ID: 1092173249

View in Genome Browser
Species Human (GRCh38)
Location 12:6386097-6386119
Sequence GGAAGTGCCCGGCCTTGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092173249_1092173261 21 Left 1092173249 12:6386097-6386119 CCCCTGCAAGGCCGGGCACTTCC 0: 1
1: 0
2: 1
3: 7
4: 165
Right 1092173261 12:6386141-6386163 CCCGCTGCCAGCCCCACACCAGG 0: 1
1: 0
2: 5
3: 41
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092173249 Original CRISPR GGAAGTGCCCGGCCTTGCAG GGG (reversed) Exonic
900117818 1:1035973-1035995 GGAAGTGGTCAGCTTTGCAGAGG + Intronic
900214736 1:1475393-1475415 GGGAGGGGCCGGGCTTGCAGAGG - Intronic
900221946 1:1513743-1513765 GGGAGGGGCCGGGCTTGCAGAGG - Intronic
900241730 1:1620538-1620560 GGAGGTGGACGGCCTGGCAGGGG + Intronic
902896910 1:19485489-19485511 GGAAGCGCCGGGCCCTGCTGCGG - Intronic
903016085 1:20362750-20362772 GGATGTTCCAGACCTTGCAGAGG - Intergenic
904682791 1:32240726-32240748 GGAAGCGCCGGGCCTGGAAGAGG - Intergenic
906530294 1:46520028-46520050 GGAAGTGCCCAGCCCTAAAGGGG - Intergenic
906537182 1:46557815-46557837 GGAAGTTCATGGGCTTGCAGTGG + Exonic
907314174 1:53558067-53558089 GGCAGTGCCCAGCCCTGCAGTGG + Intronic
908670630 1:66543698-66543720 GGAAGGGCCAGGACTTGAAGAGG + Intronic
910993466 1:93079436-93079458 GTAAGTGCTCGGACTCGCAGGGG + Exonic
911216389 1:95200144-95200166 GGGAGACCCCAGCCTTGCAGTGG + Intronic
915470649 1:156123869-156123891 AGAAGTGCTGGGCCTGGCAGGGG - Intronic
922205081 1:223439205-223439227 AGTAGTTCCAGGCCTTGCAGGGG + Intergenic
922485915 1:225972854-225972876 GGAAGTCCTCGGCCTTGCCCCGG + Intergenic
922706472 1:227793270-227793292 GGCTGTGCCAGGCCTCGCAGGGG + Intergenic
1066586559 10:36943010-36943032 GGAAGTCCATGGGCTTGCAGTGG + Intergenic
1067533412 10:47091147-47091169 AGAAGTGCCCTTCCTGGCAGAGG + Intergenic
1068078432 10:52288256-52288278 GAAAGTGCTCGGCATTTCAGTGG + Intronic
1069019168 10:63466084-63466106 AGTAGTGCCCGGCCCTGCGGAGG + Intergenic
1070763816 10:79044980-79045002 GGCAGAGCCAGGCCTTGCTGGGG - Intergenic
1075782728 10:125027290-125027312 GCAGGTGACCGGCCTTGCATTGG + Exonic
1075875837 10:125804874-125804896 GGAAGTTCCCAGCCTAGCTGGGG - Intronic
1076373592 10:129969398-129969420 CTAAGTGCCCGGCCCCGCAGCGG + Intergenic
1076861725 10:133141081-133141103 GGGAGGCCCCAGCCTTGCAGGGG - Intergenic
1078653874 11:13220410-13220432 GGAAGAGCCAGGCCTTGGTGAGG - Intergenic
1083492022 11:63020491-63020513 GGGAGTGTCGGGCCTTGCTGAGG - Intergenic
1083652087 11:64209618-64209640 GGAAGGGCCCAGCCTGGGAGGGG + Intronic
1084789353 11:71463602-71463624 GGAAGTGCCCGGGCTTAGTGAGG + Intronic
1085040334 11:73323122-73323144 GGAAGTGCCCTGCCTCTCAGGGG + Intronic
1089342713 11:117770233-117770255 CACAGTGCCAGGCCTTGCAGAGG - Intronic
1090400962 11:126447948-126447970 GGCAGTGCGCTGCCTTGCTGCGG + Intronic
