ID: 1092172461

View in Genome Browser
Species Human (GRCh38)
Location 12:6382711-6382733
Sequence CAGGTGATGGGAAGTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 329}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092172461_1092172468 23 Left 1092172461 12:6382711-6382733 CCATGCACACTTCCCATCACCTG 0: 1
1: 0
2: 3
3: 32
4: 329
Right 1092172468 12:6382757-6382779 AAGTTAGACAGACCAGTGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092172461 Original CRISPR CAGGTGATGGGAAGTGTGCA TGG (reversed) Intronic
900114291 1:1021852-1021874 CAGGTGGGGAGAAGTGTGGAAGG + Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900284623 1:1893228-1893250 CGGGTGATGGGAACTGTCAATGG - Intergenic
901243852 1:7712860-7712882 CAGGCGAGAGGACGTGTGCAGGG + Intronic
901401510 1:9018094-9018116 CAGGTGTTGGGCAGTGTGGTGGG - Intronic
901558576 1:10051305-10051327 GGAGTGATGTGAAGTGTGCATGG + Intronic
901977116 1:12953830-12953852 CAGATGATGGTCTGTGTGCAAGG + Intronic
902008053 1:13247940-13247962 CAGATGATGGTCTGTGTGCAAGG - Intergenic
902884596 1:19395703-19395725 CAGGTGATGGGTTGTGTGCCTGG - Intronic
902989933 1:20180163-20180185 CAGCTGTAGGGAAGTGAGCAAGG - Intergenic
903015044 1:20356093-20356115 CAGGGGATGGGGAGTGTGCAGGG - Intergenic
903071811 1:20730507-20730529 CAGGTGATGGTAGGTGGGCTGGG - Intronic
903953560 1:27010434-27010456 AAGCTGTTGGGATGTGTGCAGGG - Intronic
904301835 1:29559250-29559272 CAGGGGATAGGAGGTGGGCAGGG + Intergenic
904468617 1:30722468-30722490 CCTGTGCTGGGAAGTATGCAGGG + Intronic
904560981 1:31397257-31397279 GAGGTGAGGGGAAGGGTGGATGG + Intergenic
905091324 1:35433426-35433448 CAGGGGGTGGGAGCTGTGCACGG + Intergenic
905859640 1:41341739-41341761 CAGGGGAAGGGAAGGATGCAAGG + Intergenic
906710359 1:47924829-47924851 CTGGGGATGGGAAAGGTGCAGGG + Intronic
909538845 1:76768463-76768485 CAGGTGAAGGGAGGTGGGAAGGG - Intergenic
909818302 1:80025386-80025408 CATGTGATGAGAAGTGTAAACGG + Intergenic
910272322 1:85410136-85410158 CAGGTGTTTGGCAGTGTGCCTGG - Intronic
911275130 1:95850783-95850805 CAGGAGAAGAGAATTGTGCAGGG - Intergenic
911641931 1:100298721-100298743 CAGGTGATGGGATATCTGCCCGG - Intergenic
914915866 1:151818840-151818862 CTGTTGATGTGAAGTGGGCAGGG + Intronic
915345665 1:155195657-155195679 CAGGGGATGAGAAGTTTTCAAGG - Exonic
915705618 1:157840649-157840671 CATGTGAAGGAAAGTGAGCATGG + Intronic
915742654 1:158131039-158131061 GAGGTGAAGGGAAGTGAACAGGG + Intergenic
917262703 1:173187365-173187387 CAGAGTATGGGTAGTGTGCAGGG - Intronic
918446531 1:184622715-184622737 CAGATGATGGGCACTGTGGACGG - Exonic
919921695 1:202169937-202169959 CAGGTGAAGGGAGGTGTGATGGG - Intergenic
920034869 1:203059314-203059336 CAGGGGAAGGGAAGTGGGTAGGG - Intronic
920255059 1:204649045-204649067 CAGGTGAAGGGATTTGTGGAAGG + Intronic
921742170 1:218697713-218697735 CAGGTCATGGGAAGTTGGGAAGG + Intergenic
922246440 1:223803009-223803031 CATGAGATGAGAAGTGTGGAGGG - Intronic
922583627 1:226717688-226717710 GAGGTGATGGCATGTGGGCAGGG + Intronic
922980828 1:229825446-229825468 GAGGTGGTGGAAAGTGTGGAAGG - Intergenic
924867837 1:248005006-248005028 CAGAGGGTGGGAAGGGTGCAGGG + Intronic
1062945949 10:1462145-1462167 GGGGTGGTGGGAAGTGGGCAGGG - Intronic
1065167406 10:22994227-22994249 CAGGAAATGGGAAGAGCGCAGGG + Intronic
