ID: 1092171715

View in Genome Browser
Species Human (GRCh38)
Location 12:6377517-6377539
Sequence TCACTCCCACACAGAGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092171709_1092171715 6 Left 1092171709 12:6377488-6377510 CCTGGATGTGAAAGCCGGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1092171715 12:6377517-6377539 TCACTCCCACACAGAGCCCGTGG 0: 1
1: 0
2: 0
3: 21
4: 186
1092171711_1092171715 -8 Left 1092171711 12:6377502-6377524 CCGGGAAGGCCTCCCTCACTCCC 0: 1
1: 1
2: 13
3: 109
4: 803
Right 1092171715 12:6377517-6377539 TCACTCCCACACAGAGCCCGTGG 0: 1
1: 0
2: 0
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092171715 Original CRISPR TCACTCCCACACAGAGCCCG TGG Intronic
900397219 1:2458062-2458084 CCACTCACACACACAGCCTGGGG - Intronic
900469930 1:2848791-2848813 TCACTCCCACCCAGGGCACAGGG - Intergenic
900548799 1:3243321-3243343 TCACTCCCATCCAGATCCCTGGG - Intronic
902231774 1:15032106-15032128 CCACCCCCACACCCAGCCCGAGG + Intronic
903166834 1:21526034-21526056 AGACTCCCCCACAGAGCCCTAGG + Intronic
903389926 1:22956415-22956437 TCACTCCCACACACAGAACTGGG - Intronic
906314384 1:44776760-44776782 TCACTCACACTCTGAGCCCCAGG - Exonic
907038538 1:51237062-51237084 TCATCCCCACACGGTGCCCGAGG - Intronic
912686843 1:111774726-111774748 CAACTCCCACACAGAGGCTGTGG - Intronic
915019364 1:152764815-152764837 TCACTCCCACCCAGAGGCCTGGG - Intronic
915273224 1:154770206-154770228 TTTCTCACACACAGAGCCCCAGG - Intronic
918791218 1:188832603-188832625 TTACTCCCACACTGAGCCCTAGG - Intergenic
918928919 1:190827275-190827297 TCACAGCCAAACAGAGCCTGAGG + Intergenic
919839910 1:201601449-201601471 TCACTCCCTCACCGAGGCTGGGG - Intergenic
920182756 1:204142720-204142742 TCACTCCCTCACCCAGCCCAGGG + Intronic
920551668 1:206866624-206866646 CCACACTCACACAGAGCCGGAGG - Exonic
921937540 1:220808697-220808719 TCACCCACAGGCAGAGCCCGCGG + Intronic
922486583 1:225977716-225977738 TCACTCCACCACAGCCCCCGGGG - Intergenic
922763376 1:228145756-228145778 TCCCCCCCACACAGAACCTGAGG + Intronic
924708299 1:246515417-246515439 TCACTCACACACAGAGGCCATGG - Intergenic
1064678224 10:17783046-17783068 TGACTCCCACACGGAGCACAGGG - Intronic
1065887353 10:30090455-30090477 TCACTTCAACCCAGAGCCAGAGG + Intronic
1067031007 10:42878887-42878909 TCACTCCCCCAGAGAGACTGGGG + Intergenic
1070338560 10:75476289-75476311 ACACTCCCTCACAGAGCTTGGGG - Intronic
1071828880 10:89352522-89352544 TCCCTCCCACAAAGTGCCTGTGG + Intronic
1074437374 10:113445590-113445612 TCACTCCCACCTAGAGGCCTAGG - Intergenic
1075897132 10:126006442-126006464 TCACTACCACACATGGCACGTGG - Intronic
1079445204 11:20550732-20550754 TCACTCCCACCCCAAGCCCCAGG - Intergenic
1082125844 11:48430222-48430244 TCAGTCACACACAGAGACCCAGG - Intergenic
1083570986 11:63762429-63762451 TCCCTGCCACACAGGGCCTGCGG + Exonic
1083629705 11:64089237-64089259 GCTCCCCCACCCAGAGCCCGGGG - Intronic
1083662969 11:64260332-64260354 TCACACCCACACTGAGCCCCAGG - Intronic
1084518434 11:69648765-69648787 TCACTCCCTCACACACCGCGGGG - Intronic
1088238839 11:107753185-107753207 TCACTCAAACACTGAGCCCCAGG - Intergenic