1091321658 11:134656517-134656539 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321670 11:134656573-134656595 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321684 11:134656629-134656651 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321698 11:134656685-134656707 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321706 11:134656713-134656735 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321714 11:134656741-134656763 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321730 11:134656797-134656819 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321738 11:134656825-134656847 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321754 11:134656881-134656903 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321786 11:134657021-134657043 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1092173249 12:6386097-6386119 GGAAGTGCCCGGCCTTGCAGGGG - Exonic
1096236620 12:49932535-49932557 GGAAGAGCCTGGCTATGCAGAGG - Intergenic
1099127198 12:78777074-78777096 GGAAGGGCCTGGCCTGACAGAGG + Intergenic
1103623009 12:122200344-122200366 GGCAGTGCCCGGCCATCCACAGG + Intronic
1105307966 13:19182147-19182169 GTAAGCTCCCAGCCTTGCAGTGG + Intronic
1113675141 13:112202000-112202022 GGAAGGGCTCTGGCTTGCAGAGG - Intergenic
1113676193 13:112209470-112209492 GGCAATGCCAGGCCTTGGAGAGG - Intergenic
1114309744 14:21456031-21456053 GGAAGTACCAGGACTTGCACAGG - Intronic
1123993903 15:25704849-25704871 AGAAATGCCAGGCCTTCCAGAGG - Intronic
1126238646 15:46415695-46415717 GTAGGTGCCCTGCCTGGCAGGGG + Intergenic
1127920967 15:63493837-63493859 TGAAGTGTCCAGCCTGGCAGTGG - Intergenic
1128431520 15:67599652-67599674 GGAATTGCACTGCCTTGCATGGG - Intronic
1128711053 15:69872288-69872310 GGAAGCGCCAGGGCATGCAGGGG - Intergenic
1132279588 15:100601939-100601961 GCAAGTGCCCGGTCTTGGCGCGG - Intronic
1132626027 16:891973-891995 TCAAGTGCCCCGCCTTGCTGAGG - Intronic
1132837545 16:1961827-1961849 GGAAGTGCCTGGCCAAACAGAGG + Exonic
1135253803 16:20924027-20924049 CGAAGTCCCCGGCCTCGGAGTGG - Exonic
1136298783 16:29319506-29319528 GGAAGTGGCCAGGCATGCAGTGG + Intergenic
1137673385 16:50292016-50292038 GAGAGGGCCCGGCCTTGGAGCGG - Intronic
1138552557 16:57755495-57755517 GCAAGTGCCCACCCTTGCACAGG + Intronic
1139514926 16:67447226-67447248 GGAAGTGCTGGGCCTGGCACAGG - Intronic
1139767606 16:69244817-69244839 AGGAATGCCCAGCCTTGCAGGGG - Intronic
1142060451 16:88026004-88026026 GGAAGTGGCCGGGCGTGCAGTGG + Intronic
1142299369 16:89247577-89247599 TGAAGGGGCGGGCCTTGCAGGGG + Intergenic
1142876440 17:2854108-2854130 GGAAGCGGCCGGCGCTGCAGGGG - Intronic
1143400238 17:6638657-6638679 GGCAGTGCCTGGGCTTGGAGAGG - Intronic
1146370826 17:32265059-32265081 GCTAGTGGCCGGCCTGGCAGGGG - Intergenic
1146431607 17:32801469-32801491 GGAAGTGGCCTGCATGGCAGGGG + Intronic
1146679326 17:34795864-34795886 GGAACTGCCCAGTCTTGTAGGGG + Intergenic
1147469741 17:40648144-40648166 GGAGGTGCCGAGCCTTGCGGAGG + Exonic
1149495376 17:57114143-57114165 GGTAGTGCTGGGCCTTGCACAGG - Intronic
1150344083 17:64390899-64390921 GGAAATGACCGGCCTTCCTGAGG + Intronic
1151949893 17:77345737-77345759 GGAGCTGCCAGGCCTTGCTGAGG - Intronic
1152205334 17:78971635-78971657 TGAAGTGCCCTGCCGGGCAGGGG + Exonic
1152691957 17:81722401-81722423 GGCAGGGCCAGGCCTGGCAGTGG + Intergenic
1152711308 17:81871551-81871573 GGAAGTGCCCTGGCTTACAGAGG - Intergenic
1152750610 17:82060826-82060848 GTGGGAGCCCGGCCTTGCAGGGG - Intronic
1154255460 18:12777645-12777667 GGAAGGGCCCCGCCTCGGAGCGG - Intergenic
1160844430 19:1160187-1160209 GGAAGGGCTGGGCCTGGCAGAGG + Intronic
1160921736 19:1523963-1523985 GGAGGTGCCCGGCCGTGGAGTGG - Intergenic
1161578064 19:5065774-5065796 AGAAGCCCCCGGCCGTGCAGAGG - Intronic
