ID: 1092168318

View in Genome Browser
Species Human (GRCh38)
Location 12:6356830-6356852
Sequence AGTCCTCCTCTGCTGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 222}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092168318_1092168322 2 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168322 12:6356855-6356877 AGAGAAGAGGGAGAAGAGGCTGG 0: 1
1: 5
2: 24
3: 272
4: 2296
1092168318_1092168320 -10 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168320 12:6356843-6356865 GAGGAGGACTAAAGAGAAGAGGG 0: 1
1: 1
2: 7
3: 90
4: 913
1092168318_1092168329 27 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168329 12:6356880-6356902 AGAGATAAAGGGTGGGGTTCTGG 0: 1
1: 0
2: 2
3: 29
4: 342
1092168318_1092168325 19 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168325 12:6356872-6356894 GGCTGGCCAGAGATAAAGGGTGG 0: 1
1: 0
2: 1
3: 34
4: 373
1092168318_1092168327 21 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168327 12:6356874-6356896 CTGGCCAGAGATAAAGGGTGGGG 0: 1
1: 0
2: 2
3: 18
4: 233
1092168318_1092168326 20 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168326 12:6356873-6356895 GCTGGCCAGAGATAAAGGGTGGG 0: 1
1: 0
2: 0
3: 24
4: 255
1092168318_1092168321 -2 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168321 12:6356851-6356873 CTAAAGAGAAGAGGGAGAAGAGG 0: 1
1: 0
2: 10
3: 87
4: 929
1092168318_1092168323 15 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168323 12:6356868-6356890 AAGAGGCTGGCCAGAGATAAAGG 0: 1
1: 2
2: 2
3: 45
4: 290
1092168318_1092168324 16 Left 1092168318 12:6356830-6356852 CCAGTGAGCAGCAGAGGAGGACT 0: 1
1: 0
2: 3
3: 28
4: 222
Right 1092168324 12:6356869-6356891 AGAGGCTGGCCAGAGATAAAGGG 0: 1
1: 0
2: 4
3: 31
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092168318 Original CRISPR AGTCCTCCTCTGCTGCTCAC TGG (reversed) Intronic
900094766 1:935894-935916 AGGCCCCCTGTGCTCCTCACCGG - Exonic
900279982 1:1860683-1860705 AGTCTTGCTCTGTTGCCCACAGG - Intronic
900590936 1:3459543-3459565 GGACCTCCTCTGCTGCTTCCGGG - Intronic
900593038 1:3468280-3468302 ATTCGTGCTCTGCTCCTCACTGG - Intronic
901129023 1:6950667-6950689 TGTGCTCCTTTGCAGCTCACTGG + Intronic
902769655 1:18638122-18638144 AAACCTCCTCTGCTTCTCCCTGG - Intronic
902829972 1:19006088-19006110 GTTCCTCCACTGCAGCTCACAGG + Intergenic
902975142 1:20083095-20083117 AATCTTTCTCTGCTGCTCCCTGG - Intronic
904008488 1:27376333-27376355 AGGCCTCCTCTGCACCTCCCTGG + Intergenic
905797792 1:40825291-40825313 ACGCCTCCCCTGCTGATCACTGG - Intronic
907518439 1:55007904-55007926 GGTTCTCCTCTGTTGCTCATAGG - Intronic
907717748 1:56943130-56943152 AGTCCTCATCTACTGCCAACAGG + Intronic
908931499 1:69321530-69321552 AGGCCACCTCTGCTGCACACAGG - Intergenic
910114416 1:83716531-83716553 TGTCCAACTCTGCTGCTTACCGG - Intergenic
