ID: 1092170928

View in Genome Browser
Species Human (GRCh38)
Location 12:6373776-6373798
Sequence CAGAACAAGGAGAATGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092170928_1092170934 3 Left 1092170928 12:6373776-6373798 CCTGACCCATTCTCCTTGTTCTG 0: 1
1: 0
2: 3
3: 20
4: 302
Right 1092170934 12:6373802-6373824 GGCCCCTGCCCCCAGCCTTTGGG 0: 1
1: 0
2: 13
3: 45
4: 547
1092170928_1092170933 2 Left 1092170928 12:6373776-6373798 CCTGACCCATTCTCCTTGTTCTG 0: 1
1: 0
2: 3
3: 20
4: 302
Right 1092170933 12:6373801-6373823 AGGCCCCTGCCCCCAGCCTTTGG 0: 1
1: 0
2: 5
3: 83
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092170928 Original CRISPR CAGAACAAGGAGAATGGGTC AGG (reversed) Intronic
900830441 1:4961488-4961510 CAGGACAAGGAGCATGAGCCAGG + Intergenic
901885635 1:12220988-12221010 CAGAACAAGGAGCATGTGATTGG - Intergenic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
904115718 1:28160467-28160489 CTGAGGAAGGAGGATGGGTCAGG + Intronic
904420278 1:30386689-30386711 CAGAACAAGGAAGATGGGGGAGG + Intergenic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
906745905 1:48222028-48222050 CAGAATAGGAAGTATGGGTCAGG + Intergenic
907166819 1:52419371-52419393 AAGAAGAAGAAGAATGGGTTTGG + Exonic
908787481 1:67749545-67749567 CAGTACCAGGAGGAAGGGTCTGG + Intronic
909182207 1:72439169-72439191 CAGAACAGAGAGAAAGGCTCTGG - Intergenic
911313388 1:96325725-96325747 CAGAAAAAGGAGAATGGATGGGG - Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
913184828 1:116360863-116360885 GAGAACAAAGAGAATAGGACGGG + Intergenic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916740045 1:167639787-167639809 TAAAACAATGAGAATGGGCCGGG - Intronic
917816319 1:178713373-178713395 CAAAAAAAGGCCAATGGGTCTGG + Intergenic
922029829 1:221787215-221787237 AAGAAAAAAGAGAATGGGACTGG + Intergenic
922246024 1:223798428-223798450 TAGAACCTGGAGAAAGGGTCTGG + Exonic
923040703 1:230318062-230318084 CAGAGCTAGGAGAATGTGCCTGG + Intergenic
1062858183 10:789995-790017 GCGAACAAGGAGCATGGGGCTGG - Intergenic
1064820029 10:19318646-19318668 CAGAACAAGGCTAATAGATCTGG - Intronic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1070299587 10:75193522-75193544 CAAAAAAAGGAGAATGTGTTTGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1070911838 10:80125723-80125745 CAGAACGGGGAGGATGGGTGGGG + Intergenic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1072407854 10:95171146-95171168 CAGAACAAGGAGGAAGAATCAGG + Intergenic
1072456907 10:95584454-95584476 TAGAACAAGGAGTATGGGCCAGG - Intergenic
1072988264 10:100163746-100163768 AAGAACAGGGAGAATGGATAGGG - Intronic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1075002927 10:118811062-118811084 CGGGACCAGGAGAATGGGGCAGG - Intergenic
1078532844 11:12150332-12150354 CAGAACAGGGAGATTGGCCCAGG + Intronic
1079279952 11:19078098-19078120 CAGCACAAGAGGAATGGGTCAGG + Intergenic
1079408555 11:20165615-20165637 CAGGACAAGGGGAGTGGGCCAGG - Intergenic
1080644533 11:34178643-34178665 CAGAGCCAGGAGACCGGGTCGGG + Intronic
1080893856 11:36432713-36432735 CAGAAAAAAAAGAAAGGGTCCGG - Intronic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG + Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1088709157 11:112491175-112491197 CAGAAGAGGGGGAATGGGTAGGG + Intergenic
