ID: 1092163089

View in Genome Browser
Species Human (GRCh38)
Location 12:6326839-6326861
Sequence CTCGAGAGTGAAGGTAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092163082_1092163089 30 Left 1092163082 12:6326786-6326808 CCTACAGAGTTAGCCTGCCTAGA 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1092163089 12:6326839-6326861 CTCGAGAGTGAAGGTAGGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 140
1092163085_1092163089 13 Left 1092163085 12:6326803-6326825 CCTAGAGTCACACAGGAGCACTG 0: 1
1: 0
2: 3
3: 33
4: 245
Right 1092163089 12:6326839-6326861 CTCGAGAGTGAAGGTAGGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 140
1092163084_1092163089 17 Left 1092163084 12:6326799-6326821 CCTGCCTAGAGTCACACAGGAGC 0: 1
1: 1
2: 2
3: 35
4: 212
Right 1092163089 12:6326839-6326861 CTCGAGAGTGAAGGTAGGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092163089 Original CRISPR CTCGAGAGTGAAGGTAGGTG TGG Intronic
901662744 1:10808913-10808935 CGAGAGAGTCAAGGTGGGTGAGG - Intergenic
902333250 1:15741217-15741239 CTGCAGTGTGAAGGTCGGTGCGG - Exonic
903926587 1:26834848-26834870 CAGCAGAGTGAAGGCAGGTGGGG + Intronic
904313556 1:29645245-29645267 CTGGAGAGTGAAGGATGGGGGGG - Intergenic
905440989 1:37996556-37996578 CTCCAGAGGGAGGGTAGCTGTGG + Intergenic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908123258 1:61005713-61005735 CATGAGAGTGAAGAGAGGTGAGG - Intronic
908723275 1:67148538-67148560 CTCGTGTTTGAAGGTGGGTGTGG + Intronic
909178735 1:72392899-72392921 CTAGAGAGTGGAGGGAGTTGGGG + Intergenic
909429949 1:75576093-75576115 CTCTAGAGTAAAGGTGGGGGCGG + Intronic
915955049 1:160214124-160214146 CTCCAGAGTACAGGTGGGTGGGG - Exonic
916510438 1:165468301-165468323 CTGGAGAATGAAGGAAGGAGGGG + Intergenic
916525541 1:165605666-165605688 CTAAAGAGTGAAGGTAGGGAGGG - Intergenic
919714314 1:200759697-200759719 TTCTAGAGAGAAGGCAGGTGAGG + Intronic
921483373 1:215689079-215689101 CTTGAGAGAAAGGGTAGGTGAGG + Intronic
921811934 1:219524896-219524918 CTATAGGGTGAAGGGAGGTGAGG - Intergenic
922103634 1:222494274-222494296 GCTGGGAGTGAAGGTAGGTGGGG + Intergenic
922317797 1:224457936-224457958 CTAGAGAGTGCAGCTAGGTGTGG + Intronic
924929319 1:248713543-248713565 CACCAGAGTGAAGTTAAGTGTGG - Intergenic
1063977264 10:11427538-11427560 GTGGAGAGTGGAGGTGGGTGTGG - Intergenic
1065220987 10:23495700-23495722 CTGGAGAGTGCAGGCAGGAGTGG + Intergenic
1065434750 10:25694841-25694863 GTCGAGGGTGATGGGAGGTGGGG - Intergenic
1066477715 10:35764203-35764225 CTAGAGGGTGGAGGAAGGTGAGG + Intergenic
1066619664 10:37332741-37332763 CTCAAGAGTGAAGGTTGGTGGGG + Intronic
1070128543 10:73640921-73640943 CCCCAGAGTGGAGGCAGGTGTGG + Intronic
1073927954 10:108538854-108538876 CTTGAGTGTGAGGGCAGGTGTGG + Intergenic
1074591952 10:114821966-114821988 CTCCAGAGTGAAGGCCGGTGCGG - Exonic
1077412291 11:2409285-2409307 CTCCAGAGTGCAGGGAGGAGAGG - Intronic