910213656 1:84819748-84819770 AGTCCTCCTCTGCTGCTCTTTGG + Intronic
910467870 1:87519304-87519326 AGTTCTCCTCGGATGCTCTCAGG + Intergenic
911023751 1:93414867-93414889 GGTTCTCCTCTGCTGAACACAGG + Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
915587282 1:156850941-156850963 AGTCTTGCTCTGCAGCTGACAGG + Intronic
916140266 1:161690994-161691016 AGTCCTCCTCTGTTAATCAAAGG - Intergenic
919833881 1:201560541-201560563 GCTCCTCCTCTGCTTCTCTCTGG - Intergenic
919877917 1:201884065-201884087 AGTCCTGCTCTGCCACTTACTGG - Exonic
920245552 1:204585081-204585103 AGTGCTCCACTGCTCCTCTCAGG - Intergenic
920832916 1:209481425-209481447 AGTCCTCCTTACCTTCTCACAGG - Intergenic
924197053 1:241619190-241619212 TGTCCCCATCTGCTGCTCAGTGG + Intronic
924484876 1:244472298-244472320 AACTCTCCTCTGCTGCTCATGGG - Intronic
1063026911 10:2188599-2188621 AGTACTCATCTTCTGCTCCCAGG - Intergenic
1065303801 10:24349910-24349932 AGGCCTGCTCTTCAGCTCACTGG - Intronic
1067272641 10:44805401-44805423 AGTCCCCCTCTGGTGAGCACAGG - Intergenic
1067457277 10:46427983-46428005 AGTCTTCCTCTGTTGCTCTCTGG - Intergenic
1067629925 10:47956655-47956677 AGTCTTCCTCTGTTGCTCTCTGG + Intergenic
1069866761 10:71508763-71508785 AGTCTTCCTCTGATTCTCAAAGG - Intronic
1070160082 10:73861257-73861279 ATCCCAGCTCTGCTGCTCACTGG - Intronic
1071255473 10:83868228-83868250 AGCCTTCCTCTACAGCTCACAGG - Intergenic
1073414399 10:103368736-103368758 AGCTCTCCTCAGCTTCTCACTGG - Intronic
1073483261 10:103800226-103800248 AGCCCACCTCTGCGGATCACAGG - Intronic
1073514067 10:104061570-104061592 ATTCATCATCTGCTTCTCACTGG - Intronic
1074549514 10:114429551-114429573 ATTCTAGCTCTGCTGCTCACTGG + Intergenic
1076033417 10:127178197-127178219 TGGCCTCCACTGCTGTTCACTGG + Intronic
1076336435 10:129709860-129709882 AGGCCTCCGCAGCTGCTGACAGG + Intronic
1077062705 11:624859-624881 TGGCCTCCCCTGCTGTTCACCGG - Exonic
1077934288 11:6767581-6767603 AGTCCTCCTCTGATGCTGAGAGG + Intergenic
1081527098 11:43934728-43934750 GGTCCTCCTCTGCTTTTCCCTGG - Intronic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1081760071 11:45571018-45571040 ACTCCTCACCTGCTGCTCCCTGG + Intergenic
1083311516 11:61786237-61786259 AGGCCAGCTCTGCTGTTCACTGG + Exonic
1083805573 11:65071883-65071905 AGTCCTGCTCTGCTGCTCATAGG + Intronic
1084447374 11:69211720-69211742 AGACATCCTCTCCTGCACACTGG - Intergenic
1085455266 11:76661878-76661900 AGCTCTGCCCTGCTGCTCACTGG - Intronic
1085506940 11:77066386-77066408 AGAGGCCCTCTGCTGCTCACAGG + Intergenic
1085514317 11:77103475-77103497 TTTCCTCCTCTGCTTCTCCCTGG + Intronic
1089179062 11:116568285-116568307 ACTCCTCCTGTCCTGCTCACAGG - Intergenic
1091685194 12:2556432-2556454 AGGCCTCCTCTGCAGCTCTTGGG + Intronic