1090238841 11:125167434-125167456 TCTCTCCCGCTGAGAGCCCGAGG + Intronic
1090261145 11:125321292-125321314 TCAGTCCCCCACAGATACCGAGG - Intronic
1090649997 11:128798338-128798360 TCACTTAGACACAGAGCCTGTGG + Intronic
1091787305 12:3250874-3250896 TCAGTCCCTCTCAGGGCCCGAGG - Intronic
1092020940 12:5201747-5201769 TTGCTGCAACACAGAGCCCGTGG + Intergenic
1092171715 12:6377517-6377539 TCACTCCCACACAGAGCCCGTGG + Intronic
1094477715 12:30853981-30854003 CCACACCCAGACAGACCCCGTGG + Intergenic
1094850102 12:34378526-34378548 TCACGCCCACAGAGCGCCTGGGG - Intergenic
1095752583 12:45728886-45728908 TCACACGCACACAAAGCCGGCGG - Intergenic
1096492861 12:52022715-52022737 TCCCTCCCACACAGATCCTTGGG + Intergenic
1100100086 12:91092310-91092332 TCAGTCACACACAGAGACCCAGG - Intergenic
1101532625 12:105587797-105587819 TCAATACCACACAGAGCTAGTGG - Intergenic
1101665848 12:106813557-106813579 TCAATCCCACACAGATACCAAGG + Intronic
1102512074 12:113422505-113422527 TCACACACACACTGAGCCCCAGG - Intronic
1103398422 12:120625727-120625749 TCCCTCTTACACAGAGCCTGTGG + Intergenic
1103595375 12:122021907-122021929 ACACACACACACAAAGCCCGGGG - Exonic
1105283309 13:18982761-18982783 TCACTCTCACACAGAAGCCAAGG + Intergenic
1106974448 13:35190465-35190487 ACACACACACACAGAGCCTGTGG + Intronic
1107803283 13:44130809-44130831 TTACTGCCACACAGGGCCAGGGG - Intergenic
1108655049 13:52523200-52523222 TCACTCAAACACAGACCCTGGGG - Intergenic
1113148592 13:107237052-107237074 TCAATCCCACACAGATACCAAGG + Intronic
1115312977 14:31997591-31997613 ACACTCCCTCACAGAGGCAGGGG - Intergenic
1116027845 14:39536599-39536621 TCAGGCACACACAGAGCCTGAGG + Intergenic
1117956001 14:61124335-61124357 TCACAGCCACAGAGAGCCCAGGG + Intergenic
1123018182 14:105385360-105385382 TCACTCACCCACAGGGCCCGAGG - Intronic
1125338008 15:38646961-38646983 TCATGCCCACTCAGAGCCCTGGG - Intergenic
1126426612 15:48534161-48534183 TTCCTCCCTGACAGAGCCCGGGG + Exonic
1129742400 15:77995789-77995811 TCACCCCAACACCCAGCCCGTGG - Exonic
1129843083 15:78755688-78755710 TCACCCCAACACCCAGCCCGTGG + Intergenic
1131527939 15:93167508-93167530 TCACTCCCACACTGGGCCCAAGG + Intergenic
1132814971 16:1821365-1821387 TCACCCCAACACAGAGGCTGGGG + Intronic
1132949768 16:2554597-2554619 CCACTTCCAGACAGAGCCCCTGG - Intronic
1132964580 16:2645570-2645592 CCACTTCCAGACAGAGCCCCTGG + Intergenic
1133747953 16:8701807-8701829 TCTCTTCCACAGAGAGCCAGGGG - Intronic
1134045605 16:11098764-11098786 TTACTCCCACACACAGCACTTGG - Intronic
1138515503 16:57533640-57533662 TCACACTCACACATGGCCCGAGG + Intronic
1139972230 16:70783360-70783382 TCATGCCCACAGAGAGGCCGCGG - Intronic
1141635996 16:85314173-85314195 GCAGTGCCTCACAGAGCCCGGGG + Intergenic
1146160616 17:30557558-30557580 TCACTCACACACGGAGCCTTCGG + Exonic
1146843775 17:36171257-36171279 TCACTCACACACGGAGCCTTCGG - Intronic
1146856082 17:36259191-36259213 TCACTCACACACGGAGCCTTCGG - Intronic
1146864538 17:36329184-36329206 TCACTCACACACGGAGCCTTCGG + Intronic
1146871988 17:36383102-36383124 TCACTCACACACGGAGCCTTCGG - Intronic