1162144402 19:8605099-8605121 GGGAGGGCCTGGCCTGGCAGAGG - Exonic
1162440982 19:10691891-10691913 GGAGGGGCAGGGCCTTGCAGGGG + Exonic
1163844109 19:19628803-19628825 GGCAGGGCCGGGCTTTGCAGGGG - Exonic
1165171510 19:33895105-33895127 GCATGTGCACGGCATTGCAGTGG - Intergenic
1167521412 19:49958322-49958344 GGACGTTCCAGGCCTTACAGCGG + Exonic
925321835 2:2976337-2976359 GGAGGTGAACGGCCTTGGAGAGG + Intergenic
926717953 2:15939811-15939833 GGAGCTGCCCGGCCTTGGCGCGG - Intergenic
927040002 2:19219416-19219438 GGAAGAGCCCAGCCTAGCAAAGG - Intergenic
934640295 2:96023784-96023806 GGCAGCCCCTGGCCTTGCAGCGG - Intronic
934754414 2:96815890-96815912 GGAAGTTCCCGGCTTGGGAGCGG - Intergenic
934793355 2:97081632-97081654 GGCAGCCCCTGGCCTTGCAGCGG + Intergenic
935649331 2:105368855-105368877 GTAAGTGCCCGGACTAGCTGAGG + Intronic
946465790 2:219910763-219910785 GGAAGTTCACTGACTTGCAGAGG + Intergenic
946620122 2:221552601-221552623 TGAAGTGCCCAGCCTGGCAATGG - Intronic
1169277597 20:4244101-4244123 GGAAGGGCCCGGAGTTCCAGAGG - Intronic
1169327466 20:4687008-4687030 GGAAGCGCCAGGCCTTGCCAAGG - Intronic
1171252080 20:23656189-23656211 GGAAGTGCCTGCCCTTGCTTGGG - Intergenic
1174691577 20:52511654-52511676 GGAAGTGCCCTGCTGTTCAGAGG + Intergenic
1176178977 20:63740852-63740874 CGAGGTGTCCGGCCTGGCAGGGG - Intronic
1176233135 20:64042070-64042092 GGAGGTGCCCGGCCTTGCGTGGG + Intronic
1179592088 21:42415547-42415569 GTAAGTGCCCTGCCGTGGAGTGG + Intronic
1181038132 22:20179593-20179615 GGCAGTGCCTGGCCTGGCACAGG - Intergenic
1181560619 22:23697558-23697580 GGAACTGCCTGCCCTTGGAGAGG - Intronic
950414649 3:12861982-12862004 GGAAGTGCCAGCCCTTTGAGAGG + Intronic
950673309 3:14539984-14540006 GGCAGTGCTCAGCCTTGTAGGGG - Intronic
953697211 3:45169496-45169518 GAAATTGCGGGGCCTTGCAGGGG + Intergenic
957084260 3:75665634-75665656 GGAAGTTCCAGGGCTTGCACTGG + Exonic
959457449 3:106580408-106580430 GCAAGGGCCAGGCCATGCAGGGG + Intergenic
961442342 3:126960501-126960523 GGGAGTCCCTGGCCTGGCAGGGG + Intergenic
961450056 3:126998612-126998634 GGAAGTGCTTGGCCCTGCTGTGG - Intronic
967136515 3:186517055-186517077 GGAAGTGCCAGACATGGCAGTGG + Intergenic
968117102 3:196098879-196098901 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117110 3:196098909-196098931 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117118 3:196098939-196098961 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117127 3:196098969-196098991 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117170 3:196099119-196099141 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117179 3:196099149-196099171 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117188 3:196099179-196099201 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117205 3:196099239-196099261 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117250 3:196099394-196099416 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117291 3:196099544-196099566 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117315 3:196099634-196099656 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117333 3:196099694-196099716 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117341 3:196099724-196099746 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117348 3:196099754-196099776 GGAAGTGCTGGGCATTGAAGGGG + Intergenic