1065194339 10:23248062-23248084 CAGGAGAAGGGATGTGTGCATGG + Intergenic
1065226612 10:23549815-23549837 CAGGAGATGGGCACTATGCAGGG + Intergenic
1065736090 10:28753859-28753881 AGTGTGTTGGGAAGTGTGCAGGG - Intergenic
1066373093 10:34833988-34834010 TGGGTGATGGGAAGTGTTTATGG - Intergenic
1070581805 10:77725947-77725969 CAGGAGATGGGGAGTGAGCAGGG - Intergenic
1070646021 10:78203136-78203158 GAGGTGATGGGGAGGGTGCGGGG - Intergenic
1070776151 10:79111089-79111111 CAGGTGATGGGGACTGCTCATGG - Intronic
1071397255 10:85236574-85236596 TAGGTGCTAGGAAGTGTTCAAGG + Intergenic
1072921494 10:99580828-99580850 CAGGTGATGGAGAGTGATCAGGG + Intergenic
1073184716 10:101608991-101609013 TATGGGATGGGAAGTGGGCAGGG - Intronic
1074679488 10:115889565-115889587 CATGTGCTGGACAGTGTGCAAGG + Intronic
1075405976 10:122195972-122195994 CGTGTGATGAGAAGTCTGCAGGG + Intronic
1075652710 10:124139746-124139768 CAGCTGATGGGAGATGTTCATGG - Intergenic
1076545921 10:131245773-131245795 CAGTGGGTGGGAAGTGCGCACGG + Intronic
1076802286 10:132836132-132836154 CAGGCGGTGGGAGGTGAGCAGGG - Exonic
1077613611 11:3660045-3660067 CAGGTGTTCCGAGGTGTGCACGG + Exonic
1078459116 11:11499833-11499855 CAGGTGATGGGTAATGTGGATGG + Intronic
1079515609 11:21264439-21264461 CAGGAGATGGGAAGGCTGGAGGG + Intronic
1079876681 11:25866619-25866641 CAGGGGATGGAAAATTTGCAAGG - Intergenic
1079984602 11:27187426-27187448 AAGGTGATGCGAAGTGGGGAGGG - Intergenic
1082225796 11:49705536-49705558 AAGGTGATTGGAAATGTGGAAGG + Intergenic
1084009160 11:66338192-66338214 AAGGTGATGGCAAGGGGGCAGGG + Intronic
1084726379 11:70945139-70945161 CAGGGGATGGAAATTGTGTATGG + Intronic
1085508837 11:77075093-77075115 AAGGTGATGGGGAGTGTGGAAGG - Intronic
1086623298 11:88914195-88914217 AAGGTGATTGGAAGTGTGGAAGG - Intronic
1087133863 11:94694738-94694760 CAGGTGATGGAAACTGGGCCCGG + Intergenic
1089536197 11:119161997-119162019 TAGGGGATGGCAAGTGTGTAGGG - Exonic
1089767903 11:120781895-120781917 CATGTGAGGGGAAGAATGCAGGG - Intronic
1090877843 11:130806815-130806837 CAGGTGAGGGAAGCTGTGCAGGG - Intergenic
1091139439 11:133222602-133222624 CAGGTTGTGGGAAGTGGCCATGG + Intronic
1091287347 11:134414990-134415012 CAGATTATGGGAAGTGGGCCAGG - Intergenic
1091389461 12:117294-117316 CATGTGTTGGGAAGCGGGCAGGG + Intronic
1092172461 12:6382711-6382733 CAGGTGATGGGAAGTGTGCATGG - Intronic
1092703102 12:11255375-11255397 CAAGTGATAGGAAATGTGTAAGG + Intergenic
1094490951 12:30960301-30960323 AGGGTGATGGGAAGTGTACAGGG - Intronic
1095944888 12:47748234-47748256 CAGGTGGTGGGATGTGGGGAAGG - Intronic
1096154760 12:49335867-49335889 CAGGTTGTGGGATGAGTGCAGGG + Intronic
1096621689 12:52869413-52869435 CAGGAGATGGGCAGGGAGCAGGG + Intergenic
1096654526 12:53080134-53080156 ATGGTGATGGGAAGGGAGCAAGG - Intergenic
1099016220 12:77347290-77347312 CAGCTGATGTCCAGTGTGCACGG - Intergenic
1100088887 12:90946168-90946190 CAGCTCATGAGAAGAGTGCATGG + Intronic
1101487367 12:105178746-105178768 CAGTTAATGAGAAGTGTGTATGG + Intronic
1103517153 12:121515115-121515137 CAGGGGATGGGGAGTGTGATTGG - Intronic
1103517220 12:121515315-121515337 CAGGGGATGGGGAGTGTGATTGG - Intronic
1103707931 12:122889266-122889288 CAGGAGAGGGGAAGTGAGAAAGG + Intronic
