1159026768 18:63190265-63190287 GATGAGAGCAAATAAAAAATTGG + Intronic
1159136146 18:64338902-64338924 GATGCCAGCAGAGAAGAAGCTGG + Intergenic
1159691012 18:71487320-71487342 GACATGAACAGATGAAAAGCAGG + Intergenic
1161482721 19:4518837-4518859 GATGAGAGCAGAGAAGAAGCTGG - Intergenic
1163951025 19:20586564-20586586 AATGTGATTATATAAAAAGCTGG + Intronic
1163994605 19:21031624-21031646 GATGGTAGCAGACAAAAAGGTGG + Intronic
1164215883 19:23147153-23147175 GATGTGAGCAGATATTAATAGGG - Exonic
1164500638 19:28816819-28816841 GATGGATTCAGATAAAAAGCTGG + Intergenic
1164605659 19:29596154-29596176 CCTGGGAGGAGATAAAAAGCAGG - Intergenic
1166621192 19:44302352-44302374 GATGTGATCATTTAAAAAGCAGG + Intronic
1167528095 19:49997888-49997910 GATGTGAGCAGAAGAAATGTGGG + Intronic
1168726098 19:58582957-58582979 AATGTGAACAGAAAATAAGCAGG - Intergenic
1202672138 1_KI270709v1_random:65350-65372 TATGTGAGGACATAGAAAGCAGG - Intergenic
925222795 2:2155773-2155795 GATGTGAACATTTAAAAAGTTGG - Intronic
925474636 2:4199319-4199341 GAAATGAGGAGGTAAAAAGCAGG + Intergenic
925798942 2:7577492-7577514 GATGTGGGCAGATACAATGTGGG + Intergenic
929923908 2:46193695-46193717 GATGTGGGCAGACAAAGAGCAGG + Intergenic
930153977 2:48086618-48086640 GCTGTCAGCAAATATAAAGCAGG + Intergenic
930278028 2:49336500-49336522 GATGTAAGCAGTGAAAGAGCTGG + Intergenic
930956786 2:57212364-57212386 AATATGAGCAGAGAAAAAGTGGG - Intergenic
931145768 2:59515862-59515884 GGTCTGAGCAGACAAAATGCTGG + Intergenic
932308063 2:70717797-70717819 GATGTGTTCAGATAAAGAGAAGG + Intronic
932982870 2:76691212-76691234 GATGGGTGCAGAGGAAAAGCTGG - Intergenic
933673854 2:85035601-85035623 GATGTGATCTGATGAAAACCAGG - Intronic
933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG + Intronic
937318687 2:120948030-120948052 GGTGTGACCAGACAGAAAGCTGG - Intronic
939435676 2:142174301-142174323 AATGTGAACAGATACAAAACAGG - Intergenic
940188389 2:151011804-151011826 CATGTGAGGATATAAAAAGTTGG - Intronic
943366648 2:186972982-186973004 GATGTGAGCAGAGACAAACCCGG - Intergenic
943401342 2:187415268-187415290 CATGTGAGAAGTTCAAAAGCAGG - Intronic
943837064 2:192526791-192526813 AATGAGAGCAAAAAAAAAGCAGG + Intergenic
946458636 2:219850408-219850430 GATGTGCACAGACAAGAAGCAGG + Intergenic
947651542 2:231790539-231790561 TATGTGAGCTGAGAATAAGCTGG + Intronic
948602929 2:239117503-239117525 AATGTGAGCAGAGCAAAGGCTGG + Intronic
1169493171 20:6088604-6088626 GAGGTGAGCAGATTAAAGTCAGG - Intronic
1170706435 20:18748641-18748663 GAACTGAGCACATAAAAAGAAGG + Intronic
1171258996 20:23714593-23714615 GAGGTGAGCAGGTACAAAGTGGG + Intergenic
1171267794 20:23786664-23786686 GAGGTGAGCAGGTACAAAGTGGG + Intergenic
1173596838 20:44264063-44264085 GATATGAGGGGATAAAAGGCTGG - Intronic
1176158406 20:63635518-63635540 GAAGTGAGCACAGGAAAAGCTGG - Intergenic
1177766448 21:25462879-25462901 GATGTGAGCACACAAAGAGAAGG + Intergenic
1179155598 21:38848430-38848452 GATGTGAGCAGATAGGTTGCAGG - Intergenic
1182863755 22:33584159-33584181 AAGCTGAGCAGATAAAAAGCAGG + Intronic
