ID: 1092167606

View in Genome Browser
Species Human (GRCh38)
Location 12:6352597-6352619
Sequence CAGGGTATACAGAACTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092167606_1092167620 27 Left 1092167606 12:6352597-6352619 CCATCCCAGTTCTGTATACCCTG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1092167620 12:6352647-6352669 TTAATTTGCTCATCTGAGACAGG 0: 1
1: 0
2: 0
3: 22
4: 358
1092167606_1092167613 1 Left 1092167606 12:6352597-6352619 CCATCCCAGTTCTGTATACCCTG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1092167613 12:6352621-6352643 GACGTGTCACATCCTCCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092167606 Original CRISPR CAGGGTATACAGAACTGGGA TGG (reversed) Intronic
900959896 1:5912205-5912227 CGGTGTGTGCAGAACTGGGAAGG + Intronic
902811312 1:18889546-18889568 CAGGCAATACAGAAATGAGAAGG + Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904049671 1:27631722-27631744 CAGAGGGTACAGAACTGGGCAGG + Intronic
905025583 1:34847243-34847265 CTGGGCAAACAAAACTGGGAGGG + Intronic
905878230 1:41447152-41447174 CAGAGCATTCAGACCTGGGAGGG - Intergenic
907077482 1:51591887-51591909 TAGGGTACTCAGAACTGGGAAGG - Intronic
908414099 1:63895941-63895963 GAGGGTATCCAGAACTTAGAGGG - Intronic
909336528 1:74480997-74481019 CAGGGTACACATGAGTGGGAGGG + Intronic
911520443 1:98923640-98923662 CAGAGTATTGAGACCTGGGATGG - Intronic
912451541 1:109770540-109770562 CAGGGGATCCAGGGCTGGGAAGG - Intronic
913569128 1:120102774-120102796 CAGGGTATAAATGACTGGAATGG + Intergenic
914289937 1:146263765-146263787 CAGGGTATAAATGACTGGAATGG + Intergenic
914550980 1:148714548-148714570 CAGGGTATAAATGACTGGAATGG + Intergenic
915335410 1:155138095-155138117 CATGGTAAGCACAACTGGGATGG + Exonic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
920859869 1:209697003-209697025 CAGGGGATAGAGTTCTGGGATGG + Intronic
921885594 1:220302085-220302107 CACAGTATGCAGAAATGGGAAGG - Intergenic
924451815 1:244185240-244185262 CAGAATATACAGAACTTGGTTGG + Intergenic
924656717 1:245979232-245979254 CAGGGTAAAAACAACTGGGATGG + Intronic
1066645011 10:37597599-37597621 CAGGGAGTTCAGAGCTGGGATGG - Intergenic
1068093719 10:52464605-52464627 CAAGGAATGAAGAACTGGGAAGG - Intergenic
1069825191 10:71250470-71250492 CAGGCTATACAGGTCTGGGGAGG - Intronic
1070953771 10:80451503-80451525 CAGGGAATGGAGAACTGGGAGGG - Intergenic
1073190375 10:101646599-101646621 CAGGGGACGCAGAGCTGGGAGGG + Intronic
1074858582 10:117491915-117491937 CAGGGTATACAGAAACTGAAAGG + Intergenic
1075713399 10:124542649-124542671 CAGGGTGCACAGGGCTGGGATGG - Intronic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1079108304 11:17588393-17588415 CACGGAACACAGAGCTGGGAAGG - Intronic
1080122005 11:28689296-28689318 CAGGGACTTCTGAACTGGGAAGG + Intergenic
1080286868 11:30625063-30625085 CAGGGGTCACAGACCTGGGAGGG - Intergenic
1080516621 11:33028229-33028251 CAGGGTTTCCACAACTGGAATGG - Intronic
1082025894 11:47571839-47571861 CATGGGATACAGGACAGGGATGG + Intronic
1084321361 11:68375222-68375244 CAGGGCACACGGAACTGGGGAGG - Intronic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1089329005 11:117676955-117676977 CCGGGTAGAGAGCACTGGGAGGG + Intronic
1091272355 11:134326583-134326605 AAGGGAATACATAAATGGGATGG - Intergenic