1146879348 17:36434187-36434209 TCACTCACACACGGAGCCTTCGG - Intronic
1146883279 17:36455332-36455354 TCACTCACACACGGAGCCTTCGG - Intergenic
1146942051 17:36850234-36850256 TCACCCCCACCCAGTGCCTGTGG + Intergenic
1147067397 17:37929772-37929794 TCACTCACACACGGAGCCTTCGG + Intronic
1147074875 17:37983726-37983748 TCACTCACACACGGAGCCTTCGG - Intronic
1147078928 17:38009333-38009355 TCACTCACACACGGAGCCTTCGG + Intronic
1147086398 17:38063272-38063294 TCACTCACACACGGAGCCTTCGG - Intronic
1147094865 17:38133268-38133290 TCACTCACACACGGAGCCTTCGG + Intergenic
1147102343 17:38187235-38187257 TCACTCACACACGGAGCCTTCGG - Intergenic
1147450360 17:40500452-40500474 TCCCAACCACACAGAGCCCCGGG - Intronic
1147792300 17:43021417-43021439 TCACACCCCCACAGACCACGGGG + Intronic
1149846930 17:60013742-60013764 TCACTCACACACGGAGCCTTCGG - Intergenic
1150085279 17:62270319-62270341 TCACTCACACACGGAGCCTTCGG - Intergenic
1150288016 17:63964779-63964801 CCCCTCCCTCACAGAGCCTGGGG + Intronic
1151380049 17:73719641-73719663 ACACTGCCACTCAGAGCCCAAGG + Intergenic
1151660238 17:75515069-75515091 GCACTCCCACGCGGAGCCCGCGG + Intronic
1153508636 18:5829635-5829657 ACACACACACACAGAGCCAGCGG - Intergenic
1155698417 18:28712547-28712569 ACACTCCCAGACAGAGACCTAGG - Intergenic
1157286554 18:46381019-46381041 ACACTCCCACACATGGCCAGAGG - Intronic
1157794134 18:50559715-50559737 TCCCTCCCGGACGGAGCCCGAGG + Intergenic
1160584701 18:79905774-79905796 TACTTCCCACACAAAGCCCGTGG + Intronic
1161768760 19:6220351-6220373 TCACTCCCGCACAGACCTCGGGG + Intronic
1161778561 19:6277193-6277215 TCCCTTCCTCACAGAGCCGGAGG - Intronic
1161793642 19:6374694-6374716 TGCCTCCCACACAGACCCTGGGG - Intronic
1162573849 19:11487349-11487371 CTACACCCAGACAGAGCCCGAGG - Exonic
1166780849 19:45342007-45342029 CCACACTCACACAGAGCCCCGGG - Intronic
1167904800 19:52650193-52650215 CCAGTCCCACTGAGAGCCCGTGG + Intronic
1168344346 19:55643095-55643117 TCACTCCCACACACACCCCCTGG + Exonic
925694616 2:6562906-6562928 TTACCTCCACACAGAGCCCACGG + Intergenic
927874361 2:26645100-26645122 TCACTCACACACAGACCCCAAGG + Intergenic
927972915 2:27316911-27316933 TCACTCCCGAACAGATCCAGCGG + Intronic
930762204 2:55049737-55049759 GCACTCACCCACTGAGCCCGAGG + Exonic
932708477 2:74045662-74045684 ACATTCCCACACACAGCCCCAGG - Intronic
932752588 2:74380702-74380724 TCAATCTCACACTGAGCCAGAGG + Intronic
934905521 2:98198155-98198177 TAATTCCAACACAGAGCCCAGGG + Intronic
937013906 2:118586242-118586264 ACTCTCCCACACAGAGCCAATGG + Intergenic
938903840 2:135820444-135820466 ACACTGCCACACAAAGCCTGAGG + Intronic
939851975 2:147314590-147314612 TCACCCCCTCACTGAGCCCTGGG + Intergenic
940895793 2:159080985-159081007 CCATTCCCACAGGGAGCCCGAGG - Intronic
941344284 2:164348381-164348403 TCATCACCACACAGAGCCCCTGG - Intergenic
941908659 2:170741272-170741294 TCCCTAGAACACAGAGCCCGAGG - Intergenic
945005931 2:205406043-205406065 TCTCTCTCACACAGAGCATGCGG + Intronic
946057646 2:216915961-216915983 TCCCTCCCGCACACAGCACGTGG - Intergenic
947747933 2:232518923-232518945 GCAAGCCCACACAGAGCCCCTGG - Intergenic
