ID: 1092171099

View in Genome Browser
Species Human (GRCh38)
Location 12:6374609-6374631
Sequence AGAGCTCTCGGTAGGAGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092171092_1092171099 25 Left 1092171092 12:6374561-6374583 CCAGGCGGATGGCGCCGTGGATG 0: 2
1: 0
2: 0
3: 6
4: 74
Right 1092171099 12:6374609-6374631 AGAGCTCTCGGTAGGAGCGGTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1092171095_1092171099 11 Left 1092171095 12:6374575-6374597 CCGTGGATGGTGGTGTTGTTGCA 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1092171099 12:6374609-6374631 AGAGCTCTCGGTAGGAGCGGTGG 0: 1
1: 0
2: 0
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092171099 Original CRISPR AGAGCTCTCGGTAGGAGCGG TGG Exonic
900652852 1:3739086-3739108 AGAGCTCTCGATAGGAGTCCTGG + Intergenic
901376560 1:8843792-8843814 AGTCCTCTCGGTTGGAGCTGTGG - Intergenic
903223360 1:21881122-21881144 AGGGCTCCCGGGAGGAGGGGAGG + Intronic
904562969 1:31411102-31411124 TGTGCTCTGGGTAGGAGAGGGGG + Intronic
907326290 1:53640636-53640658 AGGGCTCTGGGGAGGAGTGGAGG - Intronic
907588675 1:55645188-55645210 ATAGCTCTTGGAAGGAGCTGGGG + Intergenic
912631493 1:111250121-111250143 AGAGCTCTCTGTAGGATCAAGGG - Intergenic
920651145 1:207838370-207838392 AGAGCCCTGGGAAGGAGTGGTGG - Intergenic
922191164 1:223319851-223319873 AGAACTATTGGTAGGAGGGGTGG + Intronic
1077243702 11:1525408-1525430 AGACTTCTTGGTAGGAGTGGTGG - Intergenic
1081742308 11:45449198-45449220 AGAGCTCTCGGAAGCAGCACTGG - Intergenic
1083668685 11:64288712-64288734 AGAGCACCAGGTAGGAGCCGTGG + Exonic
1085880677 11:80463485-80463507 AGAGCTCCCAGTAAGAGGGGTGG + Intergenic
1086839560 11:91667790-91667812 AGAGCTCACAGTAGGAGGGGCGG + Intergenic
1087374807 11:97327087-97327109 AGAGCTCCCAGTGGGAGGGGTGG - Intergenic
1088196377 11:107278392-107278414 AGAGGTCTCGGTAGGGTAGGGGG + Intergenic
1088729829 11:112670981-112671003 AGAGCTCCCAGTGGGAGGGGCGG + Intergenic
1089668162 11:120033330-120033352 GGAGGTCTTGGTAGGAGCGTGGG - Intergenic
1091273073 11:134331790-134331812 CGAGGTCTCGGTAGGAGAGGGGG - Intergenic
1091719842 12:2804622-2804644 AGAGCTCACAGTAGGAGAGAGGG - Exonic
1092171099 12:6374609-6374631 AGAGCTCTCGGTAGGAGCGGTGG + Exonic
1093388095 12:18583480-18583502 AGAGCTCCCAGTGGGAGGGGTGG + Intronic
1093674756 12:21925596-21925618 AGAGCTCTTGTGAGGAGCTGCGG - Intronic
1101872729 12:108579102-108579124 AGAGGTCTTGGTAGTAGGGGTGG - Intergenic
1104890377 12:132136628-132136650 AGAGCTCTCCGTTGCAGAGGGGG + Exonic
1110098235 13:71559833-71559855 AGAGCTCTCAGTCCGAGCAGGGG + Exonic
1116028031 14:39537647-39537669 AGAGCTCCCAGTGGGAGGGGCGG + Intergenic
1117791930 14:59350601-59350623 AGAGCTCTAGGGAGGGGAGGAGG - Intronic
1117820686 14:59645571-59645593 AGAGCTCCCAGTGGGAGGGGTGG + Intronic
1117956667 14:61128541-61128563 AGAGCTTTAGGTAGGAAAGGGGG - Intergenic
1119472373 14:74908049-74908071 AGAGCTCTGGGCTGGAGAGGTGG + Intronic
1126090700 15:45048761-45048783 AAAGCTCTCAGCAGCAGCGGGGG + Intronic