1103927117 12:124429292-124429314 CAGGAGATGGGAAGAGTGAGAGG + Intronic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104461725 12:128962025-128962047 CAAGTGCTGGGAAGGGTGGAGGG - Intronic
1107914872 13:45139229-45139251 TGGGTGATGTGAATTGTGCATGG + Intronic
1108771111 13:53700974-53700996 CAGGAGATGGAGAGAGTGCAGGG - Intergenic
1111973126 13:94938018-94938040 AAGCTGATGGCAAGCGTGCAGGG - Intergenic
1112020773 13:95369380-95369402 CAGGAGAGGGAGAGTGTGCAGGG + Intergenic
1112986439 13:105455910-105455932 CAGAGGCTGGGAAGTGTGTATGG + Intergenic
1113617800 13:111693534-111693556 GGGGTGATGTGAAGTGTGGAAGG - Intergenic
1113623333 13:111778795-111778817 GGGGTGATGTGAAGTGTGGAAGG - Intergenic
1113838505 13:113345657-113345679 CACGTGATCGGAAGTGCGGAGGG + Intronic
1113852319 13:113424808-113424830 CAGGTGAATGGATGGGTGCATGG - Intronic
1114254676 14:20991339-20991361 CAGGTACTGTGAGGTGTGCAGGG - Intronic
1116177953 14:41497092-41497114 CAGGTGGTGGGTAGGGGGCAAGG + Intergenic
1119649787 14:76375590-76375612 CAGGTGATGAGAACTGGGAAGGG + Intronic
1120575567 14:86176382-86176404 CAGGTGCTGGAAAGTGAGGAGGG + Intergenic
1120753828 14:88223136-88223158 GAGGTGATGGGTTTTGTGCAAGG - Intronic
1120780549 14:88482132-88482154 CATGTGAACGGAAGGGTGCATGG + Intronic
1121670812 14:95709588-95709610 CAGGTCATGGGAGGTGGGGAAGG + Intergenic
1121710154 14:96031687-96031709 CAGGTGATGGCAAGAAGGCAAGG - Intergenic
1122398169 14:101450021-101450043 GAGGTGCTGGGGAGTGTGTAAGG - Intergenic
1122929986 14:104928683-104928705 CAGGTGATGTGAGGTGGGCTGGG + Intronic
1123115925 14:105894016-105894038 CAGGTGAGGGGAACTGTCCAGGG + Intergenic
1123117952 14:105903126-105903148 CAGGTGAGGGGAACTGTCCAGGG + Intergenic
1127266205 15:57364435-57364457 CAGGTGATGGGCTGACTGCAGGG + Intergenic
1127542581 15:59956007-59956029 TAGGAGATGGGAAGTTTGAATGG - Intergenic
1127866229 15:63035442-63035464 CAGGTGCTGGGAAGTGAAGAAGG + Intergenic
1128242286 15:66109201-66109223 CAAGTTATGGGGGGTGTGCAGGG - Intronic
1129248599 15:74295607-74295629 CAGATGGTAGGAGGTGTGCACGG + Intronic
1130096734 15:80861626-80861648 GAGGTGATGGGAAGAGGGCAGGG + Intronic
1130230683 15:82094579-82094601 AAGGTGATGGGAAAAGTGGATGG + Intergenic
1130883697 15:88076204-88076226 CAGGTAAGAGGATGTGTGCAGGG + Intronic
1133221646 16:4321479-4321501 CAGGTGTTGGGATATGTGAAGGG + Intronic
1133906630 16:10028407-10028429 GAGGTGCTGGGAAGTGTCCATGG - Intronic
1134111122 16:11516112-11516134 CAGGAGATGGGAAGGGGGTAGGG - Intronic
1136711366 16:32239967-32239989 CAGGTGAGGGAAATGGTGCAGGG + Intergenic
1136811568 16:33180935-33180957 CAGGTGAGGGAAATGGTGCAGGG + Intergenic
1136818044 16:33291015-33291037 CAGGTGAGGGAAATGGTGCAGGG + Intronic
1136824608 16:33347544-33347566 CAGGTGAGGGAAATGGTGCAGGG + Intergenic
1136829674 16:33446315-33446337 CAGGTGAGGGAAATGGTGCAGGG + Intergenic
1137344052 16:47637944-47637966 CACATGATGGAAAGGGTGCAGGG + Intronic
1137509893 16:49090015-49090037 CAGCTGATAGGAAGTGGGTATGG - Intergenic
1138458689 16:57135290-57135312 CAGGGGCTGGGAAGTGAGTATGG + Intronic
1139614081 16:68078706-68078728 AAGGTGAGGGGCAGGGTGCAGGG - Intronic
1140290164 16:73645874-73645896 GAGGTGATGGTAACTGTACAGGG + Intergenic
1140510453 16:75503831-75503853 CAAGTGATAGGCAGTGTGCTAGG + Intergenic
1141735767 16:85851564-85851586 GTGGTGATGGGGTGTGTGCAAGG - Intergenic
