ID: 1092173423

View in Genome Browser
Species Human (GRCh38)
Location 12:6387550-6387572
Sequence TGGGAGGCCTGGGGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 0, 2: 11, 3: 68, 4: 690}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092173423_1092173428 -6 Left 1092173423 12:6387550-6387572 CCAGTTTCTCCCCAGGCCTCCCA 0: 1
1: 0
2: 11
3: 68
4: 690
Right 1092173428 12:6387567-6387589 CTCCCATCCCATATTCCCTTAGG 0: 1
1: 0
2: 3
3: 21
4: 188
1092173423_1092173435 21 Left 1092173423 12:6387550-6387572 CCAGTTTCTCCCCAGGCCTCCCA 0: 1
1: 0
2: 11
3: 68
4: 690
Right 1092173435 12:6387594-6387616 AGATTTACATGAATGAGAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092173423 Original CRISPR TGGGAGGCCTGGGGAGAAAC TGG (reversed) Intronic
900097332 1:945272-945294 GAGGAGCCCTGGGGAGGAACTGG + Intronic
900123024 1:1057338-1057360 TGTGAGCCCTGGGGAGAAGCAGG + Intergenic
900150456 1:1176704-1176726 GGGGAGGCCCGGGGAGATACAGG - Intronic
900156543 1:1205535-1205557 GGGGAGGCCTGGGGAGGAGGGGG - Intronic
900391745 1:2436656-2436678 TGGGAGGCCTGGAGAGGCAGGGG + Intronic
900834183 1:4987412-4987434 TGGGAGGACTGGGGGGACGCAGG - Intergenic
900867758 1:5280618-5280640 TGGGAGGTCAGAGGAGTAACAGG - Intergenic
901000175 1:6145095-6145117 AGGGAGGCCTGGGGAGGAAAAGG + Intronic
901059041 1:6463218-6463240 TGAGAGGCCTGGGGAGGGAAGGG - Intronic
901224767 1:7606838-7606860 TGGGATGGCTGGGGAGGAAATGG + Intronic
901508389 1:9701013-9701035 TGGAAGGACTGCGGAGAAGCAGG - Intronic
903126894 1:21254509-21254531 TAGGATGCCTGGGGGGAACCTGG + Intronic
903141429 1:21341544-21341566 GGGGAGGCCAGGGGAAGAACAGG - Intronic
903286457 1:22280085-22280107 TGGCAGGGATGTGGAGAAACTGG + Intergenic
905350641 1:37344101-37344123 TGAGAGGCCTGGGGAGAAAAGGG - Intergenic
905750258 1:40456239-40456261 TGGGGAGACTGTGGAGAAACAGG - Intronic
905800461 1:40839197-40839219 GGAGAGGGCAGGGGAGAAACAGG - Exonic
906105399 1:43288890-43288912 GGGGAGGCCAGGGTAGAAGCAGG + Intergenic
906340103 1:44972077-44972099 TGGGAAGGATGTGGAGAAACTGG + Intronic
906640110 1:47436760-47436782 AGGGAGGCCGGGGGAGAAAGAGG + Exonic
907085325 1:51667365-51667387 TGGGAGGGTTGGGGTGAAATGGG - Intronic
907563221 1:55410383-55410405 GTGGAGGCCTGGGAAGAAAACGG + Intergenic
908067610 1:60424390-60424412 TGGGATGGCAGGGGAGAAAAGGG - Intergenic
908673305 1:66573048-66573070 TGGGAGGGTTGGGGGGAAATGGG + Intronic
909891497 1:81013357-81013379 TGGCATGGCTGTGGAGAAACAGG - Intergenic
910218201 1:84863648-84863670 TGAGAGTCCTGGGGGGAAACTGG - Intronic
911208398 1:95116059-95116081 TGAGAGTCTTGGGGAGAAAAAGG + Intergenic
912451457 1:109770107-109770129 TGGGAGGGCAGGGGAGAAGGTGG + Intronic
912517716 1:110226531-110226553 AGGGAGGCCTAGGGAGAGGCTGG - Intronic