1089487905 11:118861359-118861381 CAAAACAAGAGGATTGGGTCAGG - Intergenic
1090466445 11:126938924-126938946 CAGAACAAGTAGGATGAGACAGG + Intronic
1090583241 11:128182376-128182398 CAGAACCATGAAAGTGGGTCAGG + Intergenic
1091485714 12:885691-885713 CAGGACAATGAGTATGGGGCTGG - Exonic
1092017296 12:5170001-5170023 CAGAACATCGTGATTGGGTCTGG + Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1095054384 12:37582265-37582287 GGGAACATGGAGAATGTGTCAGG + Intergenic
1096052650 12:48624597-48624619 CAGAACAAGGACCAAGGGTGTGG - Intergenic
1096617488 12:52842146-52842168 AAGAACCAGGAGGATGGTTCTGG + Intronic
1096755408 12:53795434-53795456 CAGAGCAGGGAGAATTGGTTTGG - Intergenic
1099231436 12:80030173-80030195 CAGAACAAGGAGGCTGGGCAGGG - Intergenic
1100045859 12:90379941-90379963 CAGAACAAGTTGAAAGTGTCAGG + Intergenic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1102815103 12:115859077-115859099 CAGCACAGGGAGTGTGGGTCGGG + Intergenic
1102959684 12:117084646-117084668 CAGAACAGGGAGGATGGGAGGGG + Intronic
1104402421 12:128487240-128487262 TAGAACAAGGAGGATGGGTGAGG - Intronic
1104695176 12:130858049-130858071 CTGAAGATGGAGGATGGGTCAGG - Intergenic
1106431562 13:29685510-29685532 TAGTGCAAGGAGAATGTGTCCGG + Intergenic
1107088957 13:36455281-36455303 CAGAACAAGAAGAAAATGTCAGG + Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1112320497 13:98402707-98402729 CAGAAACAGGAGTATGGGTAAGG - Intronic
1113878438 13:113608853-113608875 TAGAAAAAGGCGAGTGGGTCTGG - Intronic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114572924 14:23687172-23687194 CAGAGAGAGGAGAATGGATCTGG + Intergenic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1116613045 14:47102693-47102715 AAGAACAAGGAGCCTGGCTCAGG + Intronic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1116859164 14:49979817-49979839 CAGTTCAAGGAGACAGGGTCTGG - Intergenic
1117348582 14:54858686-54858708 AAGAACAAGATGAAGGGGTCGGG - Intronic
1119480111 14:74953675-74953697 CAGCACACGGAGAGTGGGGCTGG - Intronic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1119843530 14:77811085-77811107 GAGAGCAAGGAGAAAGGGTAGGG + Intronic
1121494364 14:94381725-94381747 CAGAAGGAGGAGACTGGGGCTGG + Intronic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1125719709 15:41839427-41839449 CAGAACCAGGGGCATGGGTTTGG + Intronic
1127089418 15:55451948-55451970 CAAAAGAAGGAAAATAGGTCTGG + Intronic
1128802743 15:70507275-70507297 CAGACCAAGGAGGATGGTGCTGG - Intergenic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1132222518 15:100115557-100115579 CAGCTCAAAGAGGATGGGTCAGG + Intronic
1132278948 15:100595930-100595952 CAGAAAAAATAAAATGGGTCTGG + Intronic
1135741041 16:24975478-24975500 CAGAACCAGTAGGCTGGGTCTGG + Intronic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137783740 16:51120097-51120119 CAGAACAAAGAGAATGTCTGCGG - Intergenic
1138198512 16:55071925-55071947 CAGTACAAGGACACTGGGCCTGG + Intergenic
1139762925 16:69201985-69202007 GTAAACAAGGAGAATGAGTCAGG - Intronic
1140033266 16:71355101-71355123 CTGGACAAGGAGCTTGGGTCTGG + Intergenic
1140564220 16:76022303-76022325 CAGATCAAGTTGGATGGGTCAGG + Intergenic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1145374924 17:22338328-22338350 GGGAACATGGAGAATGTGTCAGG + Intergenic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150124692 17:62628321-62628343 CAGAGCGAGGAGACTGGGCCCGG - Intronic