947958131 2:234212698-234212720 TCACGCCCACCCAGGGCCCGTGG + Intergenic
948231835 2:236354771-236354793 TGACTGACACACAGTGCCCGGGG + Intronic
949035651 2:241814698-241814720 CTACACCCACACAGAGCCCCCGG - Intronic
1170299063 20:14861663-14861685 TCCCTCCCACACACAACCCCAGG + Intronic
1171446331 20:25207159-25207181 ACACGCCCACACACAGCCCCAGG - Exonic
1171461297 20:25299598-25299620 TTACTCCAGCACAGAGCCCAAGG - Intronic
1172835325 20:37869631-37869653 TCACTCCCACACCCGGCCCCAGG - Intronic
1174391517 20:50220920-50220942 TCACTGGCACACAGAGCTGGCGG - Intergenic
1175139455 20:56849029-56849051 TCACACCCACGCAGACCCCATGG - Intergenic
1175186864 20:57184609-57184631 TCACACCCACACAGAGCCTCAGG + Intronic
1175306704 20:57981098-57981120 TGAGTCTCACACAGAGCCAGCGG + Intergenic
1175650244 20:60715490-60715512 TCAGTCCCACACAGGGCCACTGG + Intergenic
1177117555 21:17104676-17104698 TCAGTCACACACAGAGACCCAGG + Intergenic
1179022843 21:37655929-37655951 TCTTTCCCACACACAGCCCTGGG + Intronic
1179266188 21:39805658-39805680 TCACGCCCAACCAGAGCCAGAGG + Intergenic
1180073069 21:45447994-45448016 TAACACCCACACAGAGCCCCAGG + Intronic
1180644601 22:17328142-17328164 TCTCTACCACACAGAGTCCATGG - Intergenic
1181487264 22:23239157-23239179 TCCTTCCCACACAGGGCCTGAGG - Intronic
1182168768 22:28205210-28205232 ACACACACACACAGAGACCGGGG + Intronic
1183378326 22:37478088-37478110 TCACTCATACACAGAGCCCTAGG + Intronic
1183421259 22:37713115-37713137 TCACTCACACAGGGAGCCTGGGG - Intronic
1184220748 22:43098247-43098269 TCACCCCCAGACAGCGCCGGAGG + Intergenic
950264644 3:11564809-11564831 TCTCGCCCACACTGACCCCGGGG - Exonic
950766682 3:15278074-15278096 TCTCACCCCCACAGGGCCCGGGG + Intronic
952006187 3:28845105-28845127 GCACTCCCAGACACAGCCCCTGG - Intergenic
952971001 3:38649888-38649910 ACACTCCCACACTGACCCGGGGG + Intergenic
953975663 3:47380349-47380371 CCACTTCCCCACAGGGCCCGGGG + Intergenic
954110796 3:48431681-48431703 GCACACCCCCACACAGCCCGGGG - Intergenic
954420090 3:50414215-50414237 ACAGGCCCACACAGAGCCCAAGG + Intronic
954675095 3:52311271-52311293 TCACACCCACAGTGAGCCAGTGG - Intergenic
958120878 3:89286400-89286422 TAATTCCAACACAGAGCCAGAGG - Intronic
962604695 3:137023739-137023761 TCAGTCACACACGGAGCCAGGGG - Intergenic
962929118 3:140021307-140021329 TCACTCCAGCACAGAGCCCTGGG + Intronic
963547014 3:146672165-146672187 TCACTCCCAGACAGAACTCCAGG - Intergenic
963599273 3:147363762-147363784 ACACACACACACAGATCCCGAGG + Intergenic
967965656 3:194958154-194958176 ACAGTCCCACACACAGCCCCAGG + Intergenic
968556536 4:1248789-1248811 GCACTCGCACACAAAGCCGGCGG + Intronic
968974172 4:3812376-3812398 ACAGTGCCGCACAGAGCCCGTGG - Intergenic
970057230 4:11988755-11988777 TCAGTCCCACACAGATCCTGAGG + Intergenic
971157969 4:24103476-24103498 GCCCTCCAACACAGAGCCCTCGG + Intergenic
973039423 4:45451970-45451992 TCACTCTCACCCTCAGCCCGAGG - Intergenic
982306703 4:153939808-153939830 TCATTCCCACACAGGGCCTGTGG - Intergenic
985776563 5:1847264-1847286 TCACTCCCACACCCAGTGCGTGG - Intergenic
