ID: 1092169352

View in Genome Browser
Species Human (GRCh38)
Location 12:6363568-6363590
Sequence GGTGCGGCAGAGTCCCCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092169343_1092169352 15 Left 1092169343 12:6363530-6363552 CCCGTGAGGCGGGGGCGGGACCC 0: 1
1: 0
2: 0
3: 32
4: 246
Right 1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 120
1092169350_1092169352 -6 Left 1092169350 12:6363551-6363573 CCTCAGGCGCTGCAAGGGGTGCG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 120
1092169342_1092169352 16 Left 1092169342 12:6363529-6363551 CCCCGTGAGGCGGGGGCGGGACC 0: 1
1: 0
2: 0
3: 18
4: 265
Right 1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 120
1092169344_1092169352 14 Left 1092169344 12:6363531-6363553 CCGTGAGGCGGGGGCGGGACCCT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 120
1092169349_1092169352 -5 Left 1092169349 12:6363550-6363572 CCCTCAGGCGCTGCAAGGGGTGC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092169352 Original CRISPR GGTGCGGCAGAGTCCCCCGC AGG Exonic
900666600 1:3819823-3819845 GGAGTGGCAGAGTCTCCTGCTGG + Intronic
901608072 1:10475027-10475049 TGTGCGGCGGAGACCCCGGCTGG + Intronic
906202730 1:43970470-43970492 CGTGGGGCAGAGTGCCCCTCTGG + Intronic
906950749 1:50333160-50333182 GATGCGGCAGCGCCCCCTGCCGG + Intergenic
911565169 1:99455759-99455781 GGTGCAGCAGAGACTCCCGGAGG + Intergenic
923744410 1:236686831-236686853 GGTGGGGCCGGGTCCCCCGCGGG + Intronic
1067890582 10:50131744-50131766 GGTGCTGCAGAGTCACACACTGG + Intronic
1072614904 10:97042934-97042956 TTTGCGGCAGATTCCCCTGCAGG - Exonic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1077008417 11:369632-369654 GGTGCGGCCGCGACCCCCCCAGG - Intergenic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1081995053 11:47358907-47358929 CGAGCGGCAGAGCCCCCCACTGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090839047 11:130473634-130473656 GGTGGGGCAGGGCTCCCCGCAGG - Exonic
1092130936 12:6112752-6112774 GGAGAGGAAGAGTCCCCAGCAGG + Intronic
1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG + Exonic
1092247953 12:6873638-6873660 GCTGCGGCAGAGTCCGCACCCGG + Intronic
1094855014 12:34399013-34399035 GGTGCGGCAGAGCTCCCCAATGG + Intergenic
1097938459 12:65278774-65278796 GGCGCGGGAGGGTCCGCCGCGGG - Exonic
1101272477 12:103162264-103162286 GGTGGTGGAGAGGCCCCCGCAGG - Intronic
1104402411 12:128487174-128487196 GCTATGGCAGAGTGCCCCGCCGG + Intronic
1104792815 12:131494297-131494319 GGTGGGGCAGAGTCCACAGAAGG + Intergenic
1105472454 13:20705074-20705096 GGTGCCGCAGTGTCCTCAGCAGG + Intronic
1108595226 13:51943652-51943674 GGTGAGCCAGAGTGCCCAGCAGG - Intronic
1119469095 14:74882318-74882340 GGCGCGGCGGAGTCCTCCGGCGG + Intronic
1119779997 14:77271064-77271086 GGAGCGGCTGCGGCCCCCGCCGG - Exonic
1121729387 14:96175817-96175839 GGTGCGCCAGAGCCCCCCATGGG + Intergenic
1122447587 14:101781169-101781191 GCTGCGGCAGGGTCCCCACCGGG + Intronic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1124414811 15:29466414-29466436 GGTGCAGCAGTGTCCTCCCCTGG - Intronic
1133277185 16:4646103-4646125 GGTGAGCCAGAGCCCCCCGACGG - Intronic
1135712630 16:24730155-24730177 GCTGCGGCAGAGGCTCGCGCCGG - Intronic
1136146361 16:28318888-28318910 GGTGCAACAGGGTCCCCAGCAGG - Intronic