1127331004 15:57940165-57940187 AGAGCTCTCAGGGGGAGAGGTGG - Intergenic
1127571862 15:60251424-60251446 AGAGCTCACAGTAGTAGAGGTGG - Intergenic
1129454637 15:75670158-75670180 AGAGGTCTGGGTAGGATGGGTGG + Intergenic
1131661838 15:94525533-94525555 AGAGATCTAAGTAGGAGAGGGGG - Intergenic
1132261944 15:100433568-100433590 AGAGCTCTCTGTAGGGTTGGTGG + Intronic
1132560020 16:589371-589393 AGAACCCTCGGAGGGAGCGGCGG - Exonic
1132958355 16:2608612-2608634 AGAGCTCTGGGTGGCAGCAGGGG - Intergenic
1132970967 16:2688708-2688730 AGAGCTCTGGGTGGCAGCAGGGG - Intronic
1133023370 16:2976669-2976691 AGACCTCTCCGTAGGAGCCATGG + Exonic
1135091477 16:19521660-19521682 CGAGCTCTCGGGAGGACCGAGGG + Intronic
1136544262 16:30947119-30947141 AGAGCTGGCGGCAGGAGCGCAGG - Exonic
1147244652 17:39111916-39111938 AGAGCTCTGGGCAGAAGCAGTGG - Intronic
1147458045 17:40550791-40550813 AGAGCTCTGGTTAGGAGCCCAGG + Intergenic
1152096213 17:78273176-78273198 TGAGCTCTCGGCAGGAGTTGGGG - Intergenic
1156985883 18:43351157-43351179 AGAGCTCTCTGTAGAAGAGAGGG + Intergenic
1157188865 18:45563315-45563337 GGAGCTCTCTGTAGGAACTGGGG + Intronic
1160523942 18:79524652-79524674 TGAGCTCTCGGGAGGGGAGGAGG - Intronic
1163654875 19:18539786-18539808 AGAGCTGAGGGTAGGAGTGGGGG - Intronic
1165040357 19:33064371-33064393 AGAGCGCTTGGTGGGAGCGCGGG - Intronic
1166111820 19:40627303-40627325 CGGGCTCTGGGAAGGAGCGGCGG - Exonic
1166274851 19:41746020-41746042 AGGGCTCTCGGTGGTAGTGGTGG - Intronic
1167119424 19:47507772-47507794 AGGGCTCTCGTGAGGAGCTGTGG - Intronic
1168328402 19:55550555-55550577 AGCGCTGTGGGTAGGAGCTGGGG - Intergenic
929672319 2:43886554-43886576 AGCCCTCTCGGCAGCAGCGGGGG - Exonic
931976255 2:67647027-67647049 ACAGCTCTCAATAGGAGAGGGGG + Intergenic
933756767 2:85645567-85645589 AAAGCTCCCGGTTGGCGCGGTGG - Intronic
937121813 2:119445548-119445570 AGAGCTCTAGGGATGAGGGGAGG + Intronic
946189809 2:218002266-218002288 AGAGGTCTTGGTAGCAGGGGAGG + Intronic
1172789666 20:37494233-37494255 AGAGATCGAGGTAGGAGCGCAGG - Intronic
1178234425 21:30824775-30824797 TGAGCTTTTGGTAGGAGGGGAGG - Intergenic
1178773713 21:35529008-35529030 AAGGCTCTCTGTAGGTGCGGGGG + Intronic
1178942985 21:36923050-36923072 AGAGCTGGCGGTGGGTGCGGCGG - Intronic
1181053431 22:20248354-20248376 GGAGCTCAGGTTAGGAGCGGGGG - Intronic
1181763783 22:25076795-25076817 TGAGCACTCAGTAGGAGTGGTGG - Intronic
1182194965 22:28506419-28506441 AGAGCTCCCGGGGGGAGGGGTGG + Intronic
1183583764 22:38740387-38740409 AGAGCTCTGTGAAGGAGCTGAGG - Exonic
1185194857 22:49462837-49462859 AGAGCTCCCCGGAGGGGCGGTGG + Intronic
956012872 3:64850381-64850403 AGAGATCTTGGTAGCAGCTGCGG - Intergenic
960405354 3:117252989-117253011 AGAGGTCTGGGTAGGATCAGTGG - Intergenic
967450601 3:189618621-189618643 AGAGCTGGGGGTAGGAGAGGTGG - Intergenic
967915099 3:194572741-194572763 AGAACCCTCTGTGGGAGCGGAGG - Intergenic
969257286 4:6011076-6011098 AGAGCTCTCTGGAGAAGCAGTGG - Intergenic
984474298 4:180216629-180216651 AGAGCTCTCGGGAGCCACGGAGG - Intergenic