1091722206 12:2821521-2821543 ATTCTTCCTCTGGTCCTCACAGG + Exonic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1092267276 12:6991845-6991867 AAACCGCCTCTGCTGCACACTGG - Intronic
1096103853 12:48985511-48985533 AGTCCTCCTCTCCAGCGCAGAGG + Intergenic
1096321642 12:50619362-50619384 AGTTGTACTCTGCTGCTGACTGG - Intronic
1096411163 12:51378062-51378084 TGACCTCCTCTGCTGGTCAGAGG + Intronic
1099551298 12:84046735-84046757 AGTCCTCCACTGATGGACACAGG + Intergenic
1099916147 12:88896155-88896177 AAGTCTCCTCTGCTGCTCTCAGG + Intergenic
1100723010 12:97378531-97378553 AGTCCTCCTATGCTTCCCTCTGG - Intergenic
1101593206 12:106140318-106140340 GGGCCTCCTCTGCAGCTCTCAGG + Intergenic
1102458759 12:113087369-113087391 ACTCCTCCTCAGCTGCTGTCTGG - Intronic
1103128094 12:118442115-118442137 AGTCCTCCTCTACTGTGCAAGGG + Intergenic
1103322333 12:120099391-120099413 AGACCTGCTCTGCTGCCCAGGGG - Intronic
1103939756 12:124495328-124495350 AGTCCTCGTCATCAGCTCACGGG + Intronic
1104218946 12:126763331-126763353 ATTTCTGCTCTGCTGCTCATGGG - Intergenic
1104789439 12:131472616-131472638 GGTCCACTTCTGCTGCTGACAGG - Intergenic
1105210305 13:18253417-18253439 TATGCTGCTCTGCTGCTCACAGG + Intergenic
1107242115 13:38248739-38248761 AGTTCTCCTCTACTGGACACGGG - Intergenic
1107437036 13:40389263-40389285 AGCCATTCTCTGCTCCTCACAGG - Intergenic
1108480753 13:50867749-50867771 GGTGCTCCTTTGCTGCTCTCTGG - Intergenic
1108789100 13:53944828-53944850 AGTACTCCTCTGCTCTTCATCGG + Intergenic
1109861036 13:68199552-68199574 ATCCCTCCTCTGCTGCTGGCTGG - Intergenic
1113781944 13:112982047-112982069 AGGCCTCCACTGCTGCACTCCGG - Intronic
1117292681 14:54348873-54348895 TGTCCTCTCCAGCTGCTCACAGG - Intergenic
1117522005 14:56560276-56560298 ATTCCTGCTCTGCTGCTCGTTGG + Intronic
1119920703 14:78443392-78443414 TATCCCCCTCTGGTGCTCACTGG + Intronic
1121708746 14:96021026-96021048 TGTCCACTTCTGCTGCCCACTGG + Intergenic
1121941748 14:98077348-98077370 ATTCCTTCTCTGCTGCCCACAGG + Intergenic
1122636201 14:103130833-103130855 AGCCCATCTCTGCTGCTCCCAGG - Intronic
1122873328 14:104651273-104651295 AGTCCTGCCCTGCGGCCCACAGG - Intergenic
1122971137 14:105152673-105152695 AGTGCTCCCCTGCTGCCCGCTGG - Intronic
1202836955 14_GL000009v2_random:85541-85563 AGTCCTCCTCGGCTGGTCTATGG - Intergenic
1130066287 15:80607752-80607774 AGGGCTCCTCAGCTTCTCACAGG - Intergenic
1132067539 15:98744520-98744542 ATTCCACCTCTGCTCCTCCCTGG - Intronic
1132799904 16:1746878-1746900 AGAGCTCCTCTGCCGCCCACCGG - Intronic
1133297472 16:4761984-4762006 ACTCCTACTCTGCTGGGCACAGG - Intronic
1134915569 16:18068052-18068074 AGTCATCCTCTGCTGCTTCCTGG - Intergenic
1135292292 16:21250316-21250338 CGTCCTCCTCTGCTGACAACTGG - Exonic
1135388617 16:22069014-22069036 AGGCTACCTCTGCTTCTCACTGG + Intronic
1136293832 16:29290795-29290817 AGTACTTCTCAGATGCTCACTGG + Intergenic
1139286915 16:65823613-65823635 AGCTCCTCTCTGCTGCTCACTGG + Intergenic