1142089009 16:88200097-88200119 CAGGTGACGGGAGGAGTGCCCGG + Intergenic
1202990146 16_KI270728v1_random:3904-3926 CAGGTGAGGGAAATGGTGCAGGG + Intergenic
1203058689 16_KI270728v1_random:949792-949814 CAGGTGAGGGAAATGGTGCAGGG - Intergenic
1142956706 17:3527734-3527756 CAGGTGATCGGATGGGTGGATGG + Intronic
1142985977 17:3695631-3695653 GAGGTGATGAGAGGTGGGCAGGG - Intronic
1143253723 17:5540761-5540783 GAGTTGATGGGAAGGGGGCATGG - Intronic
1143786488 17:9259672-9259694 CAGGTGAGAGGAACTGTGAAAGG + Intronic
1144238753 17:13288551-13288573 AAGGGGATGGGAACTCTGCATGG - Intergenic
1147168190 17:38604451-38604473 CAGGCGCGGGGAAGTATGCAAGG - Intronic
1148384308 17:47223195-47223217 CAGGAGATGGTGAGTGAGCAGGG - Intronic
1148767576 17:50048105-50048127 CAGGTGAAGGGACTTGTCCAAGG + Intergenic
1148781083 17:50122436-50122458 GACGTGATGGGATGTGGGCATGG - Intronic
1151206529 17:72512257-72512279 CAGGTGATGTGAAGGTAGCAAGG - Intergenic
1151211291 17:72546389-72546411 CAGCAAATGGGAAATGTGCACGG - Intergenic
1151411337 17:73932168-73932190 CAGTTGATTGGAAATGGGCAAGG - Intergenic
1151809927 17:76433415-76433437 CAGGAGTTGGGAGGGGTGCAGGG + Intronic
1152433633 17:80262414-80262436 CTGGAGAGGGGAGGTGTGCAGGG + Intronic
1152659550 17:81535899-81535921 CAGGTGATGGGAACGGTGGTGGG - Intronic
1153693805 18:7619961-7619983 CAGCTGATGGCCAGTGGGCATGG + Intronic
1154046875 18:10914462-10914484 CAGATGATTTGAAGTATGCAGGG - Intronic
1154174784 18:12078565-12078587 CAGATGATTTGAAGTATGCAGGG + Intergenic
1156519290 18:37708077-37708099 CAGGAGATGGGAAGTATGACTGG - Intergenic
1157499034 18:48177287-48177309 CAGGTGAGGGCAAGTGGTCAAGG - Intronic
1158613778 18:58967545-58967567 CAGGTGCACGGAAGGGTGCACGG - Intronic
1159979899 18:74765677-74765699 AAGATCATGGGAAGAGTGCATGG - Intronic
1160390855 18:78531095-78531117 TAGTTGAGGGGGAGTGTGCATGG + Intergenic
1160918122 19:1507251-1507273 CAGGTCATGGGAGGTGGGCCCGG + Exonic
1161249672 19:3273764-3273786 CTGGTGGTGGGAGGTGGGCAGGG + Intronic
1161872510 19:6881350-6881372 CAGAGGATGGGAGGTGAGCAGGG - Intergenic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1163793885 19:19324473-19324495 CAGGTGGTGGGAGTTGTTCATGG - Intronic
1164216151 19:23150909-23150931 CAGGTAATGGGAAGCCTTCAGGG - Intergenic
1164609222 19:29621013-29621035 CAGGTGGTGGGAGGGTTGCAAGG - Intergenic
1166196282 19:41207739-41207761 CCGGCGGTGGGAAGTGGGCAAGG + Intergenic
1166346009 19:42166372-42166394 CAGGTGTTAGGCATTGTGCAAGG - Intronic
1166420553 19:42632991-42633013 CAGGGGATGCGCTGTGTGCAGGG + Intronic
1166432643 19:42740341-42740363 CAGGTGATGCGCTGTGTGCAGGG + Exonic
1166435755 19:42765538-42765560 CAGGTGATGCGCTGTGTGCAGGG + Exonic
1166453022 19:42917749-42917771 CAGGTGATGTGCTGAGTGCAGGG + Exonic
1166482569 19:43186362-43186384 CAGGTGATGTGCTGTGTGCAGGG + Exonic
1166485051 19:43205493-43205515 CAGGTGATGCGCTGTGTGCAGGG + Exonic
1167965214 19:53139074-53139096 TATGTGATGGGAATAGTGCAGGG - Exonic
1168020774 19:53607167-53607189 CAGATGATGGGGAGTGGGGATGG - Intergenic
925247259 2:2395023-2395045 CAGGTGATGGAATGTGTGCATGG + Intergenic
926306814 2:11643230-11643252 GAGCTGATGGGGAGTGAGCAAGG - Intergenic
926467421 2:13207729-13207751 CAGGTGAAGGTATTTGTGCATGG + Intergenic
927055885 2:19365246-19365268 CAGCTGATGGGAGCTGTGCCAGG + Intergenic