912778530 1:112522781-112522803 GGGGATGCCTGTGGAGAAATGGG + Intronic
912900305 1:113640238-113640260 TGGCAAGGCTGTGGAGAAACAGG + Intronic
913239828 1:116820288-116820310 TGGAAGGCCTGGGTTGAAATAGG + Intergenic
913728798 1:121686513-121686535 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913729101 1:121690242-121690264 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913729249 1:121692107-121692129 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913729401 1:121693972-121693994 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913736628 1:121792073-121792095 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913748216 1:121931076-121931098 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913748367 1:121932941-121932963 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913748756 1:121937742-121937764 TTCGAGGCCTGGGGAGGAAAAGG - Intergenic
913749241 1:121943448-121943470 TTCGAGGCCTGGGGAGGAAAAGG + Intergenic
913751182 1:121969019-121969041 TTCGAGGCCTGGGGAGGAAAAGG + Intergenic
913758929 1:122109326-122109348 TTCGAGGCCTGGGGAGGAAAAGG + Intergenic
913767181 1:122204967-122204989 TTCGAGGCCTGGGGAGGAAAAGG + Intergenic
915447492 1:155982226-155982248 GGGGAGGCCAGGGGAGGAAAAGG + Intronic
915613344 1:157013904-157013926 TGGGAGGACTGGGGATACAAAGG - Intronic
915839049 1:159201023-159201045 TGGGTGGGCTGGGGAGCAAGCGG - Exonic
915903231 1:159861158-159861180 TGGGAGACTTGAGGAGAGACAGG + Intronic
916408018 1:164516738-164516760 AGGGAGGGCTGGGGAGAGAAAGG - Intergenic
916710994 1:167408240-167408262 TGGGAAGGATGTGGAGAAACTGG + Intronic
916934724 1:169615780-169615802 TAGGAGGCTTGGGGAGAAGAGGG + Intronic
917361116 1:174177113-174177135 TGGCAAGGCTGTGGAGAAACAGG - Intronic
918675604 1:187281276-187281298 TGGGAGGAATGGGGTGAAGCAGG - Intergenic
919396254 1:197052280-197052302 TGGTAAGGCTGGGGAGAAATAGG + Intronic
920051682 1:203168181-203168203 AGGGAGGCCTGGTGAGGAAGAGG - Intronic
921783387 1:219196309-219196331 TGGCAAGGCTGTGGAGAAACAGG - Intronic
921985975 1:221312752-221312774 TGGGAAGGCTGTGTAGAAACTGG - Intergenic
922721128 1:227900788-227900810 TGGGAGTGCTGTGGAGAGACAGG - Intergenic
922792367 1:228317449-228317471 AGGGAGGCCTGGGGAAAAGGGGG - Exonic
922971919 1:229749205-229749227 TGGGAGGCTTGGGGAGATGATGG + Intergenic
923756558 1:236795933-236795955 TGGCTTGCCTGGGGAGAAAGAGG - Intronic
924470212 1:244336677-244336699 TGGGAGGCCTGGTGACCAGCTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924606746 1:245541949-245541971 TGGAAGGACACGGGAGAAACTGG - Intronic
1062769141 10:85838-85860 TGGGAGGCCTGGGAAGTGGCGGG + Intergenic
1062986366 10:1772880-1772902 TGGGTGCCCTGGAGAGAAAGGGG + Intergenic