986796652 5:11219155-11219177 AGATCTCTCGCTAGAAGTGGTGG + Intronic
988697995 5:33643313-33643335 AGAGTTCTTGGGAGGAGCTGAGG - Intronic
990282588 5:54267376-54267398 AGAGCTCTGGCCAGGCGCGGTGG - Intronic
990462808 5:56045538-56045560 AGAGCTCTGGCCAGGTGCGGTGG - Intergenic
997979075 5:138457989-138458011 AGAGTTCTTGGTAGGAGCTGGGG + Intergenic
999479837 5:151937838-151937860 AGGGCTCCTGGTAGGAGAGGAGG - Intergenic
1001171075 5:169419513-169419535 AGGGCACTCGGCAGGAGCTGTGG + Intergenic
1002386492 5:178871035-178871057 AGAGATGTTGGTAGGAGGGGAGG - Intronic
1003964525 6:11240356-11240378 AGAGGGCTCAGTAGGAGTGGTGG - Intronic
1008294298 6:49757116-49757138 AGAGCTCCCAGTGGGAGGGGTGG - Intergenic
1013664503 6:112333294-112333316 AGAGCTTTGGCTAGGAGTGGTGG + Intergenic
1016271981 6:142300950-142300972 AGAGCTGTTGGTGGGTGCGGGGG - Intergenic
1016703018 6:147075455-147075477 AGGGCTCTGGGGAGGAGAGGTGG - Intergenic
1017487615 6:154917619-154917641 AGAGCTCGTGATAGGAGAGGTGG - Intronic
1018598343 6:165508932-165508954 TGAGCTCTCTGTAGGTGCAGGGG - Intronic
1019104133 6:169655213-169655235 AGAGCTCCGGGCAGGAGAGGCGG + Intronic
1027992487 7:85380229-85380251 CCACCTCTCGGTAGGAGGGGTGG + Intergenic
1029151514 7:98483877-98483899 TGAGCCCTTGGTAGGAGCTGGGG - Intergenic
1032540617 7:132699998-132700020 AGAACACTCTGTAGGAGCTGGGG - Intronic
1032775538 7:135109335-135109357 AGAGCTCTCAGTGGGAGAGGTGG - Intronic
1032794864 7:135269192-135269214 AGAGCTCCTGGTGGGAGAGGAGG + Intergenic
1033222062 7:139534184-139534206 AGAACTACCGGTAGCAGCGGTGG + Intronic
1034528473 7:151681046-151681068 AGAGCTCTCGGCAGGGGGTGGGG - Intronic
1037304759 8:17493697-17493719 AGTGCTCTGGGTCGGGGCGGTGG + Intergenic
1039102617 8:33957451-33957473 AGAGCTCCCAGTAGGAGTGGGGG - Intergenic
1051504798 9:17815166-17815188 AGTGCTCTTGATAGGAGAGGAGG - Intergenic
1053188397 9:36037760-36037782 AGCTCTCTCGGTAGGAGATGGGG + Intronic
1056094026 9:83232772-83232794 AGAGCTATCTGAAGGAGGGGAGG - Intergenic
1057135263 9:92682928-92682950 ATAGCTCTCTGTAGGTGCAGTGG - Intergenic
1060418767 9:123452521-123452543 AGGACTCTCGGTGGGAGCTGTGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061690153 9:132321106-132321128 AGAGGGCTGGGTAGGAGTGGGGG - Intronic
1062160904 9:135079202-135079224 AGTGCTCTGGGTAGGAGTTGGGG + Intronic
1189794347 X:44633338-44633360 AGTGCTCGCGGCAGCAGCGGCGG + Intergenic
1189806817 X:44743532-44743554 AGAGCTCTCGGTCTGCACGGTGG + Intergenic
1190382535 X:49853753-49853775 AGAGCTGAGGGTAGGAGCCGTGG - Intergenic
1191185512 X:57607352-57607374 AGAGCACTTGGGAGGAGGGGCGG - Intergenic
1193026583 X:76851699-76851721 AGAACTCTGTGTAGGAGGGGTGG + Intergenic
1194594089 X:95836510-95836532 AGAGCTCTCAGAGGGAGGGGTGG - Intergenic
1196582133 X:117391472-117391494 AGAGCTCCCAGAAGGAGGGGTGG + Intergenic
1198029888 X:132744717-132744739 AGAGCCCTCAGTAGGAGGAGGGG - Intronic
1198525866 X:137500098-137500120 AGAGCTCTTGGTAAGAATGGAGG - Intergenic
1201958416 Y:19651048-19651070 AGAGCTCCCAGAAGGAGGGGTGG - Intergenic