927738478 2:25545041-25545063 AAGGAGATGGAAAGTGTGAAAGG - Intronic
928228931 2:29479156-29479178 CAGGAGATGGGAGATGTTCAGGG - Intronic
930667684 2:54115735-54115757 GAGGTGTTCGGAAGAGTGCAGGG + Exonic
932492283 2:72130075-72130097 CAGGTGAGGGGCAGGGGGCATGG - Exonic
932656362 2:73614110-73614132 CAGGTGGTAGGTAGTGTTCAAGG + Intergenic
935362817 2:102262074-102262096 CAGGTGAGGTGAAGTGAGGAGGG + Intergenic
938211710 2:129471184-129471206 CAGGTGATGCAATGTGTACAGGG - Intergenic
938979486 2:136512608-136512630 CAAGTGTTGGGAAGTATGTAGGG - Intergenic
941712541 2:168729408-168729430 GAGGTGATGGGAAGTGAGGATGG - Intronic
944185461 2:196943224-196943246 GAGGTTAAGGGACGTGTGCAGGG - Intergenic
944742654 2:202627248-202627270 CAGGTGATAGGAAGTATGGGAGG - Intergenic
945432520 2:209780799-209780821 CTGGTGAGGGGAAGTTTACATGG - Intronic
946225513 2:218262164-218262186 CAGATGGGGGGAAGGGTGCAGGG + Exonic
947937597 2:234021449-234021471 TAGGTGGTGGGAAGTGTCAAAGG - Intergenic
948041664 2:234906096-234906118 AGGGTGCTGGGAAGTGTGCCAGG - Intergenic
948351725 2:237346423-237346445 CAGATGGTGGGAAGTTTTCAGGG + Intronic
948969169 2:241411104-241411126 CAGGAGATGGGACGTGAGAAGGG - Exonic
1168748073 20:261829-261851 CAGGGGATGTGAAAGGTGCATGG + Intergenic
1169312829 20:4561643-4561665 CAGTTGATCAGAAGTGTGAATGG - Intergenic
1169468593 20:5863464-5863486 CTGGTGCCGGGCAGTGTGCAGGG + Exonic
1170113812 20:12835567-12835589 CTGGAGATGGGAAGTCTGTATGG - Intergenic
1170556063 20:17515759-17515781 CAGGTGTTGGCAGGTGTGCATGG - Intronic
1171961291 20:31496886-31496908 CTGGGAATGGAAAGTGTGCAGGG + Intergenic
1172677971 20:36688508-36688530 AAGTTCCTGGGAAGTGTGCAGGG - Intronic
1172865685 20:38095365-38095387 CAGGTGATGGGAGATGAGGATGG + Intronic
1173237119 20:41256753-41256775 CAGCAGACGGGAAGTCTGCATGG - Intronic
1173522842 20:43712107-43712129 CAGGTGAGGTGGAGTCTGCAGGG + Intronic
1173534621 20:43800065-43800087 GAGTTGAGGGGCAGTGTGCATGG - Intergenic
1173641211 20:44603419-44603441 GAGGTGAGGGGAGTTGTGCACGG + Intronic
1173842299 20:46165851-46165873 CAGGGGATGTGAAGTGCTCAAGG + Intergenic
1175253791 20:57625956-57625978 CAGGTGACAGGAAGTGGGCAAGG + Intergenic
1175295170 20:57903324-57903346 CAGGAGATGGGGTGTGTGCTAGG + Intergenic
1175445829 20:59018825-59018847 CAGGGGCTGGGAAGGGTGCTGGG + Intergenic
1178669859 21:34580838-34580860 CAGGTGCTAGAAAGTTTGCAAGG - Intronic
1178678464 21:34651444-34651466 CACGTGATAGGAAGTGAGGAAGG - Intergenic
1181038089 22:20179431-20179453 CAGGGGAGGGGAGGTGGGCAGGG + Intergenic
1181058825 22:20272397-20272419 CAGGTGGTGGGAGGTGCGCATGG - Intronic
1181369571 22:22405321-22405343 GAGGTGATGAGCAGTTTGCAAGG - Intergenic
1182393384 22:30018121-30018143 CCTGTGTTGGGACGTGTGCAGGG + Intronic
1182441169 22:30365211-30365233 CAGGTGATGGGAATTGGACAGGG + Intronic
1182739659 22:32558577-32558599 CAGATGAGGGGAAGTGGGGAAGG - Intronic
1183394273 22:37562307-37562329 CAGGTGAGGGGAGGTGAGCCTGG + Intronic
1183779506 22:39989741-39989763 GAGGGCCTGGGAAGTGTGCAGGG + Intergenic
1183864695 22:40694919-40694941 CAGGTGAGGGGAACTGCACAAGG - Intergenic
1184390081 22:44198810-44198832 CAGGTGAAGTGAAGGGTGTAGGG + Intronic
1184897686 22:47421198-47421220 CAGGAGATGGAAAGTATGGAAGG - Intergenic