1063392772 10:5661070-5661092 TGGGATGACTGAGGAGATACTGG - Intronic
1063972005 10:11387680-11387702 TGTGAGGGCTGGAGAGAGACAGG - Intergenic
1064126521 10:12666284-12666306 AGGGAGACCTGGTGAGACACTGG - Intronic
1064419208 10:15175976-15175998 TGGGAGGAGTGGGGGGAAAGAGG + Intergenic
1064471543 10:15640659-15640681 TGAGATGCCTGGGTGGAAACTGG + Intronic
1065389212 10:25165028-25165050 TGGTAGGGATGTGGAGAAACAGG - Intergenic
1066004533 10:31134258-31134280 GGGGAGGCCCGGGGAGACAGAGG + Intergenic
1066525648 10:36276263-36276285 TGGCAGGGCTGTGGAGAAACAGG + Intergenic
1066811599 10:39345049-39345071 TTTGAGGCCTGTGGAGAAAAAGG - Intergenic
1066824101 10:39541443-39541465 TTGGAGGCCTGTGGTGAAAAAGG + Intergenic
1066824124 10:39541954-39541976 TTGGAGGCCTGTGGTGAAAAAGG + Intergenic
1066824278 10:39545015-39545037 TTGGAGGCCTGTGGTGAAAAAGG + Intergenic
1067288524 10:44924679-44924701 TGGGAGGACTGAGCAGAAAGCGG + Intronic
1067537713 10:47126934-47126956 GGGGAGGAATAGGGAGAAACAGG - Intergenic
1067837804 10:49652362-49652384 TGGGAAGACTGGGGAGGAACAGG - Intronic
1068185335 10:53578048-53578070 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
1069996352 10:72344391-72344413 TGGGAGACCTGGGGAGAAATGGG + Intronic
1070290279 10:75109300-75109322 GGGGAGGCTTGGGGAGGAAAAGG - Intronic
1070440234 10:76435931-76435953 TGTGAGGGTTAGGGAGAAACTGG + Intronic
1070784156 10:79153519-79153541 TGGAAGGCCAGGGAAGAAAGGGG - Intronic
1071344566 10:84680282-84680304 CTGGAGGCCAAGGGAGAAACTGG + Intergenic
1072932818 10:99681669-99681691 TGGCAGGGCTGTGGAGAAATTGG - Intronic
1073126983 10:101157188-101157210 TGGGAGGCCTGGGGATCCTCCGG - Intergenic
1073143946 10:101266871-101266893 TGGGAGGCCTGGGGTGAGAGAGG - Intergenic
1073184522 10:101607698-101607720 TGAGAGGCCTGGGGAGGATGGGG - Intronic
1073306539 10:102507216-102507238 TGGGAGACTTGGTGAGAAAGAGG + Intronic
1073359267 10:102884386-102884408 TGGGAGGGCAGGGGTGGAACAGG - Intronic
1073896399 10:108165035-108165057 TTGGAGTCATGGGAAGAAACAGG - Intergenic
1074353314 10:112759043-112759065 GGGGAGGCCTGGGAGGGAACAGG - Intronic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1074865932 10:117544236-117544258 TCGGAGGCCTGGGGAGGGGCGGG + Intronic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1076429070 10:130388958-130388980 CGGCAGGCCTGGGGAGAAACAGG - Intergenic
1076836007 10:133021231-133021253 AGGGAGGGCTGGGGAGGAGCAGG + Intergenic
1076902869 10:133348272-133348294 TGGGGGTCCTGAGGAGAAGCAGG + Intronic
1077024407 11:432846-432868 CTGGAGGACTGGGGAGAAGCAGG + Intronic
1077129849 11:965739-965761 TGGGAGCCCAGGGGAGTTACTGG + Intronic
1077343129 11:2034896-2034918 AGGGAGGCCTGGGGAGCCACAGG - Intergenic