1139660647 16:68418604-68418626 AATCCTCCTCTGCTGCCTGCAGG - Intronic
1140188232 16:72793299-72793321 ATTCCTCCTGTGTTGCTCCCGGG - Exonic
1141178587 16:81737223-81737245 AGTCTTGCTCTGTTGCCCACGGG + Intergenic
1141224485 16:82102056-82102078 AGTCCTGCTGTTCTGCTCAAGGG + Intergenic
1142217176 16:88835559-88835581 AGCCCTCCTCTGCTGATCCCAGG + Intronic
1142440497 16:90094637-90094659 AGTCCTCGCCCGCAGCTCACGGG - Intergenic
1145793240 17:27641078-27641100 ATTCCTCCTCTCCAGGTCACTGG + Intronic
1147384270 17:40072322-40072344 GGTCCTCCTCGGCTGCCCCCAGG + Intronic
1147385372 17:40078034-40078056 ACTCCTCCTCTGCCACTCACAGG + Intronic
1147880853 17:43652397-43652419 AGTCCTCCCCTGATGCTGGCTGG - Intronic
1147947142 17:44086621-44086643 AGTCCTCCCCTGCTGCCCCTGGG - Exonic
1148199616 17:45741170-45741192 AGTCCCCATCTGCTGCTTACTGG + Intergenic
1150811873 17:68363179-68363201 AGTCCTCCTCCTTTGCTCCCAGG - Intronic
1152233893 17:79128539-79128561 AGGCCACCTCTACAGCTCACAGG + Intronic
1152272317 17:79331895-79331917 AGCCCTCCTGTGCGGCTCACAGG + Intronic
1152957067 18:48920-48942 AGTCCTCGCCCGCAGCTCACCGG + Exonic
1154412149 18:14147252-14147274 GCTCCTCCCCTGGTGCTCACTGG + Intergenic
1155438226 18:25834704-25834726 AGTCCTACTCTGCTACTTGCCGG - Intergenic
1156499369 18:37547426-37547448 AGGCTGCCTCTTCTGCTCACAGG + Intronic
1160121277 18:76132526-76132548 AGTCATCCTGTGGTGCTCATTGG - Intergenic
1160558628 18:79742086-79742108 ATGCCTCCTCTGCTGCCCCCAGG - Intronic
1160558638 18:79742119-79742141 ATGCCTCCTCTGCTGCCCCCAGG - Intronic
1160558663 18:79742250-79742272 ACACCTCCTCTGCTGCCCTCAGG - Intronic
1160558671 18:79742294-79742316 ATGCCTCCTCTGCTGCCCTCAGG - Intronic
1161089902 19:2354504-2354526 AGTCGTCCCCAGCTGCACACGGG + Intronic
1165815571 19:38640000-38640022 AGTGTGCCTCTGCAGCTCACTGG + Intergenic
1166238984 19:41476893-41476915 AGTCCTCCCCTGATGCACTCTGG + Intergenic
1166297589 19:41896592-41896614 CATGCTCCTCTGCTGCTCTCTGG + Intronic
1166373141 19:42313509-42313531 AGCCCTCCTCTGCGGCCCGCCGG + Intronic
1167824718 19:51961797-51961819 ATTCCTCCTCTTCCCCTCACTGG + Intergenic
1168614997 19:57830381-57830403 AGTTGTCCTCTGCTGCACAGAGG + Exonic
1202635683 1_KI270706v1_random:41809-41831 AGTCCTCCTCGGCTGGTCTATGG + Intergenic
925001649 2:407704-407726 AGCCCTTCCTTGCTGCTCACAGG - Intergenic
926781260 2:16474223-16474245 CATGCTCCTCTGCAGCTCACTGG + Intergenic
928008421 2:27583674-27583696 CGTGCTCCTCTGCTGCTTAAAGG - Exonic
929220512 2:39460168-39460190 AACTCTCCTATGCTGCTCACAGG + Intergenic
929430329 2:41880868-41880890 AGTCCCACTCTGTTGCTCCCAGG + Intergenic
929688919 2:44058660-44058682 AGCCATCCTCAGATGCTCACTGG + Intergenic
931785166 2:65611599-65611621 AGTCCTCCTCTGGAGAACACAGG - Intergenic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