1091684693 12:2553335-2553357 TAGGCTTTACAGAACTGGAAGGG - Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1096036793 12:48479001-48479023 TTGGGTATACAGTAATGGGATGG - Intergenic
1101364365 12:104058070-104058092 CAGAGTTTCCAGAGCTGGGATGG + Intronic
1104511068 12:129378595-129378617 CAGGGCAGACAGACCTGAGAAGG - Intronic
1108281634 13:48867700-48867722 CAGGTTATATAGAGGTGGGAAGG + Intergenic
1112462303 13:99613681-99613703 CAGGGTAAACATGACTGAGATGG + Intronic
1113119811 13:106914049-106914071 CAGAGCATACAGCTCTGGGAAGG - Intergenic
1113216098 13:108042392-108042414 CAGAATATAAAGAACTTGGAGGG - Intergenic
1115665591 14:35541721-35541743 CAAGGTAAACAGCAATGGGAGGG - Intronic
1116330926 14:43596896-43596918 CAGGGTACAGAGAGCTGGAAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118425132 14:65652274-65652296 GAGGGCATACAAAACAGGGAGGG - Intronic
1119392768 14:74302545-74302567 CAGGGTGTCAAGAACTGAGAAGG + Intronic
1122664895 14:103322195-103322217 CAGGGCAAACAAAACTTGGACGG - Intergenic
1126280781 15:46947048-46947070 AAGGGTATAGAGAGGTGGGAAGG - Intergenic
1128865758 15:71114537-71114559 CAAGGTGTTCAGAGCTGGGAAGG - Intronic
1131455698 15:92580813-92580835 CAGAGCACACAGACCTGGGAGGG + Intergenic
1131538851 15:93259435-93259457 CAGTGTATACAGCATTGGGATGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132343558 15:101093021-101093043 GAGGGTCTACAGAGCTGGCAGGG + Intergenic
1133412653 16:5581012-5581034 CAGTGTGCACAGACCTGGGATGG + Intergenic
1133633163 16:7641076-7641098 CTGGGTCTACAGAGCTGGGAAGG + Intronic
1134676364 16:16093417-16093439 CAGTGTATACAGAACATGGAAGG + Intronic
1137027216 16:35489035-35489057 CAGGCCATGCAGATCTGGGAGGG + Intergenic
1140017150 16:71198614-71198636 CAGGGTATAAAAACCAGGGAGGG + Intronic
1140222057 16:73050794-73050816 CTGGGTATGGAGAACTGCGAGGG - Intronic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1140996321 16:80263166-80263188 GAGGGTATACAGATGTGGGTGGG - Intergenic
1141082117 16:81061707-81061729 CAGGGGAGGCAGAACTAGGAGGG + Exonic
1141497515 16:84420165-84420187 CAGGGTGTACAGAGCAGGGAGGG - Intronic
1143098026 17:4488923-4488945 CCGGGGCTACAGAACTGGGCAGG - Intergenic
1144024953 17:11269476-11269498 CAGGGTGGAAAGAACTGGAAGGG - Intronic
1144105955 17:11985673-11985695 CAGGGTCTTGGGAACTGGGAAGG - Intronic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1146262928 17:31433507-31433529 AAGGTTGTACTGAACTGGGAGGG - Intronic
1151954840 17:77375005-77375027 CTGGGTCTGCAGAGCTGGGAGGG + Intronic
1152212673 17:79010660-79010682 CAGGGAATACAGAACGGCAATGG - Intergenic
1155412441 18:25561602-25561624 CAGGTTGCCCAGAACTGGGAGGG + Intergenic
1155901539 18:31396891-31396913 CAGGGCACACACAGCTGGGAAGG - Intronic
1158009676 18:52714507-52714529 AAGGGCATACTGAACTGGGAAGG + Intronic
1160301514 18:77685453-77685475 CAGGGTAGAATGAACTTGGAGGG + Intergenic
1160727742 19:625057-625079 CAGGGTTTTAAGATCTGGGACGG - Intronic
1162521712 19:11184486-11184508 CAGGGTCAACAAACCTGGGAAGG + Intronic
1162781105 19:13007431-13007453 CAGGGCAATCAGAAATGGGAGGG - Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1164977324 19:32582896-32582918 CTGGGTCTACAGAAATAGGAAGG + Intronic
1165100483 19:33435882-33435904 CAGTGTTTACAGCCCTGGGAAGG - Intronic