1151022000 17:70627756-70627778 CAGCACAACTTGAATGGGTCTGG + Intergenic
1153419431 18:4887370-4887392 CAGAACTATGATAATGGCTCTGG - Intergenic
1153720128 18:7893394-7893416 TAGAACAAGTAGAATGGGAAAGG - Intronic
1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG + Intronic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156487487 18:37475769-37475791 GAGAACAGGGAAAATGTGTCTGG - Intronic
1156573629 18:38286685-38286707 CAAAGCAAGGAGAATAGGTAAGG - Intergenic
1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG + Intergenic
1158605797 18:58895033-58895055 GAAAAGAAGGAGAATGGCTCAGG - Intronic
1158731162 18:60023961-60023983 CAGAGTAAGTAGGATGGGTCAGG + Intergenic
1159437377 18:68436440-68436462 CACACTAAGGAGAAAGGGTCTGG + Intergenic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161485146 19:4531548-4531570 TAGACCAAGGAGGATGGGACAGG + Intronic
1162028026 19:7905141-7905163 CACAAAAAGGATCATGGGTCAGG - Intronic
1163580705 19:18137115-18137137 CAGAACCAGAAAAATGGGCCGGG - Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164148742 19:22530559-22530581 GAGAAGCGGGAGAATGGGTCTGG - Intronic
1164709451 19:30344846-30344868 AAGAACTAGGAGCCTGGGTCTGG - Intronic
1165009300 19:32832289-32832311 CAAAACAAAGAAAATGGGCCGGG + Intronic
1165391535 19:35541985-35542007 CAGCATATGGAGAAAGGGTCTGG + Intronic
1165572985 19:36791281-36791303 AGGAACATGGAGAATGTGTCAGG - Intergenic
1165632305 19:37312287-37312309 GGGAACATGGAGAATGTGTCAGG - Intergenic
1165811208 19:38612956-38612978 CTGAGCAAGGAGAATGGCTTAGG + Intronic
1167345146 19:48940842-48940864 CACAAAAAGGAGACAGGGTCTGG - Intronic
1167999636 19:53434509-53434531 GAGAAACAGGAGAATGGGTTTGG + Intronic
1168004002 19:53471334-53471356 GAGAAACAGGAGAATGGGTTTGG + Intronic
925934207 2:8738020-8738042 CAGAGCAAGGAGACTGGTTGAGG - Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
927070766 2:19526975-19526997 TAGAATAGGGAGAATGGGCCAGG + Intergenic
927868466 2:26608250-26608272 AAAAAAAAGGAGAGTGGGTCTGG + Intronic
927946445 2:27137770-27137792 CAGTACAGGGACACTGGGTCCGG - Exonic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
930280784 2:49367440-49367462 CAGAACAAGAAGACAGGCTCAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
932176241 2:69605385-69605407 CAGAGCAAGGAGAATGGTTAGGG - Intronic
932299216 2:70653935-70653957 AAGAAGCAGGAGAATGGTTCAGG - Intronic
936896064 2:117428984-117429006 CATAACAAAGAGAATGGTTAAGG + Intergenic
937250876 2:120522914-120522936 AAGAACAAGCAGCATGGGGCTGG + Intergenic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
939881434 2:147635760-147635782 AAGTACAAGGTGAATGTGTCAGG - Intergenic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
942735896 2:179112161-179112183 CAGTACAAAGGGAATGGGTTTGG + Intronic
942787477 2:179716379-179716401 CAGAAAATGGAAAATAGGTCAGG - Intronic
944023536 2:195136129-195136151 CAGACCAAGAAGTATGGCTCTGG - Intergenic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
945621953 2:212150687-212150709 AAGCACAAGAAGAATGAGTCTGG - Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948029046 2:234801351-234801373 CAGAGCAGGGAGGATGGGTCTGG + Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948212857 2:236207876-236207898 CAGCAGAAGGACATTGGGTCTGG + Intronic