1077502841 11:2917043-2917065 AGAGAGGCCTGGGGAGGACCAGG + Intronic
1077677885 11:4213736-4213758 GGGGAGGCCTGTGGAGTGACCGG + Intergenic
1077911651 11:6577164-6577186 TGGGGGGAGTGGGGAGGAACAGG + Intronic
1077936233 11:6789759-6789781 TGGTAGGTATGGGGAGAAAATGG + Intergenic
1078325187 11:10374935-10374957 TGGAAGGCCTTTAGAGAAACAGG + Intronic
1078531875 11:12142890-12142912 AGGGAGGGCTGGGGAAAAATAGG + Intronic
1078587428 11:12604683-12604705 TTGCAGGCCTGGGGACCAACAGG + Intergenic
1079122466 11:17695757-17695779 TGGGGGTGCTGGGGAGAGACGGG + Intergenic
1079877268 11:25875532-25875554 TGGAAAGCCTGTGGAGAAATAGG - Intergenic
1080023473 11:27588935-27588957 TGGCAGGGCTGTGGAGAAAAGGG - Intergenic
1080342219 11:31278518-31278540 TGGGAGGACTGGGAAGATATTGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081030361 11:38073297-38073319 TGATTGGCCTGGGTAGAAACAGG - Intergenic
1081566835 11:44265545-44265567 TGAGGGGCCTGGGGAGGAGCTGG - Intronic
1081619684 11:44611897-44611919 AGGGAGGCTGGGAGAGAAACAGG + Intronic
1081695870 11:45108716-45108738 AGGCAGGGCTGGGGAGAAATGGG - Intronic
1081794557 11:45810641-45810663 AGGGAGGCCTGGGGAGGAACGGG + Intronic
1082315909 11:50721456-50721478 TGTGAGGCCTGTGGAGGAAAAGG - Intergenic
1082583281 11:54900833-54900855 TTGGAGGCCTGTGGTGAAAAAGG + Intergenic
1082848001 11:57741719-57741741 TGAGGGGCCTGGAGAGTAACGGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083378110 11:62242636-62242658 TGTGAGGTCTGGGGTGAATCTGG + Intronic
1083384612 11:62298328-62298350 TGTGAGGTCTGGGGTGAACCTGG - Intronic
1083748416 11:64747464-64747486 TGGCAGCCCTGGGGAGCAGCAGG - Intronic
1084188544 11:67488364-67488386 TGGGAGGAGTGGGGAGGACCCGG + Intronic
1084515170 11:69634087-69634109 GGGGTGGGCAGGGGAGAAACAGG - Intergenic
1085149773 11:74241141-74241163 TGGGAGGGTTGGGGAGAAATGGG - Intronic
1085303802 11:75473859-75473881 TTGGAGGCCTGGGGAAACCCTGG - Intronic
1085832173 11:79912966-79912988 TGGCAAGCCTGTGGAGAAATAGG - Intergenic
1086063540 11:82724029-82724051 TGGGCGGGCGGGGGAGAAGCTGG - Intergenic
1086492810 11:87372422-87372444 AGAGAGGCCTTGAGAGAAACAGG - Intergenic
1087075306 11:94122658-94122680 TGGGAAGCAGGGGCAGAAACAGG + Intergenic
1087122780 11:94592120-94592142 TGGGAGGGGTGGGGAGGAAAAGG - Intronic
1087574446 11:99972687-99972709 TGGGAGGCCTGAGGAGAACCAGG + Intronic
1088270911 11:108033468-108033490 TGGGAGGCCTTGGGTCATACTGG - Intronic
1088500145 11:110474764-110474786 TGGGAGGGCAGGGGAGCAGCAGG + Intergenic
1088647120 11:111926345-111926367 TAAGAGGCCAGGGGAGAAAATGG - Exonic
1088653519 11:111977824-111977846 TGGGGGGCCTGGGTGGGAACAGG + Intronic
1089118501 11:116114935-116114957 GGGGAGGGGTGGGAAGAAACAGG - Intergenic
1089270229 11:117296851-117296873 TGTGAGTCCTGGGGAGAGCCCGG - Exonic