933301020 2:80541109-80541131 TGTCTTTCTCTGCTTCTCACTGG - Intronic
935148161 2:100410264-100410286 ACTCTTCCTCTGCTGCCCATGGG - Intronic
937376133 2:121337025-121337047 GGTTCTTCTCTGCTGGTCACTGG - Intergenic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
937859396 2:126696295-126696317 AGTCCTCCTCCGTTCCTCCCTGG - Exonic
937920097 2:127122714-127122736 TCTCCTCCTCTGCTTCTCCCAGG - Intergenic
940755515 2:157677381-157677403 AGTCCTTCTCTGCTGCCTATTGG - Intergenic
942859691 2:180594892-180594914 TGTATTCCTCTGGTGCTCACAGG - Intergenic
946076714 2:217079673-217079695 ACTCCCCCTCTGCAGCTCTCTGG + Intergenic
946226286 2:218265690-218265712 TGTCCTCCTCTGATCCTCTCTGG - Intronic
946458785 2:219851277-219851299 AGTCCTGCTCTGCCCCTCACTGG + Intergenic
946959550 2:224969503-224969525 AGTCCTCCAGGGCTGTTCACTGG + Intronic
947327697 2:228995715-228995737 TGTCCACCTTTGCTGCTCTCTGG - Intronic
948718354 2:239880709-239880731 TGTGCCCCTCTGCTACTCACCGG + Intergenic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1169601773 20:7269320-7269342 ATTCCTCCCTTGCTGTTCACAGG - Intergenic
1170457591 20:16547878-16547900 TCTCCAGCTCTGCTGCTCACAGG + Intronic
1171291449 20:23985107-23985129 TGTGCTGCTCTGCTGCTCACAGG + Exonic
1171411702 20:24952309-24952331 ATTCCAGCTCTGCTTCTCACTGG - Intronic
1173319843 20:41977493-41977515 AGGCTTCCTCTCCTACTCACTGG + Intergenic
1174643499 20:52065756-52065778 AGACCAGCTCTGCTGCTCACTGG - Intronic
1175795802 20:61769984-61770006 AGTCCTGCTGTCCTGCTCATCGG + Intronic
1176003546 20:62846405-62846427 AGTCCTCCTCAGCTGAGCCCAGG + Intronic
1176108957 20:63402544-63402566 AGTCCTCCTCCCCTTCTCTCCGG + Intergenic
1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG + Exonic
1179951142 21:44709373-44709395 TGTCCTCCCTTGCTGCCCACGGG + Intronic
1180765950 22:18345986-18346008 TATGCTGCTCTGCTGCTCACAGG - Intergenic
1180780363 22:18516392-18516414 TATGCTGCTCTGCTGCTCACAGG + Exonic
1180813079 22:18773713-18773735 TATGCTGCTCTGCTGCTCACAGG + Intergenic
1181199256 22:21208029-21208051 TATGCTGCTCTGCTGCTCACAGG + Exonic
1181400509 22:22647828-22647850 TGTGCTGCTCTGCTGCTCACAGG - Intronic
1181648862 22:24247963-24247985 TGTGCTGCTCTGCTGCTCACAGG + Intergenic
1181702489 22:24628926-24628948 TGTGCTGCTCTGCTGCTCACAGG - Exonic
1181882038 22:25988883-25988905 ATCCCAACTCTGCTGCTCACTGG - Intronic
1183314119 22:37127902-37127924 AAACCTCCACTGCTGCTCCCGGG - Exonic
1183381433 22:37492322-37492344 GGCCATGCTCTGCTGCTCACTGG - Intronic
1184264016 22:43337182-43337204 AGCCCAGCTCTGCTGCTCACTGG - Intronic
1184358901 22:44001891-44001913 AGAACACTTCTGCTGCTCACAGG - Intronic
1184917688 22:47583289-47583311 AGTCTCCCTCTGTTGCCCACTGG + Intergenic
1185360389 22:50403410-50403432 GGCCCTCCTCTCCTGCTCTCTGG + Intronic