1136778588 16:32884192-32884214 GGTGGGTCACAGTCCCCTGCTGG + Intergenic
1136892032 16:33977322-33977344 GGTGGGTCACAGTCCCCTGCTGG - Intergenic
1137983112 16:53086338-53086360 GGTGCGGCACAGACCCCAGGAGG - Intronic
1139053889 16:63157839-63157861 GCTGCAACAGAGTCCCCAGCCGG + Intergenic
1142762475 17:2050396-2050418 GGAGCAGCAGAGCCCCCAGCCGG - Intergenic
1147241935 17:39096216-39096238 CGTGGGGCAGGGTCCCCTGCTGG - Intronic
1149659051 17:58324882-58324904 GGAGCGGGAGCGTCTCCCGCTGG + Exonic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152587171 17:81194288-81194310 GGTGGGGAAGAGACCCCCACAGG + Intronic
1152654747 17:81514442-81514464 GGAGGGGCAGGGTCCCCGGCCGG - Intronic
1152726722 17:81950691-81950713 TGTGCCGCAGAGCCCTCCGCAGG + Intergenic
1152805114 17:82352066-82352088 GGTGCGGCAGAGCAGCCCGGAGG - Intergenic
1153174120 18:2351445-2351467 AGCGCGGAAGGGTCCCCCGCGGG + Intergenic
1157712208 18:49857874-49857896 GGTGCGGCAGAGTCCTGCTGGGG - Intronic
1160702186 19:512952-512974 GAGGCGGCCCAGTCCCCCGCAGG - Intronic
1161003197 19:1921441-1921463 GGTGCAGCAGGGGCCCCCGGTGG + Intronic
1161047761 19:2145408-2145430 GGAGGGGCAGAGTCACCTGCTGG - Intronic
1162524635 19:11200360-11200382 GGGGCTGCAGAGCCTCCCGCAGG + Exonic
1163085890 19:14979618-14979640 GGTGCTGCACAGTCCCTGGCGGG - Intronic
1163737468 19:18990273-18990295 GGTCAGGCAGAGGCCCCTGCAGG + Intergenic
1164679052 19:30121887-30121909 GGTGGGGCAGAGATCCCCACAGG - Intergenic
1166233268 19:41438335-41438357 GGTGCGGCAGTGGCCCCAGAGGG - Exonic
1167043630 19:47037592-47037614 GGTGCTGCAGATTACCCTGCCGG + Intronic
1167619056 19:50551255-50551277 GGGGAGGCAGAGACCCCGGCTGG - Intronic
1167935588 19:52904262-52904284 GGCTGGCCAGAGTCCCCCGCGGG + Intergenic
925273867 2:2635431-2635453 GGAGCAGCAGAGTCACCTGCTGG - Intergenic
926690049 2:15726782-15726804 GGTGAGGCAGAGCCCCTCTCTGG + Intronic
927496670 2:23555798-23555820 GGTGGGGCAGAGGCCAGCGCTGG - Intronic
930704492 2:54490800-54490822 GGTGTGGGAGAGTCCCACGCAGG + Intronic
932268141 2:70386137-70386159 GGTGGGGCAGCGCCCCCCTCCGG - Intergenic
934578936 2:95422847-95422869 GGTGGGGAAGAGTCTCCCACAGG - Intergenic
934600511 2:95653856-95653878 GGTGGGGAAGAGTCTCCCACAGG + Intergenic
1172165155 20:32894296-32894318 GTTGGGGCAGCGTCCCCTGCTGG + Intronic
1172189041 20:33050470-33050492 GGTGTGTCAGAGTCCCCTGTTGG + Intergenic
1176159458 20:63641076-63641098 GGCGCGGCTGGGTCCCCCGGGGG - Exonic
1176867646 21:14062972-14062994 GGGGCTGCAGTGCCCCCCGCAGG + Intergenic
1177355394 21:19999611-19999633 GGCTGGGCTGAGTCCCCCGCAGG + Intergenic
1178534884 21:33403308-33403330 GGAGCGGGAAAGTCCCGCGCGGG + Exonic
1181778966 22:25179047-25179069 GGCGCGGCTGGGTCCCCCGGGGG - Intronic
1182501549 22:30751737-30751759 GATGGGGCAGAATCACCCGCAGG + Intronic
1183230153 22:36577077-36577099 GGGGCAGCAGAGGCCCCCGGGGG - Intronic
1184787463 22:46678795-46678817 GGGGCCGCAGAGTCACACGCTGG + Exonic
1185285284 22:49997230-49997252 GGTGGGGCAGAGACCACCACAGG + Intronic
1185332116 22:50256548-50256570 GGTGGGGCAGGGGCCCCCTCTGG - Intronic
950032589 3:9862503-9862525 AGTGCGGCTGCGTCCCCTGCGGG - Intergenic
950053912 3:10010856-10010878 AGTGCGGCCGCGTCCCCTGCGGG - Intronic