1185417359 22:50717574-50717596 AAGGTGATGAGACCTGTGCAGGG - Intergenic
949698811 3:6731635-6731657 CAGGTGAAGGGAAAAGTGCATGG + Intergenic
950124635 3:10503972-10503994 CAGGTGCTGGGGTGTGGGCATGG + Intronic
950502512 3:13373275-13373297 CAGGTGTGGGGACCTGTGCAGGG + Intronic
951304676 3:21043793-21043815 CATGTGATTGGAAATGTGGAAGG + Intergenic
954400522 3:50317301-50317323 CTGGTGGTGGGAGGTGGGCAGGG - Intergenic
957309966 3:78507057-78507079 CAGGAGATGGGAAGTGAGGGAGG - Intergenic
958150427 3:89686117-89686139 CAGGTGATGGAAAATGTGCATGG - Intergenic
961738475 3:129017117-129017139 GAGGTGAGGGGAAGTCTGCCAGG - Intronic
961781318 3:129322073-129322095 CAGATGATGAGGAGTGGGCAGGG - Intergenic
962610698 3:137073750-137073772 CAGGTGTTGGGAAGTGGTTAGGG - Intergenic
963823999 3:149931842-149931864 CAGATGCTGGGAAGGGTGGAAGG - Intronic
965415432 3:168387064-168387086 GAGGTGGTGGGAAGTGGGAAAGG - Intergenic
965679668 3:171236878-171236900 CAGGTGATTGGGAGTGGGCAGGG + Intronic
966756633 3:183377506-183377528 CAGGTGTTGGGCACTGTGCTAGG + Intronic
967756124 3:193171013-193171035 CAGGTGAGGGAAGGTGTTCAGGG - Intergenic
969246218 4:5934633-5934655 CTGGCTATGGCAAGTGTGCAGGG - Intronic
970213832 4:13738094-13738116 AAGGTGATGGGAAGAGTGGATGG + Intergenic
971021428 4:22540369-22540391 CATGTGCTGGGAATGGTGCAAGG + Intergenic
971164635 4:24170561-24170583 TGGGTGATGGGAAGTGAGCAGGG - Intergenic
971267871 4:25110842-25110864 CAGGAGAGGGGAATGGTGCAAGG + Intergenic
971505178 4:27358751-27358773 GAGGTGTTTGGAAATGTGCAGGG + Intergenic
972363152 4:38347596-38347618 GATGTGATGGGAAGTTTGCCGGG + Intergenic
973330316 4:48906002-48906024 CAGGAAATGGAAGGTGTGCAGGG - Intronic
973581634 4:52349647-52349669 CAGGGGGTGGGAGGTGGGCAGGG + Intergenic
974738233 4:65969308-65969330 TATGTGATGGGAAGAGTGCTGGG + Intergenic
975052216 4:69879973-69879995 CAGGTGCTGGTAAGGTTGCAGGG + Intergenic
975321169 4:73011507-73011529 CAGATGATGGCCAGGGTGCAGGG + Intergenic
977148408 4:93476735-93476757 CATGTGATGGGAAGTATTCTGGG + Intronic
979881378 4:125963805-125963827 CAGGTGGTGTTAAGTTTGCAGGG + Intergenic
980098544 4:128518464-128518486 CGGGTGGTGGGAAGAGTACATGG + Intergenic
980489269 4:133504952-133504974 TAGGTGATGGTGAGTGTGAAAGG + Intergenic
982235325 4:153246818-153246840 CAGCAGATGGAATGTGTGCACGG - Intronic
983111391 4:163754624-163754646 TAGGTGATGGGAAGAATGGATGG - Intronic
983356956 4:166674801-166674823 CAGGTAATGGGAAATGTCCCAGG - Intergenic
984273315 4:177574809-177574831 CATGTAATGGTAAGTGAGCATGG + Intergenic
984699642 4:182810490-182810512 GTGGTGATAGGGAGTGTGCATGG - Intergenic
984784387 4:183554249-183554271 CAGGTTAGGGTAAGTGTGGATGG + Intergenic
986038102 5:3960174-3960196 CAGGTGCTGGGAAATGTGTTTGG + Intergenic
986754004 5:10817440-10817462 CAGATGCTGGCAAGTTTGCAGGG + Intergenic
988897162 5:35689493-35689515 GAGGAGATGGGGAGAGTGCAAGG - Intronic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
991352409 5:65732892-65732914 CAGATGATGGTCTGTGTGCAAGG - Intronic
991610623 5:68446152-68446174 GAGGTGATGTAAAGTGTGAAGGG - Intergenic
992426533 5:76663207-76663229 CCGGTGGTGGGAAGTGGCCAGGG + Intronic
992981779 5:82182702-82182724 CAGGTGATAGGGAGTGTGAATGG + Intronic
993004494 5:82415877-82415899 CAGGAGATAGGCAGTGAGCAGGG - Intergenic