1183162131 22:36121757-36121779 GCTGTTATCATATAAAAAGCAGG - Intergenic
1183501948 22:38185626-38185648 GATGTGAGCAGCACAAAGGCAGG - Intronic
1184381500 22:44147585-44147607 CATATGAGAAGGTAAAAAGCAGG + Intronic
1184386575 22:44179993-44180015 GATGTGAGGAGAGAAAATGGTGG - Intronic
949568553 3:5269133-5269155 GATGAGAACAGAAAAAAAGACGG - Intergenic
949910589 3:8903156-8903178 GAAGGGAGAAGATAAAAAGAAGG - Intronic
950708583 3:14799074-14799096 TAGGTGAGCGGATAAAAAGGGGG - Intergenic
950954582 3:17038096-17038118 AATTTGAGCAGATGAAAAGCAGG - Intronic
951262751 3:20530768-20530790 GCTGTGTGAAGAAAAAAAGCAGG + Intergenic
951552575 3:23889219-23889241 GAAGTGAGCAGATAGAAAGGAGG - Exonic
953402424 3:42636535-42636557 GTTGTGAGCAGATAACAGCCAGG + Intronic
953807569 3:46084591-46084613 GGAGTGAGCTGATAAAAAGTTGG - Intergenic
954366816 3:50150895-50150917 GCTCTGAGCCGATCAAAAGCTGG - Intergenic
955457727 3:59142547-59142569 GATGTGAGACGATAAAAAGCAGG - Intergenic
955674879 3:61437661-61437683 GATGCCAGCAGATAAAAATCTGG - Intergenic
957114458 3:76007494-76007516 ATTTTGAGTAGATAAAAAGCAGG + Intronic
959025516 3:101236094-101236116 GCTTTGAGCAGATCAAAAACAGG + Intronic
962771195 3:138611766-138611788 CATGTGACCAGAGAGAAAGCAGG - Intronic
964753041 3:160069496-160069518 GATGTGAGCAGACAAAAACCTGG - Intergenic
965720939 3:171661576-171661598 GATGTGAGAACATTAAGAGCAGG - Intronic
971447596 4:26767578-26767600 CATGTGAGCACATAACAAGATGG + Intergenic
973739557 4:53906249-53906271 GAAGTGTGCAGATGAAAAGAAGG + Intronic
975455777 4:74588157-74588179 GAGGTAAGCAGGTAAAAAGTAGG + Intergenic
975714915 4:77196374-77196396 GATTTGAGCTACTAAAAAGCTGG - Intronic
979217791 4:118186563-118186585 AATGTGATCAGAATAAAAGCAGG - Intronic
980649717 4:135696553-135696575 GATGTGAACAGGCAGAAAGCGGG + Intergenic
981253893 4:142637956-142637978 CATGTAAGCATATAAAAAGATGG - Intronic
981322288 4:143406589-143406611 GATGTGGGCAGAGGAAAATCGGG - Intronic
982293654 4:153805014-153805036 TATGTGAGGAGAAATAAAGCTGG - Intergenic
985075862 4:186213938-186213960 GATGAGAACAGAAGAAAAGCCGG - Intronic
986091931 5:4517332-4517354 GATTTTAGCAGAGAAAAATCTGG + Intergenic
986169459 5:5303831-5303853 GAAGTGAGAAGAGAAAAACCAGG - Intronic
986184179 5:5421342-5421364 GAAGTGAGCAGATCCATAGCGGG - Intronic
986234048 5:5891405-5891427 GATGTGAGCTGCTAAGAAGGTGG + Intergenic
987578037 5:19755839-19755861 GCTGTCAGCAAATACAAAGCAGG - Intronic
990786499 5:59426427-59426449 GCTGGGATCAGAAAAAAAGCAGG - Intronic
991266711 5:64728190-64728212 GAGGTGAGAAGAAAAAAATCTGG + Intronic
991924952 5:71696312-71696334 AATATGAGCAGAAAAAAAGCAGG - Intergenic
992481877 5:77159360-77159382 GCTGCCAGCAGATATAAAGCAGG + Intergenic
993121379 5:83778832-83778854 GATGTGAGCATAAACAAAGAAGG - Intergenic
993207267 5:84897547-84897569 TGTGTAATCAGATAAAAAGCAGG - Intergenic
994494805 5:100498398-100498420 GCTGATAGCAGATATAAAGCAGG - Intergenic
996490532 5:124089476-124089498 TATATAAACAGATAAAAAGCTGG + Intergenic
996772668 5:127101486-127101508 TTTTTGAGCAGAGAAAAAGCAGG - Intergenic