1089314098 11:117578920-117578942 TGGGAAGACTGGGGAGCAATAGG - Intronic
1089680448 11:120116333-120116355 AGGGACGCCTGGGAAGACACAGG + Intronic
1090242720 11:125195420-125195442 TGGGAGGCCTGGGAAGCAGGAGG + Intronic
1090363016 11:126186438-126186460 TCTGAAGCCTGGGGAGAAGCAGG + Intergenic
1091321643 11:134656377-134656399 AGGGAGGTCTGGGGAGAGTCAGG + Intergenic
1202826115 11_KI270721v1_random:90085-90107 AGGGAGGCCTGGGGAGCCACAGG - Intergenic
1202828085 11_KI270721v1_random:99389-99411 TGGGGGGCCTGGGGCGAGAATGG + Intergenic
1091379503 12:47032-47054 TGGGGAGGCTGTGGAGAAACAGG - Intergenic
1091399690 12:174507-174529 AGGGAGGCCAGGGGAGGCACAGG + Intronic
1091767598 12:3131922-3131944 TGAGAGGCCTGGGGGGTCACAGG - Intronic
1091791805 12:3276205-3276227 AGGGAGGCCAGGAGAGCAACTGG - Intronic
1091875866 12:3932309-3932331 TGGGAGGCCTGCAGAGCACCTGG + Intergenic
1091901628 12:4148772-4148794 TGGGAGGCCAGGGGAGAAGCTGG - Intergenic
1091986182 12:4911335-4911357 TGGGAGGCCAGGAGAGAGCCCGG - Exonic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1092917850 12:13204220-13204242 TGGGAAACATGGGGAGAAAAAGG - Intronic
1093210829 12:16306400-16306422 TGGCAAGGCTGTGGAGAAACAGG - Intergenic
1093541427 12:20291105-20291127 TGGGAGGCAGGGCGAGAAATGGG - Intergenic
1093900753 12:24628757-24628779 TGGCAGGGATGTGGAGAAACAGG - Intergenic
1093934812 12:24989193-24989215 TGGGAGGATTGGGGAGATATTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094440176 12:30466569-30466591 AGGGAGGCCTGAGGAGAGAGAGG + Intergenic
1094819951 12:34216534-34216556 TGGGAGGCCGGGGGTGGAAGGGG + Intergenic
1096657061 12:53098333-53098355 GGGGAGGCAGGGGGAGAAATGGG + Intronic
1096659857 12:53117672-53117694 TGGGAGGCCTGGGGAGGCAGTGG + Intronic
1096660122 12:53118996-53119018 TGGGAGGCCTGGGGAGGCAGTGG + Intronic
1096978941 12:55717383-55717405 TGGCAAGCCTGGGGAGCAGCTGG + Intronic
1097188569 12:57208768-57208790 TGGGACGCTTCGGGAGACACTGG + Exonic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1097937691 12:65271949-65271971 TGGCAGCCCTAGAGAGAAACTGG - Intergenic
1098156897 12:67608804-67608826 TGTGTGCTCTGGGGAGAAACTGG + Intergenic
1098918979 12:76285621-76285643 TGGCAGGCCTGGGCAGAGAGTGG - Intergenic
1098978654 12:76931224-76931246 TTGGAAGCCTGAGGAGAAAAGGG - Intergenic
1099286265 12:80717006-80717028 CGAGAGGGATGGGGAGAAACGGG - Exonic
1099658117 12:85521559-85521581 GGGGAGGCTGAGGGAGAAACAGG - Intergenic
1100110718 12:91238662-91238684 TGGGGAGGCTGTGGAGAAACAGG - Intergenic
1100397114 12:94195029-94195051 TGAGAGGTCTGTGGAGAGACTGG + Intronic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1102290480 12:111695186-111695208 TGGCATGCCTGGGGAGCATCAGG - Intronic