1166729830 19:45052777-45052799 CAGGGCATCCTGAAGTGGGAGGG - Exonic
1167690035 19:50979744-50979766 CAGGGTACCCAGGACTGGGGAGG + Intronic
926627300 2:15102934-15102956 CAGGGTATACAGATTTTGGAGGG + Intergenic
931772644 2:65511558-65511580 CAGGGAATGCAGAACTTAGAGGG - Intergenic
939505286 2:143038480-143038502 CAGGTTACACAGAACTTGGTAGG - Intronic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
941873830 2:170413309-170413331 CAGGGCCTACAGCACTGGAAAGG + Intronic
945146781 2:206746812-206746834 CAGAGTATGAAGAATTGGGAAGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
1170735098 20:19007500-19007522 CAGGGTATTGGGAATTGGGAAGG + Intergenic
1170953410 20:20956575-20956597 CAGGGAATGCAGACGTGGGAGGG + Intergenic
1171073780 20:22102258-22102280 CATGGGAATCAGAACTGGGATGG + Intergenic
1172731724 20:37094600-37094622 CAGTGTAGACAGAATTGTGATGG - Intronic
1172909185 20:38393821-38393843 CAGGCTCTTCAGAAATGGGAAGG - Intergenic
1173738618 20:45379914-45379936 CAGGGTAAAGGGAACAGGGAGGG + Intronic
1175695285 20:61098766-61098788 CAGTGTAGCCAGACCTGGGAGGG - Intergenic
1180931171 22:19592957-19592979 CAGAGTCTACAGAAATGAGATGG + Intergenic
1182868973 22:33629233-33629255 CATGGAAGACATAACTGGGAAGG + Intronic
1182958218 22:34447228-34447250 CAGGGTATACAGATCTGAACTGG + Intergenic
949354191 3:3160432-3160454 CATGGTAATAAGAACTGGGATGG + Intronic
949589770 3:5482038-5482060 AAGAGTATAGAGAACTGTGAAGG - Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
955031906 3:55230247-55230269 GAGGGCACAAAGAACTGGGAGGG + Intergenic
955856489 3:63278549-63278571 CAGGTGAGACAGAACTGGGCAGG + Exonic
956594975 3:70957676-70957698 CATGGTATGCAGAAATGTGATGG - Intronic
957267025 3:77981311-77981333 CAGGATATACATAACAGGCAAGG + Intergenic
961226863 3:125257695-125257717 GAGGGTAGAGAGAAATGGGAAGG - Intronic
961705310 3:128780488-128780510 CAGCTTATAGAGAACTGAGATGG + Intronic
962391351 3:134975324-134975346 CAGGGGATGCAGAACTGGGGTGG + Intronic
968317652 3:197737544-197737566 CTGGGTAGCCAGAGCTGGGAAGG + Intronic
969606358 4:8204131-8204153 CAGGGCATGGAGAACCGGGACGG - Intronic
970130221 4:12861249-12861271 CAGGGGATTCAGATATGGGAAGG - Intergenic
975709008 4:77140492-77140514 CAGCCTATACAGAGCTTGGAGGG - Intergenic
976659559 4:87525577-87525599 CAGGGGAAAAACAACTGGGAAGG - Intronic
980741834 4:136960603-136960625 CATGGTAAACAGAACGGTGAGGG - Intergenic
981593481 4:146391751-146391773 CAAGGTATACTGCACTGAGAAGG + Intronic
982172669 4:152677004-152677026 CAGGGCATAAAGAACAGAGACGG + Intronic
984501525 4:180565148-180565170 CAGGGTATGAGGAAGTGGGAGGG - Intergenic
985894600 5:2740800-2740822 CAGGGTCTCCAGCACTGGGAAGG + Intergenic
986539234 5:8826842-8826864 CCGGGTATACATATCTTGGAGGG + Intergenic
986885181 5:12225775-12225797 AAGGATATAGAAAACTGGGAAGG - Intergenic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
989138145 5:38175638-38175660 CAGGAAATCAAGAACTGGGAAGG - Intergenic
989188072 5:38643835-38643857 CAGGTTATAAAGCACTGGAATGG + Intergenic
992381143 5:76239087-76239109 CAGGACATACAGAAGTGGGGGGG - Intronic
995179306 5:109215388-109215410 CAGGGGATTCAGAAATGGGGAGG - Intergenic
999610632 5:153365370-153365392 CTGGGTATACAGAAATGTCAGGG + Intergenic