1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1170118199 20:12884192-12884214 GACTACAAGGAGAATGTGTCAGG - Intergenic
1170156078 20:13270664-13270686 TAGATCAAGGAGAAAGGATCTGG - Exonic
1171322354 20:24257628-24257650 CAGAGGAGGGAGAATAGGTCAGG + Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174293083 20:49522727-49522749 CAGATTAAAGAAAATGGGTCGGG + Intronic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1175168937 20:57066454-57066476 CTTAACAAGGAGAAAGGGTTTGG - Intergenic
1176936481 21:14873808-14873830 CAAAACAAGGTCAATGGGTCAGG - Intergenic
1177706632 21:24714482-24714504 CAGGACAAGGTGCATGGGTTAGG - Intergenic
1178275922 21:31236859-31236881 AAGAACAGGGAGAATGGCTTGGG + Intronic
1178391325 21:32200784-32200806 CAGAATAAGGAGCATGGTTGAGG - Intergenic
1179281742 21:39939616-39939638 CAGCACCAGGAGAATTGGACAGG - Intergenic
1179678223 21:42999276-42999298 CAGAACAAGGACCCTGGGCCTGG + Intronic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1182463079 22:30495824-30495846 AAGAAACAGGAGAATGGGACAGG + Intronic
1182744390 22:32594459-32594481 CAAAACAAAAGGAATGGGTCAGG - Intronic
1183608843 22:38883892-38883914 CAGAACTGGCAGAATGGGGCTGG - Intergenic
1184053850 22:42030831-42030853 GAGAACAGGGTGAATGGGTGAGG + Intronic
1184607884 22:45584749-45584771 CAGATCAAGGATGATGGGACAGG + Intronic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
949479916 3:4483965-4483987 CAGAAAAAGCAAAATGGGCCTGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
954103687 3:48397821-48397843 AAGAACAAGGAGACTGGGGTGGG + Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
958547483 3:95572893-95572915 CTGAACAACAAGAATGGGTTTGG + Intergenic
959678162 3:109060850-109060872 CAGAAAAAGACTAATGGGTCAGG - Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961131779 3:124475167-124475189 CACATCATGGAGAATGGGTGGGG + Intronic
961502730 3:127349587-127349609 CTGGAAAAGGAGACTGGGTCTGG + Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
963589254 3:147235980-147236002 CAGAACTTGGTGAATGGGTGGGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967718576 3:192790727-192790749 CAATATAAGGAGACTGGGTCTGG + Intergenic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
969909796 4:10433319-10433341 CAGAACAAGGAAGATAGGGCAGG - Intergenic
970162601 4:13204496-13204518 CAGAGCCTGGAGACTGGGTCTGG - Intergenic
972590687 4:40483373-40483395 CAGAACAACAAGAAAGGGGCGGG + Intronic
974669789 4:65014682-65014704 CTGAACAACTAGAATGGGCCAGG + Intergenic
974846771 4:67360960-67360982 TAGAACAAAGAAAATGGGTGGGG - Intergenic
977843993 4:101745001-101745023 CAGAACAAAGACACTGAGTCCGG - Intronic
979737435 4:124104722-124104744 CAGGAAAAGTAGAATGGCTCAGG + Intergenic
982270369 4:153579769-153579791 CAGAAAAAAAAGAATAGGTCAGG - Intronic
984883275 4:184428964-184428986 CTTAACAAGGTGAGTGGGTCAGG - Exonic
985178833 4:187233855-187233877 CTGAAGAAGGAGATTAGGTCAGG + Intergenic
987774401 5:22345805-22345827 GTCAAAAAGGAGAATGGGTCCGG + Intronic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
990861539 5:60333087-60333109 CTGAACAAGGAGAATATATCAGG - Intronic