1102484697 12:113247808-113247830 TGGAAGGCCTGGGGTGACACTGG - Intronic
1102630698 12:114276428-114276450 TGGGAAGCCTGGTGAGAACTTGG + Intergenic
1103195162 12:119037386-119037408 TGGGAGGCAGGGGGAGAGACAGG + Intronic
1103729369 12:123016681-123016703 TGGTTGGCATGTGGAGAAACTGG + Intronic
1103903275 12:124314560-124314582 CGGGAGCCCTGGGGAGAAGCCGG + Exonic
1104745256 12:131206681-131206703 AGGGGCGCCTGGGGAGGAACAGG - Intergenic
1104789080 12:131470425-131470447 AGGGGCGCCTGGGGAGGAACAGG + Intergenic
1104987015 12:132603016-132603038 TGGGAAGCCTGGGGAGGCACAGG - Intergenic
1105655286 13:22429905-22429927 TGGCAAGGCTGTGGAGAAACAGG - Intergenic
1105947294 13:25201242-25201264 TGGAAAGCTTAGGGAGAAACGGG - Intergenic
1106343730 13:28855906-28855928 TGGCAGGGCTGTGGAGAAATAGG - Intronic
1106925585 13:34609596-34609618 TAGGAGGCCTGTGCAGAAAGTGG - Intergenic
1108230314 13:48332218-48332240 TGGGGAGCCTGGGGAGAATGTGG + Intronic
1108432216 13:50365758-50365780 TGTGAGGCCTGGGGGAAATCAGG + Intronic
1108484040 13:50906923-50906945 TGGCAAGACTGGGGAGAAATAGG - Intergenic
1108598753 13:51972594-51972616 TAGGAGGCCGGGTGAGAAAGAGG - Intronic
1109531397 13:63653267-63653289 TGGCAAGCCTGTGGAGAAATAGG - Intergenic
1110380128 13:74840891-74840913 TTGAAGGCATGGGGATAAACTGG - Intergenic
1111856174 13:93640692-93640714 AGGGAGGACTGAGGGGAAACAGG - Intronic
1111919269 13:94393652-94393674 AGGGAGGAATGGGGAGAAATGGG - Intronic
1112517640 13:100068709-100068731 TGGTAAGCCTGGGGAGAAACAGG + Intergenic
1112761865 13:102700808-102700830 TGTGAGGCCTGGGAAGCAGCAGG + Intergenic
1112836582 13:103522304-103522326 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
1113078971 13:106496571-106496593 TGGCAGCCCTGGAGAGAAAGTGG + Intronic
1113149926 13:107252110-107252132 TGGGAGGCCTGGCGAGGTAGTGG + Intronic
1113392803 13:109914240-109914262 TGGCAGGGATGTGGAGAAACTGG + Intergenic
1113786632 13:113005346-113005368 GGGGAAGCCTGGGGAGATGCTGG + Intronic
1113850120 13:113413192-113413214 GGGGTGGCCAGGAGAGAAACAGG - Intergenic
1113998298 14:16114796-16114818 TTTGAGGCCTGGGGTGAAAAAGG + Intergenic
1114826670 14:26089419-26089441 TGGCAGGCATGGGTAGATACTGG + Intergenic
1115638853 14:35318388-35318410 TGGGAGGGATGGGGAGAAGGTGG - Intergenic
1116062365 14:39939858-39939880 AGAGAGGCCTCAGGAGAAACTGG + Intergenic
1116651024 14:47593239-47593261 TGGCAAGGCTGTGGAGAAACAGG + Intronic
1117385507 14:55208105-55208127 AGGGAGGTATGGGGAGAAAGAGG + Intergenic
1117913550 14:60655761-60655783 TGGGTGTCCTGAAGAGAAACTGG + Intronic
1118394411 14:65323494-65323516 CCGGATGCCTAGGGAGAAACTGG - Intergenic
1118522783 14:66605332-66605354 TGACAAGCCTGGGGAGAAAAGGG - Intronic
1118620480 14:67610054-67610076 AGGCAGCCCTGGGGAGAAGCAGG - Intergenic