1203227569 22_KI270731v1_random:86877-86899 TATGCTGCTCTGCTGCTCACAGG - Intergenic
949184441 3:1173217-1173239 AGTCCAATTCTGCTGCTAACTGG + Intronic
953802847 3:46040897-46040919 ACTCCTGCTCTGCTTCACACTGG - Intergenic
955038562 3:55292682-55292704 AGTCCTCCTCAACCTCTCACAGG - Intergenic
956875012 3:73454145-73454167 AGGCCTCCTCTCCTGCCCAGGGG - Intronic
964079171 3:152730471-152730493 AGACCTCCTCTGATGCACAAAGG + Intergenic
965638572 3:170809482-170809504 AGTCCAGCTCTGCCGATCACTGG - Intronic
967129687 3:186458987-186459009 AATCCTGCTCTGCTGCTTACTGG - Intergenic
968528071 4:1074593-1074615 AGTCCTCCACTCCTACTCACTGG + Intronic
970855789 4:20648484-20648506 AGTTCTCCTGTGATGCCCACTGG - Intergenic
971505089 4:27357987-27358009 AGACCTACTCTGTTTCTCACTGG - Intergenic
972710111 4:41587286-41587308 ATTCCTCCTCTACTCCTCCCTGG + Intronic
977794983 4:101153955-101153977 TGGCCTTCTCTGCTGCTCTCTGG + Intronic
979547670 4:121955720-121955742 ATCCCACCTCTGCTGCTCACAGG + Intergenic
980877618 4:138677787-138677809 ACTCCTTCTCTGCCACTCACAGG + Intergenic
982546377 4:156738143-156738165 AGTTCTCCACTGTTGATCACAGG - Intergenic
983975013 4:173923067-173923089 TGTCCTCCTGTACTGCCCACGGG + Intergenic
985226214 4:187764341-187764363 AGGCCTCCTGAGCTGGTCACAGG + Intergenic
985226225 4:187764416-187764438 AGGCCTCCTGAGCTGGTCACAGG + Intergenic
985226239 4:187764545-187764567 AGGCCTCCTGAGCTGGTCACAGG + Intergenic
985226249 4:187764620-187764642 AGTCCTCCTGAGCTGGTCACAGG + Intergenic
985226263 4:187764749-187764771 AGGCCTCCTGAGCTGGTCACAGG + Intergenic
985441336 4:189984235-189984257 AGTCCTCGCCCGCAGCTCACGGG + Intergenic
1202763005 4_GL000008v2_random:127689-127711 AGTCCTCCTCGGCTGGTCTATGG + Intergenic
985717932 5:1473095-1473117 AGTGCTCCTCACCTGCTCTCTGG + Intronic
991583907 5:68183404-68183426 TGTTGTCCTCTGCTGCACACTGG + Intergenic
992895191 5:81239523-81239545 AGTCCTCCACTGATGCACATGGG + Intronic
996457345 5:123699833-123699855 AGTCCTCCTCTTCTGGCCCCAGG + Intergenic
996479234 5:123955123-123955145 AAGCTTCCTCTGCTGCTCTCAGG - Intergenic
997665282 5:135625527-135625549 AGTCCTCCTCTTCTACCCAGAGG - Intergenic
998256398 5:140591897-140591919 AGTCTCACTCTACTGCTCACTGG - Intronic
999496501 5:152104116-152104138 ATTTCTCCTCTGCTTCTCCCTGG + Intergenic
1000148315 5:158474699-158474721 AGTCCTCCTCAGCAGCTAAAAGG - Intergenic
1002785848 6:399346-399368 AGTCCTCCTCCTCTACTCCCTGG + Intronic
1003017533 6:2480017-2480039 ACTCCTCCACTCCTGCCCACAGG + Intergenic
1003141597 6:3476143-3476165 AGTCCTCCTGAGCTGCTTGCAGG - Intergenic
1003804487 6:9711702-9711724 ACATCTCCTCTGTTGCTCACAGG + Intronic
1004310685 6:14542347-14542369 AGTCGTCCTCTGGTGCTCAGGGG + Intergenic
1006524940 6:34596239-34596261 AGTCCTTCTCTCATGCTGACGGG - Intronic
1008453905 6:51686041-51686063 ACTCTTTCTCTGCTGATCACTGG + Intronic