1078053393 11:7986818-7986840 CTGGAGGGTGAGGGGAGGTGAGG - Intronic
1080351647 11:31392095-31392117 CTGGAGAGGGTAGATAGGTGGGG + Intronic
1080434728 11:32229151-32229173 CCCAAGAGGGAAGGAAGGTGGGG + Intergenic
1083282620 11:61636562-61636584 CTGAAGAGTGAAGAGAGGTGAGG - Intergenic
1087198004 11:95319805-95319827 CTGGGAAGTGAAGGCAGGTGGGG + Intergenic
1091721974 12:2820436-2820458 GAGGAGTGTGAAGGTAGGTGTGG + Intronic
1092163089 12:6326839-6326861 CTCGAGAGTGAAGGTAGGTGTGG + Intronic
1095373528 12:41499103-41499125 CTGGAGAGTGAAGGTGAGTCAGG + Intronic
1095402919 12:41835492-41835514 CTTCAGAGAGAAGGTAGGGGTGG + Intergenic
1096062993 12:48717466-48717488 CTTGAAAGAGAAAGTAGGTGAGG + Intergenic
1096394878 12:51258210-51258232 GTTGAGAGTGAGGGTAGGAGGGG + Intronic
1102762701 12:115402588-115402610 CTCCAGAGTAAAGGTGAGTGTGG - Intergenic
1103473270 12:121199080-121199102 CTCCAGAGTGAAGCCTGGTGTGG + Intergenic
1104926343 12:132315964-132315986 TTCGAGAGTGGAGGGTGGTGGGG + Intronic
1107805182 13:44146969-44146991 TTCGAGAGTGACTGGAGGTGGGG + Intronic
1109359467 13:61277106-61277128 GTCTAGAGTAAAGGTATGTGAGG + Intergenic
1112239039 13:97663099-97663121 CTCTAGAGTGAATGTAAATGTGG - Intergenic
1113978090 13:114247179-114247201 CTCGAGAGAGAGGGGAGGGGAGG - Intronic
1118442063 14:65821308-65821330 CTCAAGAAAGAAGGCAGGTGTGG + Intergenic
1121358456 14:93233887-93233909 CTGGAGAGAGAAGCCAGGTGGGG - Intergenic
1124010361 15:25833514-25833536 CTCCAGAGTGAAGAGAAGTGTGG - Intronic
1126350789 15:47742887-47742909 CTCTATAGTGAGAGTAGGTGGGG + Intronic
1128081287 15:64858360-64858382 CTGGAGAGTGGAGGGAGGGGAGG + Intronic
1132503748 16:296691-296713 CTCGGGAGTGATGGTCAGTGGGG + Intronic
1133032467 16:3017883-3017905 CCCGAGAGGCAAGGCAGGTGGGG + Intronic
1133412357 16:5579305-5579327 CTGGAAAGTGAAGGTGGGTGGGG - Intergenic
1140283124 16:73573922-73573944 CTGGAGAGTCACGGTAGGTATGG - Intergenic
1140593408 16:76379321-76379343 CTCCAGATTGTAGGGAGGTGGGG - Intronic
1141641624 16:85344806-85344828 CTGGAGAGAGAAGGGAGGGGAGG + Intergenic
1144051831 17:11503389-11503411 CTGGAGAGTGGAGGTGGGGGTGG + Intronic
1145751955 17:27361560-27361582 CTGAAGAGTGAAGGAAGGTCGGG - Intergenic
1146462033 17:33054011-33054033 CAGGAGAGCAAAGGTAGGTGCGG - Intronic
1146469351 17:33111674-33111696 CTGGAGAGGTAAGGTAGGTAGGG - Intronic
1147124091 17:38353441-38353463 CATGAGTGTGAAGGGAGGTGCGG - Intronic
1147253088 17:39165332-39165354 CTGGAATGTGAAGGGAGGTGGGG - Intronic
1147918077 17:43900461-43900483 CTCCAGAGGGAAGGTAGGGAAGG - Intronic
1150497906 17:65623222-65623244 CTCAATGGTGAAGGTGGGTGGGG + Intronic
1151920524 17:77151497-77151519 CGCTAGAGTGAAGGCAGTTGTGG + Intronic
1152491202 17:80635797-80635819 CTGAAGAGTGAAGGCAGATGAGG + Intronic
1155229458 18:23758499-23758521 CACGAGTGTGAAGGTGGGTGTGG + Exonic