986733020 5:10649193-10649215 TCCCTCCCAGGCAGAGCCTGGGG - Intronic
990656154 5:57958277-57958299 TCACACCCATACAGAGCACTGGG + Intergenic
991135440 5:63176723-63176745 TCAGACACACACAGAGCCCTGGG - Intergenic
994670313 5:102755318-102755340 TCCGTCCCGGACAGAGCCCGTGG + Intronic
997716142 5:136044421-136044443 TCACTCCCAGCCAGAGGCAGAGG - Intronic
998340925 5:141417572-141417594 GCAGTCCCACACAGAGCCTCTGG + Intronic
999088254 5:148912328-148912350 TCACATTCACACAGAGCCTGTGG + Intergenic
999204710 5:149839851-149839873 TCAGGCCCACACACAGCCCTGGG + Intronic
1002278803 5:178119254-178119276 TGAATCCCACACAGGCCCCGAGG + Intronic
1004036151 6:11926046-11926068 TCACTCCCACGCAGAACACGTGG + Intergenic
1014654063 6:124077236-124077258 CCACTCCCACACATACCCAGTGG + Intronic
1019634699 7:2069330-2069352 TCTCTCCCATGCAGCGCCCGGGG - Exonic
1025995066 7:66522771-66522793 TCCCACGCACACAGAGCCCCAGG + Intergenic
1025997598 7:66537835-66537857 TCCCTCCCAGACAGTGCCCAAGG + Intergenic
1026134914 7:67651433-67651455 TCAATCCAACACACAGCCAGGGG - Intergenic
1026455972 7:70572777-70572799 TCAATCCCCAACAGTGCCCGTGG - Intronic
1026680889 7:72465872-72465894 TCACTGTCACACAGAGTCAGGGG - Intergenic
1026986707 7:74559466-74559488 TCCCGCACACACAGAGCCCCAGG + Intronic
1028758850 7:94470928-94470950 CCACTCCCACCCATAGCCCTAGG - Intergenic
1033843066 7:145398883-145398905 TCCCTCACACATAGAGCCCTGGG - Intergenic
1040548853 8:48423051-48423073 TCACTCCCAGGCAGGGCCCCTGG - Intergenic
1042533206 8:69834768-69834790 ACACACACACACAGAGCCCGTGG + Intronic
1043473244 8:80581683-80581705 TCAGTCCCACTCAGAGCCCCAGG - Intergenic
1045222526 8:100213076-100213098 CCACTTCCTCACAGAGCCCGCGG + Exonic
1049486290 8:142865416-142865438 CCACTCCCACAGAGAGCCATAGG - Intronic
1054862977 9:69972167-69972189 TCACTCCCAAATAGGGCACGTGG - Intergenic
1059076258 9:111196936-111196958 TCAGTCACACACAGAGACCCAGG + Intergenic
1059662909 9:116419438-116419460 ATACCCCCACACAAAGCCCGTGG + Intergenic
1060027284 9:120183874-120183896 GGACTCACACACAGAGCCAGTGG + Intergenic
1060341108 9:122778040-122778062 TCTTCCCCACACAGAGCCTGGGG + Intergenic
1061421496 9:130475142-130475164 TCACTCTAACACAGAGCCACAGG + Intronic
1061951541 9:133938985-133939007 TGGCTCCAACACAGAGCCAGTGG - Intronic
1062623390 9:137432699-137432721 TCGAGCCCACACAGAGGCCGGGG + Intronic
1062637937 9:137501268-137501290 CCCCTCCCACACTGAGCCCCCGG + Intronic
1186500157 X:10044524-10044546 CCACTCCCACACAGGGCTAGGGG - Intronic
1187095216 X:16140808-16140830 TCACCTCCAAACAGACCCCGAGG - Intronic
1190081697 X:47361812-47361834 TGCCTCCCACACAGAGCCATTGG + Intergenic
1192459068 X:71301894-71301916 CAACACCCACACAGAGCCCCTGG - Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1196234428 X:113262031-113262053 TCAAGCACACACAGAGCCCCAGG - Intergenic
1198636173 X:138703253-138703275 ACACACCCACACATACCCCGAGG + Intronic
1199658366 X:150021505-150021527 TCTCTCCCTCTCAGAGCCCATGG - Intergenic
1199679793 X:150216628-150216650 TCCCTCCCTCACAGAGCTGGAGG - Intergenic
1199695435 X:150340421-150340443 TCCCTCCCTCACAGAGCTGGAGG + Intergenic