1013545405 6:111152028-111152050 GGTCCTGCTCTGCTGGGCACTGG - Intronic
1020245170 7:6424051-6424073 AGCCCTCTTCTGCTCCTGACTGG - Intronic
1022596504 7:31718366-31718388 GGCTCTCCTCTGCTACTCACAGG + Intergenic
1023864350 7:44231828-44231850 AGGCCTGCTCTGCTCCTCAGAGG + Intronic
1030328386 7:108246553-108246575 ATTGATCCTCTGCTGCCCACTGG - Intronic
1030804345 7:113896331-113896353 ACTCCTCCTCTTCAGCTCATGGG + Intronic
1031418387 7:121520258-121520280 CTTACTCCTCTGCTGCTCCCTGG + Intergenic
1033442730 7:141395087-141395109 AGTCCTCCACTGCTGACCCCTGG + Intronic
1033512509 7:142073373-142073395 ATTCCTCCTCTGTCTCTCACTGG - Intronic
1035159845 7:156942761-156942783 AGTCCTCCTCCGCGACTCACTGG - Intergenic
1035991533 8:4496346-4496368 ACTCCTGCGCTGCTGATCACTGG - Intronic
1036086679 8:5620220-5620242 AGTCTTGCTCTGCTGCCCAGTGG + Intergenic
1037780436 8:21864787-21864809 AGTCTTCCTCTGCTGGTTTCTGG - Intergenic
1041489054 8:58411411-58411433 AGACCTCCTCTCCTGCTCGCCGG - Exonic
1049270605 8:141693681-141693703 TCTCCACCTCTGCTGCCCACCGG - Intergenic
1049385690 8:142341884-142341906 AGTCCTCCTGCCCTCCTCACAGG - Intronic
1049447699 8:142638965-142638987 AGCCCTCCTCTCCTGCTGTCTGG - Intergenic
1049808705 8:144553552-144553574 AGTACTCTGCTGCTGCACACTGG + Intronic
1053466335 9:38311389-38311411 TGTCTTCCTCTTCTGCTCAATGG + Intergenic
1056063187 9:82906326-82906348 GGTCCACCTGTGCTGCTGACTGG + Intergenic
1056435110 9:86568545-86568567 AGTCCTCCACTGATGCTACCAGG + Intergenic
1056435336 9:86570322-86570344 AGTCGTCCACAGCAGCTCACTGG + Intergenic
1057233829 9:93342757-93342779 AGGCCTCCTCTTCTGGGCACCGG - Intronic
1057810378 9:98252746-98252768 AGTCCACCTCAGCTGATCTCAGG - Intronic
1057987649 9:99733453-99733475 AGTGATCCTTTGCAGCTCACTGG - Intergenic
1058836870 9:108865101-108865123 AGCCCTCCAGAGCTGCTCACTGG + Intergenic
1060799290 9:126533399-126533421 AGTCTTGCTCTGCAGCTCACGGG + Intergenic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061489331 9:130936550-130936572 CGCCTTCCTCTGCTGCTCCCTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062424773 9:136501004-136501026 AGTCCGCCTGGGCTGCTCAGTGG + Intronic
1203543768 Un_KI270743v1:112570-112592 AGTCCTCCTCGGCTGGTCTATGG + Intergenic
1186779419 X:12898134-12898156 AGCCCGCCTCTCCTGCTCCCTGG - Intergenic
1189260410 X:39674724-39674746 TGTCCTCCTCTGCAGTCCACAGG + Intergenic
1189733785 X:44048949-44048971 AGCCCTCCTCTGCTGTTCACTGG - Intergenic
1191226077 X:58044449-58044471 TGTCCACCTCCTCTGCTCACTGG + Intergenic
1193333858 X:80264509-80264531 CTTCCTCCTCTCCTGCTCAGAGG + Intergenic
1195667903 X:107447495-107447517 GGCCCTCCTCTGCTGCTTTCTGG - Intergenic
1196750096 X:119108252-119108274 ATTCCTACTCTGCTACTTACTGG - Intronic
1200123506 X:153802407-153802429 GGTCTTCCACTGCTGCTCATGGG + Exonic