1155265857 18:24092712-24092734 CTTCAGTGTGGAGGTAGGTGAGG + Intronic
1155289407 18:24325566-24325588 CTAGAGAGTGATGGTAGGATGGG - Intronic
1158200376 18:54932541-54932563 CTGGAGGGTGGAGGTAAGTGTGG - Intronic
1159451717 18:68611221-68611243 CTGGAGAGTGAAGATTGGTGGGG + Intergenic
926134445 2:10326560-10326582 CTCAGCTGTGAAGGTAGGTGAGG + Intronic
928087757 2:28356419-28356441 CTCCAGAGTGAAGGCAGGACAGG - Intergenic
928103573 2:28453407-28453429 ATGGAGGGTGAAGGTGGGTGAGG - Intergenic
934929394 2:98408339-98408361 CTGCAGAGTGAAGGTGGGAGGGG + Intergenic
935111139 2:100095270-100095292 CTCAAGCCTGAAGGTAGGTCAGG - Intronic
936123836 2:109769894-109769916 CTCAAGCCTGAAGGTAGGTCAGG + Intergenic
936220851 2:110601572-110601594 CTCAAGCGTGAAGGTAGGTCAGG - Intergenic
936525393 2:113237758-113237780 GACGAGTGTGAAGGTATGTGGGG - Intronic
937234999 2:120425392-120425414 CTGGGGATTGAAGGGAGGTGGGG - Intergenic
946027967 2:216683527-216683549 TGGGAGAGTGAAGGCAGGTGAGG + Intronic
947095663 2:226563748-226563770 CACTAGAGGGAAGGTAGGAGTGG - Intergenic
1169260713 20:4136174-4136196 CAGGAGAGTGGAGGAAGGTGGGG + Intronic
1170517678 20:17148815-17148837 CTAGACAGTGAAGGCAGGGGAGG - Intergenic
1172998785 20:39090825-39090847 CTTGAGAGTTAAGGTAGCTCAGG + Intergenic
1173406704 20:42772543-42772565 TTGTAGAGTGCAGGTAGGTGAGG - Intronic
1174435404 20:50503017-50503039 CTCGAGAGTGAAGCTAGCACAGG + Intergenic
1174682740 20:52424033-52424055 CAGGTGAGTGAAGGTGGGTGCGG - Intergenic
1174682764 20:52424153-52424175 CAGGTGAGTGAAGGTGGGTGCGG - Intergenic
1175705313 20:61172336-61172358 CTCGAGCCTGATGGTACGTGGGG + Intergenic
1183585960 22:38753076-38753098 CTCTAGGGAGAAGGCAGGTGGGG - Intronic
950044556 3:9941194-9941216 CTCAAGTGTGTAGGTAAGTGGGG + Exonic
950834307 3:15904520-15904542 CTCATGAATGAAGGCAGGTGTGG + Intergenic
952270195 3:31823412-31823434 CTGCAGAATGAAGGTAGGAGTGG + Intronic
956990077 3:74752225-74752247 CCCAAGAGTGCAGGTATGTGTGG + Intergenic
962695036 3:137939551-137939573 CTTGGGAGTGATGGTAAGTGGGG + Intergenic
964049776 3:152376455-152376477 CTTGAGAGTGTAGTTATGTGTGG + Intronic
964844495 3:161030988-161031010 TTCAAGAGGGAGGGTAGGTGTGG - Intronic
969185211 4:5469503-5469525 CTAGAGAGTGAGGAGAGGTGAGG + Intronic
970439850 4:16071318-16071340 TTAGAGAGAGAAGGAAGGTGAGG - Intronic
970809602 4:20076799-20076821 CTCAAGTGATAAGGTAGGTGTGG + Intergenic
971329873 4:25673602-25673624 TACAAGAGTGAAGGGAGGTGGGG - Intronic
972145481 4:36019730-36019752 ATAGAGTGTGAAGGTAGGAGTGG + Intronic
978045735 4:104124639-104124661 ATAGAGAGTGAAGGTAAGTTGGG + Intergenic
979366446 4:119830304-119830326 CTGGAGAGTAAAGGTGGGTGGGG - Intergenic
981142350 4:141283082-141283104 CTCTAGAGTTATGGAAGGTGTGG - Intergenic
984285662 4:177725076-177725098 CGAGAGAGTGTAAGTAGGTGAGG + Intergenic
989617453 5:43351050-43351072 CTCAAGAGACAAGTTAGGTGAGG - Intergenic