993644977 5:90451290-90451312 AAGGTGATGTGAAGAGGGCAAGG + Intergenic
994488559 5:100410945-100410967 CAGATGCTGGGAAGTGGGGAAGG - Intergenic
995506385 5:112864713-112864735 TACGTGATGGGAACTGTACAAGG - Exonic
996014221 5:118514821-118514843 CAGAGGATGGGAAGGGTGCGGGG - Intergenic
996019198 5:118573374-118573396 CTGGGGATGGGAAATGGGCAAGG - Intergenic
996354689 5:122582519-122582541 CAGGTGATGAGAACTCTGTATGG - Intergenic
997079905 5:130726033-130726055 AAGGGGCTGGGGAGTGTGCAGGG - Intergenic
999686802 5:154110534-154110556 GAGGTGAGGGGATGTGTCCAAGG + Intronic
1002337670 5:178491443-178491465 CAGAGGAAGGGAACTGTGCACGG + Intronic
1002657873 5:180767107-180767129 CAGCTGAGGGGAGGTGGGCAAGG - Intergenic
1003499888 6:6695363-6695385 CAGGTGCTGGGAAGACAGCAAGG + Intergenic
1004128387 6:12896407-12896429 CAGGTGACGGGAATTGTCAAGGG - Intronic
1004251354 6:14025542-14025564 CAGGTGCTGGGAAGGCAGCAGGG - Intergenic
1004643995 6:17542097-17542119 CAGGGGCTGGGAGGGGTGCAGGG - Intronic
1006168939 6:32081969-32081991 GGGCTGAAGGGAAGTGTGCATGG + Intronic
1006345633 6:33479640-33479662 CAGGAGATGGAACATGTGCATGG + Intergenic
1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG + Intergenic
1008851450 6:56027313-56027335 CAGGAAATGGGAAGTGGGGAGGG + Intergenic
1009531725 6:64826155-64826177 CAGGTCAAGGGAACTATGCAAGG - Intronic
1009635482 6:66259656-66259678 CAGAGAGTGGGAAGTGTGCAAGG + Intergenic
1014313700 6:119837211-119837233 CTGGTGATGGAAAAAGTGCAGGG + Intergenic
1014992728 6:128102624-128102646 CAGGTGGAAGAAAGTGTGCATGG + Intronic
1015384909 6:132610837-132610859 TTGGTGATGGGAGGTGTGCAGGG + Intergenic
1016326462 6:142908134-142908156 CAGGAGATGGGAAATATACAAGG - Intronic
1016330998 6:142951794-142951816 CTGGGGATGAGAAGGGTGCAGGG + Intergenic
1016772540 6:147868160-147868182 CAGATGAAGGTAAATGTGCAGGG + Intergenic
1016836111 6:148478542-148478564 GAGGTGAGGGGAAGTATGGATGG + Intronic
1017124417 6:151052048-151052070 CAAGGGATGGGATGTGAGCAAGG + Intronic
1017801060 6:157896996-157897018 CAGGTGAGGAGAGGGGTGCAAGG + Exonic
1018101424 6:160444492-160444514 GAGGTGATGGAATGTGTGCCCGG - Intronic
1018177430 6:161189340-161189362 CAGGTGATGGGTGGGGTCCAGGG + Intronic
1018985036 6:168629775-168629797 CCAGTGATGGGAACTCTGCATGG - Intronic
1020192128 7:6008705-6008727 CCTGTGATGGGATGTGGGCAAGG + Intronic
1022960239 7:35419192-35419214 GAGGTGATGGTGGGTGTGCAGGG - Intergenic
1023048062 7:36228763-36228785 CATGTGAGGAGAAGTGTGCCAGG + Intronic
1023594493 7:41814794-41814816 CAGGTGATGGGAGGGTTGCCAGG + Intergenic
1023817511 7:43961953-43961975 CAGGTGAGGGGACCTGGGCAGGG - Intergenic
1024245950 7:47470810-47470832 CAGGTGGAGGGAATTGTGAACGG - Intronic
1024581738 7:50806233-50806255 CAGGAGAAGGGAAGGGGGCAAGG - Intergenic
1026091139 7:67302098-67302120 CCTGTGATGGGATGTGGGCAGGG + Intergenic
1026340629 7:69431083-69431105 AGGGTGATGGGAGGTGGGCAGGG - Intergenic
1026745287 7:73006430-73006452 CCTGTGATGGGATGTGGGCAGGG - Intergenic
1027031395 7:74891103-74891125 CCTGTGATGGGATGTGGGCAGGG - Intergenic
1027098455 7:75358666-75358688 CCTGTGATGGGATGTGGGCAGGG + Intergenic
1027951513 7:84822807-84822829 CAGGTTATGGGAAGGGTGGAGGG - Intergenic
1028663529 7:93313267-93313289 CAAGTCAAGGGAAGTGGGCAGGG + Intronic
1029399564 7:100335559-100335581 CCTGTGATGGGATGTGGGCAGGG + Intergenic