996790437 5:127288457-127288479 CATGAGAGCACATGAAAAGCTGG + Intergenic
996796542 5:127354115-127354137 GCTGTGGGCAGATAAGGAGCTGG + Intronic
998066005 5:139159262-139159284 GATGTGAGGAGGTAAAGAACTGG + Intronic
998605032 5:143624619-143624641 GCTGTGTGCAGAGCAAAAGCTGG - Intergenic
999664150 5:153895274-153895296 GATGTGATCAGGTAGAAGGCAGG + Intergenic
1000013378 5:157254902-157254924 AATGTGAGAAGAGAAAAACCAGG - Exonic
1001864652 5:175092976-175092998 GCAGTGAGCAGACAAATAGCAGG - Intergenic
1002012828 5:176297643-176297665 TAGGTGAGCAGACAAAAAGTTGG - Intronic
1002215013 5:177625092-177625114 TAGGTGAGCAGACAAAAAGTTGG + Intergenic
1004756017 6:18611163-18611185 GGTGTGGGCAAATAAAAAGACGG + Intergenic
1004966487 6:20857763-20857785 TATGTGAGCTAATAAAAATCTGG + Intronic
1008399288 6:51046139-51046161 GATGTGAGCAAAGGAAAAGAAGG - Intergenic
1009429240 6:63548031-63548053 GATGTGGGCAGAAAAGAAACAGG - Intronic
1009524111 6:64721367-64721389 TATCTGAGCAAATAAAAAGGAGG + Intronic
1012244943 6:96915558-96915580 GATCTTGGGAGATAAAAAGCTGG + Intergenic
1013746696 6:113354517-113354539 GATGAGAGCAGGGAAAATGCAGG - Intergenic
1013756298 6:113465598-113465620 GATGGGAGCAGAGGAAATGCTGG + Intergenic
1013856873 6:114583261-114583283 GCTGCCAGCAGATACAAAGCAGG - Intergenic
1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG + Intergenic
1014964285 6:127727824-127727846 GAGCTGAGGAGATAGAAAGCAGG - Intronic
1015597619 6:134880752-134880774 GATGTCAGCAGAGGAAATGCAGG + Intergenic
1015803930 6:137089868-137089890 GAGGGGAGCAGATGAAATGCAGG + Intergenic
1017338951 6:153297734-153297756 GATGTGTACAGAGAAAAGGCTGG - Intergenic
1019272491 7:158157-158179 GATGTGAACAGAAACAGAGCTGG - Intergenic
1020784690 7:12558384-12558406 CATGTGTGCAGTAAAAAAGCAGG - Intergenic
1020960907 7:14800421-14800443 GCTGTCAGCAAATATAAAGCAGG + Intronic
1022399036 7:30018308-30018330 AGTGTGAGTAGATAAAAAACAGG + Intronic
1023721017 7:43095169-43095191 GATGAGAGAAGACAAAAACCAGG + Intergenic
1024040866 7:45552666-45552688 GCTGTCAGCAAATATAAAGCAGG + Intergenic
1024611497 7:51068326-51068348 GATCTGAGGAGAAAGAAAGCTGG - Intronic
1026966640 7:74444269-74444291 GATGGGGGCAGATAGAAAGCAGG + Intergenic
1027361975 7:77418207-77418229 GCTGTGCCCAGATAAAAATCAGG + Intergenic
1027742595 7:82029989-82030011 TATGTTAGCAGACAAAGAGCAGG + Intronic
1028783292 7:94762518-94762540 AAAATGAGCAGATAAAAAGTTGG - Intergenic
1029575773 7:101402347-101402369 GATGGGAGGAAATTAAAAGCAGG + Intronic
1030233124 7:107228640-107228662 GATTTGAGCTGATACAAAGAAGG + Intronic
1030405319 7:109103905-109103927 GATGTGTTCAGATACAAAGGGGG - Intergenic
1031410762 7:121437941-121437963 CATTTGAGGAGATAAAAATCTGG - Intergenic
1031522544 7:122784144-122784166 GATGTGAGATGATAAATAGTGGG - Intronic
1031570575 7:123354262-123354284 GATGTGTTCAGAAAAAAAGGGGG - Intergenic
1032089064 7:128901916-128901938 GATTTGAGCAGGGAAAAAGAGGG - Intronic
1032270620 7:130401325-130401347 GATATGAACTGAAAAAAAGCAGG + Intronic
1032343325 7:131096205-131096227 GAAGTGAGCCCATAAAAAGTAGG + Intergenic