990456478 5:55994399-55994421 CTCGAGAATGAAGACAAGTGCGG + Intronic
995221629 5:109654832-109654854 CTAGAGGGTGAGGGGAGGTGAGG + Intergenic
996338390 5:122409875-122409897 CTTGAAAGTGAAGGTTGGTATGG + Intronic
996510641 5:124312153-124312175 CTTGAAAATGAAGGAAGGTGGGG + Intergenic
997879557 5:137577317-137577339 CACTGGAGTGAAGGCAGGTGGGG + Intronic
998848647 5:146334405-146334427 CTTGGGAATGAAGGTGGGTGGGG + Intronic
999584692 5:153077214-153077236 CTTGAGAGTGGAGATAGGAGTGG + Intergenic
1000312259 5:160056292-160056314 CTAGAAAGTGAAGGTATGAGTGG - Intronic
1000991342 5:167915119-167915141 ATCGGGAGTGAAGGGAGGTATGG - Intronic
1004021025 6:11775595-11775617 AAGGAGAGTGAAGGTAGGAGAGG - Intronic
1005903333 6:30238498-30238520 TTGGAGAATGAAGGTAGATGAGG + Intergenic
1007406632 6:41639333-41639355 CACGAGAGGGAAGGAAGGCGAGG - Intronic
1014632547 6:123803968-123803990 CGAGCGAGTGAAGGTATGTGTGG + Intergenic
1014976605 6:127892395-127892417 CTGGAGAGTAAAGCAAGGTGAGG - Intronic
1018527647 6:164730702-164730724 CTTTAGAGTGAAGGGAGGTTAGG + Intergenic
1019195283 6:170277881-170277903 CAGGAGAGGGAAGGGAGGTGGGG - Intergenic
1023086754 7:36578517-36578539 ATGGAGAGTGGAGGGAGGTGTGG - Intronic
1027251756 7:76403162-76403184 CTTGAGAGTGGAGGTGGGAGAGG + Intronic
1035663498 8:1364112-1364134 CTCAGGAGGGAAGGTGGGTGGGG - Intergenic
1035940299 8:3892599-3892621 CACCAGAGTGAAAGTAGGAGTGG - Intronic
1044771029 8:95634401-95634423 CTTGAGAGTGAAGGAAGAAGAGG - Intergenic
1046553248 8:115743609-115743631 CTAGATAATGAAAGTAGGTGGGG + Intronic
1046972757 8:120240599-120240621 CTTGAGAGTTAAGGAAGGTCTGG - Intronic
1048711363 8:137215075-137215097 ATAGAGATTGAAGGAAGGTGAGG - Intergenic
1049238744 8:141525849-141525871 CTCCAGAGTGATGGCAGGTCAGG + Intergenic
1049627509 8:143632280-143632302 GTGGAGAGAGAAGGTAGGGGTGG - Intergenic
1050097793 9:2085768-2085790 CTAGAGAGAGAAGGGAGATGAGG - Intronic
1050795280 9:9532218-9532240 CTTGAGAGAGAAGGTCTGTGTGG + Intronic
1053427956 9:38023441-38023463 CTCCAGGATGAAGGTAAGTGCGG + Intronic
1056226419 9:84500003-84500025 CAAGAGAGTGAAGGTTAGTGTGG + Intergenic
1056248530 9:84723594-84723616 CTCCACAGTGAGGTTAGGTGCGG - Exonic
1056724053 9:89096771-89096793 CTAGAGAGTGAAGGTCAGAGAGG + Intronic
1060839734 9:126784002-126784024 CTTGAGAGTGAGGGCAGGTTAGG + Intergenic
1190339208 X:49282962-49282984 GGCGAGAGTGATGGTAGGTAGGG + Intronic
1192203970 X:69084081-69084103 CTGGTGAGTGGAGGTGGGTGAGG - Intergenic
1193890663 X:87042169-87042191 CTTGAGAGTGAAGGTAGCACAGG - Intergenic
1196976570 X:121164181-121164203 CTGGAGAGTGGAGGGAGGAGGGG - Intergenic
1198728930 X:139706557-139706579 CTAGAGGGTGCAGGGAGGTGGGG + Intronic
1200088932 X:153625495-153625517 CTGGAGTGTGAAGGTGGGTGAGG + Intergenic
1200678425 Y:6178638-6178660 GTGGAAAGTGAAGGTAAGTGTGG + Intergenic
1201466636 Y:14288593-14288615 CAGGAGACAGAAGGTAGGTGGGG + Intergenic