991423149 5:66462232-66462254 CAGAAAAAGGAGAATAGAGCTGG - Intergenic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
992117275 5:73551641-73551663 CAGACCACAGAGAATGTGTCAGG - Intergenic
992203964 5:74411872-74411894 AAGCATAAGGAGATTGGGTCAGG + Intergenic
993905427 5:93618364-93618386 TAGAACAAGTAGAATGGGAAAGG - Exonic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994607523 5:101988133-101988155 CAGAACAGGAAGAATGCTTCAGG - Intergenic
995133232 5:108652815-108652837 TAAAAGAAGTAGAATGGGTCAGG - Intergenic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
998285032 5:140850814-140850836 CAGCACAAGGAGAAAGGCCCGGG - Exonic
998307059 5:141088995-141089017 CAGTAGAAGGAGACTAGGTCTGG + Intergenic
999706340 5:154275774-154275796 GAGAACAAGGAAAATGTGCCTGG + Intronic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1001654023 5:173335758-173335780 ATGAACCAGGAGAATGGGTGAGG + Intergenic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002907500 6:1462725-1462747 CAGGACTAAGAGAATGGTTCAGG + Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004514553 6:16311321-16311343 CAGAAAAAAGAAAATGGGTTTGG - Intronic
1004728252 6:18332025-18332047 CAGAACGGGGAGAATGGGTGAGG + Intergenic
1005265838 6:24111353-24111375 CAGAACAAAGACATTAGGTCAGG - Intergenic
1005765265 6:29005267-29005289 AAGAATAAAAAGAATGGGTCAGG + Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007151826 6:39701205-39701227 CAGGACAAAGAGATTGGCTCTGG + Intronic
1007341845 6:41195606-41195628 CAGAACAAGCAGCATTGGTGAGG + Intronic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1007908687 6:45490601-45490623 CAGAACAAGAGGAATGTATCAGG - Intronic
1009405922 6:63312744-63312766 CTGAACTAGGAGAATAGCTCTGG + Intronic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015337633 6:132058847-132058869 CACAGAAAGCAGAATGGGTCTGG + Intergenic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1017593814 6:156007096-156007118 CAGGACCAGGAAAATGGGTTGGG - Intergenic
1017598306 6:156053847-156053869 TAGGACAAGGTGAAAGGGTCAGG + Intergenic
1019296598 7:280101-280123 CAGAGCATGTAGGATGGGTCAGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020384726 7:7587314-7587336 CAAAACAAGGATACTGGGGCAGG - Intronic
1020755085 7:12191377-12191399 CAGCACAAGGATCCTGGGTCTGG + Intergenic
1021962981 7:25891173-25891195 AAGGACAAGGAGAATGGCTGGGG - Intergenic
1022790735 7:33686557-33686579 TAGAAACAGGAGAATGGGCCTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023494408 7:40779031-40779053 CAGATCAGGCAGAATGGCTCAGG + Intronic
1024194255 7:47043291-47043313 CAGAACTAGGAGAATTGCTCAGG - Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1026763134 7:73141589-73141611 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1026828137 7:73596560-73596582 AAGAAGAAGGGGACTGGGTCTGG - Intronic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027039599 7:74951371-74951393 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1027084043 7:75251013-75251035 CAGAAAAAGGAAATTGGGCCAGG - Intergenic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1028120276 7:87049747-87049769 AAGAACAAGTAGACTGGGACTGG + Intronic
1028746829 7:94336895-94336917 GAGAACAAGGAGAATGTAGCAGG - Intergenic
1029391616 7:100278779-100278801 CAGAAAAAGGAAATTGGGCCGGG - Intergenic