950415836 3:12868763-12868785 AGTGCGGCCGCGTCCCCTGCGGG - Intronic
950417286 3:12875882-12875904 AGTGCGGCCGCGTCCCCTGCAGG - Intergenic
951453722 3:22867717-22867739 GGTGCAGCAGAGTCACCCGGAGG + Intergenic
952816471 3:37452033-37452055 GGCGCGGCAGCGCCCCCTGCGGG - Intergenic
956166567 3:66402101-66402123 GGAGGGGCAGAGTCCCACACAGG - Intronic
961736276 3:129003890-129003912 GCTGCGGCGGAGGCCCGCGCTGG + Exonic
961820706 3:129574371-129574393 TGGGCTGCAGAGGCCCCCGCAGG + Exonic
962462878 3:135630867-135630889 GGTGTCCCAGAGGCCCCCGCAGG - Intergenic
968080954 3:195846820-195846842 GGGGAGGCAGAGTCACCCACTGG - Intergenic
971027163 4:22599813-22599835 GGCTGGTCAGAGTCCCCCGCAGG - Intergenic
972076875 4:35101099-35101121 GGCGGGCCAGAGTCCCCTGCAGG - Intergenic
972216727 4:36906276-36906298 GGCTAGTCAGAGTCCCCCGCAGG - Intergenic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
985928657 5:3037174-3037196 GGGGCTGCAGAGTCCCCTGAGGG + Intergenic
990347306 5:54883598-54883620 CGTGCGGCAGAGTAACTCGCCGG + Intergenic
998343763 5:141442126-141442148 GGTCTGGCAGAGTCTCCTGCAGG - Intronic
1001492408 5:172165053-172165075 GGTGAAGCAGTGTCCCCGGCTGG - Intronic
1007071411 6:39040951-39040973 GCTGCCTCAGAGTCCCCCCCAGG - Intergenic
1019392155 7:794705-794727 GATGCGGAAGGGTTCCCCGCAGG + Intergenic
1019400291 7:848157-848179 GGTGCTGCAGAGTAACCCCCAGG - Intronic
1019511500 7:1419829-1419851 GGAGCGGCAGAGTCCAGAGCTGG + Intergenic
1019709658 7:2512420-2512442 GGTGGGGCAGAGTCTCTCTCAGG - Intergenic
1019716986 7:2543660-2543682 GGTGCGGCTGAGTCCCCGCGTGG - Exonic
1024300764 7:47885808-47885830 AGGACTGCAGAGTCCCCCGCAGG + Exonic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1029286306 7:99468466-99468488 GCTGGGGCAGAGGGCCCCGCAGG + Intergenic
1032306256 7:130734257-130734279 GGGGCGGCAGAGACCCGCCCCGG + Intergenic
1034674707 7:152884105-152884127 GGTGCAGGAGAGGCACCCGCAGG + Intergenic
1035638050 8:1161951-1161973 GGTGCGTCAGAGTCACCTGAGGG + Intergenic
1036132622 8:6130204-6130226 GGTGTGTCAGAGTCCCCTGGAGG - Intergenic
1036132630 8:6130266-6130288 GGTGTGTCAGAGTCCCCTGGAGG - Intergenic
1049631100 8:143658072-143658094 GGTGCTGGAGAGTCCCCACCAGG - Intergenic
1051344546 9:16140295-16140317 GGTGCTACAGAGTCCCCCTGGGG + Intergenic
1055453012 9:76447660-76447682 AGTGTGGCAGAGGCCCCCTCTGG - Intronic
1056756102 9:89382950-89382972 GCTGGGGCTGAGTCTCCCGCAGG - Intronic
1061767734 9:132892494-132892516 GGTGGGGCAGAGCCCCCTGGGGG + Exonic
1061991287 9:134160070-134160092 GGTGAGCCAGGGTGCCCCGCAGG + Intergenic
1062097040 9:134708860-134708882 CGGCAGGCAGAGTCCCCCGCTGG - Intronic
1062341321 9:136095021-136095043 GGTGCGGCCGAGTTCCGCGCCGG - Intronic
1062424940 9:136501844-136501866 GGTGCTGCTGAGTCCACTGCCGG + Exonic
1191638947 X:63409591-63409613 GGCTGGTCAGAGTCCCCCGCAGG - Intergenic
1192292847 X:69815629-69815651 GGTGTGGCTGAAGCCCCCGCAGG - Intronic
1196741293 X:119028445-119028467 GGTGCTGCAAAGTCCCGCGGCGG - Intergenic
1197660813 X:129169259-129169281 GGTGTGTCAGAATCCCCCGGAGG - Intergenic
1198328130 X:135595198-135595220 CGTGAGGAAGAGTCCCCTGCAGG + Intergenic
1200101233 X:153689864-153689886 GGTGGGTCACAGTCCCCTGCTGG - Intronic
1200942817 Y:8803549-8803571 AGTGGGCCAGAGTCCCCCACAGG - Intergenic