1033007771 7:137586118-137586140 CATATGAGCAGATAAAAAGTTGG + Intronic
1033800976 7:144901929-144901951 GGTTTGTGCAGATAAAAAGATGG - Intergenic
1035355885 7:158276026-158276048 GATTTGTGCAGATAAAAGTCAGG - Intronic
1036445893 8:8821693-8821715 GATGTTAGCAGATACTACGCAGG + Intronic
1037685039 8:21131392-21131414 GATATTAGCAGACATAAAGCAGG + Intergenic
1038217660 8:25577528-25577550 GATGTGAAGAGATAGAAAGTGGG - Intergenic
1039881990 8:41630768-41630790 GATGTGAGCAAATAAAACTGTGG - Intergenic
1042119642 8:65472114-65472136 GATGACGGCAGATATAAAGCTGG - Intergenic
1042492384 8:69414505-69414527 GATGATGGCAGATATAAAGCTGG - Intergenic
1043887274 8:85615842-85615864 GGTGTGAGCAGATACAAACTGGG + Intergenic
1047069280 8:121324734-121324756 GATATGAGTAGATACAAAGTTGG - Intergenic
1047966792 8:130050941-130050963 TTTGTCATCAGATAAAAAGCTGG + Intergenic
1048635702 8:136292919-136292941 GATGTGGGCAGAGGAAAAGAAGG - Intergenic
1048649980 8:136464932-136464954 GCTGTGAAGTGATAAAAAGCTGG - Intergenic
1048809408 8:138272155-138272177 GAAGTGAGGAGAGAAAAAGTTGG - Intronic
1048884737 8:138900895-138900917 GATTTGAACACAAAAAAAGCAGG + Intronic
1048891422 8:138952363-138952385 GATGTGTGCAGTTAAAACCCTGG + Intergenic
1049758014 8:144319377-144319399 GATGTGAGCAGATCAGCAGCTGG - Intronic
1050971667 9:11884375-11884397 GAGGTGAAAAGATAAAAAGCAGG + Intergenic
1052424875 9:28291304-28291326 GAAGTGAACAGAAAAAGAGCTGG + Intronic
1053222691 9:36325314-36325336 GCTGTGATGAGAGAAAAAGCAGG - Intergenic
1055887914 9:81086556-81086578 GATGTGGGCTGATGCAAAGCTGG - Intergenic
1056130894 9:83585426-83585448 AATGTGCCCAGGTAAAAAGCGGG - Intergenic
1056795022 9:89652580-89652602 GGTGTGAGAAGAGAAAGAGCAGG - Intergenic
1058961120 9:109993846-109993868 GATGTGAGGGGAGAAAAAGAGGG - Intronic
1060258295 9:122052134-122052156 AATGTGAGCACATCAAAAGAAGG + Intronic
1061817088 9:133203958-133203980 GAGGTGGGCACATAAGAAGCTGG - Intergenic
1185516720 X:704829-704851 GGTGTGAGCAGACAAAAAGAAGG + Intergenic
1186862254 X:13684343-13684365 GAGGTGAGAGGATAAGAAGCTGG + Intergenic
1187812770 X:23198151-23198173 GATGTGTGTAGTTAAAAATCGGG + Intergenic
1189125359 X:38439708-38439730 TATGTGAGCAGAGGAGAAGCTGG + Intronic
1189658370 X:43270830-43270852 CATGTGTGCAGCTAAAAATCAGG + Intergenic
1189749042 X:44200114-44200136 GATGTTAACATAGAAAAAGCTGG + Intronic
1193820757 X:86161379-86161401 GGTGTTAGCAGATCAAAACCTGG + Intronic
1195272611 X:103247190-103247212 GTTGTCAGGAGATAAAATGCTGG - Intergenic
1195310485 X:103627790-103627812 GATGTGAGTAGATGAGAGGCAGG + Intronic
1197899806 X:131358494-131358516 GAAGTAAGCAGACAAAAAGGTGG - Intronic
1198597887 X:138256953-138256975 TATGTGAGCACATAGAATGCTGG - Intergenic
1199116253 X:143996728-143996750 GCTGTCAGCAGATATAAAGCAGG - Intergenic
1199982456 X:152928459-152928481 GATGAGAGCACATCAAAAGGGGG + Intronic
1200904334 Y:8466133-8466155 GCTGTGAGCAGAGACAAGGCAGG - Intergenic
1201271037 Y:12253919-12253941 GATGTGAGGAAATAAAAACATGG - Intergenic
1201495017 Y:14583517-14583539 GATGGGACCAGAGAAAAAGCAGG + Intronic