1030391512 7:108933897-108933919 AAGAACAAGCAGAGTGGGCCGGG + Intergenic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034336114 7:150324621-150324643 CAGAGAAAGTAGGATGGGTCTGG - Intronic
1035105855 7:156441066-156441088 ATGAAGCAGGAGAATGGGTCTGG - Intergenic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1035613962 8:988800-988822 CAGAAAAAGCAGGATTGGTCAGG - Intergenic
1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG + Intronic
1039245723 8:35606279-35606301 CAAAAAAAGGAAACTGGGTCAGG - Intronic
1043064666 8:75553338-75553360 TAGAACAAGGTGAATGGGTAAGG - Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043457799 8:80429585-80429607 CAAAATAAGTAGAATGGGTGGGG + Intergenic
1043608203 8:82028554-82028576 CAGAACAAGGCCAATGTGTTAGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044580813 8:93824479-93824501 CAGAATAAGAGGAATGGGTTTGG - Intergenic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1047066589 8:121291278-121291300 CAAAACAACGAGAATAGATCGGG - Intergenic
1047861697 8:128974180-128974202 CAGAACAGGGAAACTGAGTCTGG - Intergenic
1050406942 9:5319352-5319374 AAGAACAAGACGAATGGCTCAGG + Intergenic
1050413851 9:5394311-5394333 AAGAACAAGGTAAATGGCTCAGG + Intronic
1052081933 9:24216894-24216916 GTGAGTAAGGAGAATGGGTCAGG + Intergenic
1052414268 9:28157401-28157423 CAGCACAAGGACACTGGGCCTGG + Intronic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1053795839 9:41726230-41726252 GGGAACATGGAGAATGTGTCAGG - Intergenic
1054149341 9:61588643-61588665 GGGAACATGGAGAATGTGTCAGG + Intergenic
1054184246 9:61938301-61938323 GGGAACATGGAGAATGTGTCAGG - Intergenic
1054469101 9:65519754-65519776 GGGAACATGGAGAATGTGTCAGG + Intergenic
1054654260 9:67650194-67650216 GGGAACATGGAGAATGTGTCAGG + Intergenic
1055492709 9:76822510-76822532 GAGAAAAAGAAGAATAGGTCGGG + Intronic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056811108 9:89764522-89764544 CATAACAAGGAGAGTGAGACAGG - Intergenic
1057303784 9:93901146-93901168 CAGAACAAGGTTGGTGGGTCAGG - Intergenic
1059067117 9:111096997-111097019 GAGAAAAAGGAGAGTGGGTAAGG + Intergenic
1060502308 9:124169796-124169818 CAGAACAAGGAGTATTGCTGTGG - Intergenic
1062271820 9:135713355-135713377 CAGAACAAGGAGCAGGGTTTGGG + Intronic
1062624818 9:137438002-137438024 GCGAACAAGGAGAATGGCACGGG - Exonic
1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG + Intergenic
1185526557 X:784874-784896 CAGAGGAAGCTGAATGGGTCAGG - Intergenic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186490120 X:9965110-9965132 AAGAAATAGGAGATTGGGTCAGG + Intergenic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1197272470 X:124440158-124440180 CAGAGCCAGGAGACTAGGTCTGG + Intronic
1198023681 X:132683779-132683801 CAGAGCAAGTAGCATGGGCCAGG + Intronic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199990776 X:152986551-152986573 CAGAGCAAGGAGACTTTGTCGGG - Intergenic
1200033865 X:153316025-153316047 CAGAGCAAGGAGACTTTGTCGGG - Intergenic
1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1202247425 Y:22834108-22834130 CATCACAAGGCGAATGGGTGGGG + Intergenic
1202400413 Y:24467856-24467878 CATCACAAGGCGAATGGGTGGGG + Intergenic
1202470367 Y:25202230-25202252 CATCACAAGGCGAATGGGTGGGG - Intergenic