999674770 5:153987904-153987926 CAGAGAATATAGAGCTGGGAGGG - Intergenic
1003267286 6:4576977-4576999 CAGGGGATAGGGAGCTGGGATGG - Intergenic
1004282891 6:14295926-14295948 CAGGGGATACAGAAATGAGTAGG + Intergenic
1004911864 6:20293502-20293524 CAGGCTATAGAGACTTGGGAGGG + Intergenic
1007188586 6:39994557-39994579 CTGGGTATACAGTACTGACATGG - Intergenic
1008090887 6:47292503-47292525 CAGGGTGTCCAAAACTTGGATGG - Intronic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1010060037 6:71611724-71611746 CAGGGTATATAAAACTTTGAAGG + Intergenic
1011094679 6:83647157-83647179 AAAGGTATACAGATTTGGGATGG - Intronic
1016769703 6:147835590-147835612 CGGGGTAAACAGAAATGGCATGG - Intergenic
1016968701 6:149742723-149742745 CAGTGTATATAGAACTTTGATGG - Intronic
1017718913 6:157231381-157231403 CAAGGTATCCATGACTGGGAAGG - Intergenic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1018283503 6:162213394-162213416 CAATGCATACACAACTGGGAAGG + Intronic
1019769873 7:2876898-2876920 AAGGGCACACAGGACTGGGAAGG + Intergenic
1020363611 7:7356351-7356373 CATGGAATAGAGAGCTGGGATGG + Intronic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022478037 7:30724577-30724599 CAGGGAAAACACAACTGGAAAGG - Intronic
1023465671 7:40451802-40451824 CACGCTACACATAACTGGGAAGG - Intronic
1023805868 7:43872548-43872570 CAGGGGATACAGCACTGGCTGGG + Intronic
1023892496 7:44403246-44403268 CAGGAGAGTCAGAACTGGGATGG + Intronic
1024883648 7:54116990-54117012 CAGGTGATACAGAAGTGAGAGGG - Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1032200611 7:129820051-129820073 CTGGGTACACAGAAGTGGGGAGG + Intergenic
1032894004 7:136230906-136230928 AAAGGTATGCAGAATTGGGAAGG - Intergenic
1034493833 7:151408815-151408837 CAGGGTTTACAGCAATGAGAGGG + Intronic
1034706027 7:153145319-153145341 CAAGTTACACAGAACTGGGGTGG + Intergenic
1037070483 8:14640829-14640851 CAGAGTATTCAGAACTTGCAGGG - Intronic
1040479390 8:47809806-47809828 CAGGGAAATCAAAACTGGGAAGG + Intronic
1041893108 8:62893708-62893730 AAGGATATATATAACTGGGAAGG + Intronic
1042230229 8:66547006-66547028 CACTGAATACAGAACTGGGGTGG + Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1044992221 8:97806351-97806373 CTGGGGATAGAGAACAGGGAAGG + Intronic
1047024850 8:120813235-120813257 GAGGGTAGACAGCAGTGGGAAGG - Exonic
1049329261 8:142041372-142041394 CAGAGTCCACAGAGCTGGGAGGG - Intergenic
1049529842 8:143148712-143148734 CAGGGGCTGCAGAGCTGGGATGG - Intergenic
1057344296 9:94234581-94234603 CAGGGTATACAGGACATGAATGG + Intergenic
1057929499 9:99181300-99181322 CAGGCTACACAGAACTGTGCTGG + Intergenic
1058418445 9:104812411-104812433 CAGCGGATACACAACTGGCAAGG + Intronic
1062328960 9:136028262-136028284 CAGGTTCTACAGAACAGGGCTGG + Intronic
1185690821 X:2153917-2153939 CTGGGTCTCCAGAACTGGAAAGG + Intergenic
1185701134 X:2231284-2231306 CAGAAGTTACAGAACTGGGAAGG - Intronic
1187221703 X:17333082-17333104 TAGTGTATACAGAACTGTGCTGG + Intergenic
1195117013 X:101709351-101709373 GAGGGAATAAAGAAGTGGGAAGG + Intergenic
1195363160 X:104104562-104104584 CAGAGGATACAGAACTAGGCAGG + Exonic
1196383898 X:115126750-115126772 CAGGTTACAGAGAACTGGCAAGG + Intronic
1200268371 X:154658864-154658886 CAGAGTATGCAGAGTTGGGAAGG + Intergenic
1201061312 Y:10049257-10049279 CAGACTATACAGAGGTGGGAAGG + Intergenic