1030170477 7:106597282-106597304 CAGGTGATATGATGTGTGAAAGG + Intergenic
1030474590 7:110014855-110014877 CCGGTAAAGTGAAGTGTGCATGG + Intergenic
1031496370 7:122453809-122453831 CAGGTGATGACAAGTGAGAAAGG + Intronic
1034009295 7:147510330-147510352 GAGGTAATGGAAAGTCTGCATGG - Intronic
1035082960 7:156233058-156233080 CAGGTGAGGGCAAGAGTCCACGG + Intergenic
1035342761 7:158174825-158174847 CAGGTGAGGGGTATGGTGCAGGG - Intronic
1038127810 8:24693753-24693775 CAGGTGAGGGGAAGTGTGATCGG + Intergenic
1038447009 8:27611378-27611400 GAGGGGATGGGCAGTGTGGAGGG - Intronic
1038618697 8:29119460-29119482 CAGGTGAAGGGGAGTGGGGAGGG - Intronic
1041235056 8:55792588-55792610 ATGGTGTTGGGAAGTTTGCATGG + Intronic
1042442513 8:68844767-68844789 CAGGTTATGGGAACGGTGGAGGG - Intergenic
1043064788 8:75555046-75555068 CAGGTGATGGGAGGCGTGAGAGG - Intronic
1044985564 8:97753646-97753668 CTGGGGATGGAAAGTGTGCAAGG + Intergenic
1046637251 8:116683603-116683625 TTGGTGATGGTACGTGTGCATGG + Intronic
1046671011 8:117056328-117056350 GTGGTGATGGAAAGTGAGCAGGG - Intronic
1047750449 8:127876602-127876624 CAGGAGATGGGAAGAGTGTACGG - Intergenic
1048107740 8:131429685-131429707 CATGTGGTGGGATGGGTGCAAGG + Intergenic
1049045515 8:140148139-140148161 CAGGGCTAGGGAAGTGTGCAGGG + Intronic
1049385928 8:142342994-142343016 CAGGTGCTGGGACAGGTGCAGGG - Intronic
1052830195 9:33208929-33208951 CAGGGGATTGGAAGTTTGTAGGG + Intergenic
1055445884 9:76382053-76382075 GAGGAAATGGGAAGTATGCAGGG - Intergenic
1055800208 9:80026849-80026871 TAGGTGTTGGAAAGTGTGGATGG - Intergenic
1056074577 9:83025281-83025303 CATGTGGTGGGCAGTGTGCAGGG + Intronic
1056099269 9:83285184-83285206 CATGTGATGGCAAGTGTGTGTGG - Intronic
1057282057 9:93720246-93720268 CAGGTGAGGAGATGGGTGCAAGG + Intergenic
1059903345 9:118953452-118953474 CAGGTTATGGGAGTTCTGCAAGG + Intergenic
1059930088 9:119251742-119251764 TAGTTGATGGGATGTGGGCATGG + Intronic
1059956678 9:119523237-119523259 CAGGTGATGGGGAAAGTACAAGG + Exonic
1060272706 9:122158295-122158317 GAGGTGGTGGGAAGAGTGGAAGG - Intronic
1060477644 9:123998213-123998235 CAGTTGGTAGGAAGTGGGCAGGG - Intergenic
1060533660 9:124365329-124365351 CAGGTGATGGAGACTGGGCAGGG + Intronic
1060975848 9:127764567-127764589 CAGGTGAGGGGGAGTGTGGTGGG - Intronic
1062289270 9:135787250-135787272 CTTGTGGTGGGAAGTGTGCTTGG + Intronic
1185500188 X:591059-591081 CATGTGATTGGAGGTGGGCAGGG - Intergenic
1186793604 X:13023185-13023207 CAGGTGAGACTAAGTGTGCAGGG + Intergenic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1189704794 X:43749230-43749252 GAGGTGGTGGTAAATGTGCAAGG + Intergenic
1190145296 X:47885663-47885685 CACGTGGTGGAAAGTGTGGAAGG + Intronic
1191013174 X:55782555-55782577 AAGGTGCAGGGAAGTGTGTATGG - Intergenic
1193047426 X:77067874-77067896 AAGGTGAAGGGAACTGTCCAAGG - Intergenic
1195727649 X:107934758-107934780 CAAGTGAAGTGAAGTGTGTATGG - Intergenic
1196686361 X:118513830-118513852 CAGGTGCTCTGAAGTGTGCCTGG - Intronic
1197899950 X:131359993-131360015 CAGGTGTTGGGAAGTTTACAGGG - Intronic
1197905226 X:131417782-131417804 CAGGGGAAGGGAAGTGTCCTGGG - Intergenic
1199731800 X:150640917-150640939 TAGGGGATGGGAGGGGTGCATGG + Intronic
1200787267 Y:7272182-7272204 AAGGTGTTGTGAAATGTGCAGGG + Intergenic