968117362 3:196099814-196099836 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117371 3:196099844-196099866 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117380 3:196099874-196099896 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117397 3:196099934-196099956 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117423 3:196100021-196100043 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117431 3:196100051-196100073 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968117439 3:196100081-196100103 GGAAGTGCTGGGCGTTGAAGGGG + Intergenic
968509090 4:987498-987520 GGGAGTGGACGGCCCTGCAGCGG + Intronic
968521249 4:1035766-1035788 GCCAGGGCCCGGCCCTGCAGAGG + Intergenic
968549335 4:1214246-1214268 GCAAGTGTCCGGCCTGGCAGAGG + Intronic
971128801 4:23783058-23783080 GACAGGGCCCGGCCATGCAGAGG + Intronic
974904036 4:68034515-68034537 GGAAGTGCAGGGCTATGCAGTGG + Intergenic
996732421 5:126728660-126728682 GTAAGTGCCTGGCTTTCCAGTGG + Intergenic
997568105 5:134904984-134905006 GGAAGCGCCCAGCCTTCCCGCGG - Intronic
1002080089 5:176732602-176732624 GGAAGGAGCCTGCCTTGCAGAGG - Intergenic
1003908863 6:10725679-10725701 GGAAGTGCCCTGCCTATTAGAGG + Intronic
1003911924 6:10750907-10750929 GGAAGTGCCCTGCCTATTAGAGG + Intronic
1004943483 6:20586344-20586366 GGAAGTGCTCGGCCAGGCACAGG + Intronic
1005840340 6:29741070-29741092 GGAAGACACCTGCCTTGCAGAGG - Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1017931750 6:158961537-158961559 GGAAGTACCAGGCCTTCCCGTGG - Intergenic
1020083389 7:5298046-5298068 AGGAGTGCCAGGCCATGCAGAGG + Intronic
1022876236 7:34533573-34533595 GGAAGTGGCTGCCTTTGCAGAGG - Intergenic
1023836757 7:44073161-44073183 GGAAGAGCCAGGCCTTGGCGGGG + Exonic
1025210886 7:57019153-57019175 AGGAGTGCCAGGCCATGCAGAGG - Intergenic
1025661069 7:63557694-63557716 AGGAGTGCCAGGCCATGCAGAGG + Intergenic
1025762466 7:64407328-64407350 GAAAGTGCCCCGCCGAGCAGTGG - Intergenic
1026963507 7:74424722-74424744 GGGAGTGCCCAGCCCTGCTGAGG + Intergenic
1034285150 7:149879293-149879315 GAAGGGTCCCGGCCTTGCAGTGG - Intronic
1037876508 8:22551475-22551497 GGAAGCGAGCGGCCTCGCAGCGG - Intronic
1037987803 8:23300429-23300451 GGAAGTGACCGTCCACGCAGAGG - Intronic
1038309669 8:26436702-26436724 GGAAGAAGCCAGCCTTGCAGAGG + Intronic
1044717371 8:95112936-95112958 GGCAATGCCTGGCCTGGCAGTGG - Intronic
1045941778 8:107747170-107747192 GAAAGTGCCCTGCCTCTCAGTGG - Intergenic
1049758109 8:144319766-144319788 GGAGGTTCCTGTCCTTGCAGAGG - Intronic
1056403242 9:86248664-86248686 GGGAGTGCCAGGCCCAGCAGGGG - Intronic
1056785738 9:89591483-89591505 GCATGTGCCCGGACATGCAGGGG + Intergenic
1058467495 9:105244413-105244435 GGAAGGGCCCGGCCTTGTTCTGG + Intergenic
1059281370 9:113136792-113136814 TGAAGTGCCCAGCATGGCAGTGG - Intergenic
1060970178 9:127733363-127733385 GGTGGGGCCCGGCTTTGCAGTGG - Exonic
1061268889 9:129525098-129525120 TGAAGTGCCAGGGCCTGCAGGGG + Intergenic
1062396964 9:136356466-136356488 GGAGGTGCCCTGCATTGCTGTGG - Exonic
1203778469 EBV:87499-87521 GGAAGGGCCCGGCCTTTCAGGGG - Intergenic
1187699996 X:21956009-21956031 GGAAATGCTCTCCCTTGCAGTGG + Intronic
1189205904 X:39238593-39238615 GGAAGTTCCTGGCCCTGCACTGG - Intergenic