1118772132 14:68949254-68949276 TGGGAGCCCTGGGGAGGCACGGG - Intronic
1119541056 14:75438458-75438480 TGGGAGGATTGGGGAGATAATGG + Intronic
1119726100 14:76922663-76922685 GGAGAGGCCTGGGGAGAGAGAGG - Intergenic
1120321297 14:82964923-82964945 TGGGAGGGCTGTGGAGAAATAGG - Intergenic
1121312692 14:92943692-92943714 ACGGAGGCCTGAGGATAAACAGG + Intronic
1121436695 14:93925331-93925353 CAGAAGGCCTGGGGAGAAAAGGG + Exonic
1122189753 14:100031826-100031848 TGTGTGGCCCTGGGAGAAACAGG + Intronic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122341061 14:101028770-101028792 TGACAGGGCTGGGGAGAATCAGG - Intergenic
1122902609 14:104788040-104788062 TGGGAGGGCTGGGCAGAGAGTGG - Intronic
1122918528 14:104869919-104869941 GAGGACGCCTGGGGAGAAGCTGG - Intronic
1123046615 14:105520663-105520685 TGGGAAAACTGGGGAGAAATTGG + Intergenic
1123158932 14:106258386-106258408 TGAGAGGCCTGAGGAGAGAGTGG + Intergenic
1123178430 14:106443747-106443769 TGGGACGCCTGAGGAGAGAGTGG + Intergenic
1123212709 14:106775781-106775803 TGGGACGCCTGAGGAGAGAGTGG + Intergenic
1123897283 15:24841446-24841468 TGGGAGGTTTGGGAACAAACTGG - Intronic
1123967302 15:25471920-25471942 TGGCCGGCCTGGAGAGAAGCAGG + Intergenic
1124490812 15:30153990-30154012 TGGGAGTGCTGGGGAGAGCCAGG - Intergenic
1124717658 15:32080651-32080673 TGGCAGGGCTGTGGAGAAATAGG + Intronic
1124752720 15:32384339-32384361 TGGGAGTGCTGGGGAGAGCCAGG + Intergenic
1125127689 15:36243190-36243212 TGGCAAGACTGTGGAGAAACAGG - Intergenic
1125286695 15:38100918-38100940 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
1125749402 15:42018662-42018684 TGGGAAGCCAGGGGAGAGAGAGG + Intronic
1127042840 15:54996314-54996336 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
1127481881 15:59385225-59385247 TGGCAAGGCTGTGGAGAAACAGG + Intronic
1127711018 15:61598439-61598461 TAGAGGGCCTGGGGAGGAACTGG - Intergenic
1128094614 15:64944233-64944255 TGGGAGGCCTGGAGAAAAGGAGG + Intronic
1129317339 15:74753049-74753071 TGGGAGGGGAGGGGAGGAACAGG - Intronic
1129767675 15:78180714-78180736 CGGGAGGCCTGGGGAGAGAGTGG - Intronic
1130154848 15:81341488-81341510 TGGGAGACATGGGGAGAAGAAGG + Exonic
1130327714 15:82895075-82895097 TAGCATGCCTGAGGAGAAACAGG - Intronic
1130545486 15:84855162-84855184 ATGGAGGCCTGGGTGGAAACTGG - Intronic
1130880479 15:88051297-88051319 TGGGTGGAGTGGGGAGAAAGAGG - Intronic
1130886847 15:88100331-88100353 TGGGAGCCCTGTGGAGAACAGGG - Intronic
1131138018 15:89953300-89953322 TGAGAGGCCCTGGGAGAAGCAGG + Intergenic
1131176653 15:90213492-90213514 TTGGAGGCCTGGGCTGAACCAGG + Intronic
1131459214 15:92606682-92606704 GGGGAGCCCTGGAGAGAAGCAGG + Intergenic
1131873461 15:96782410-96782432 TGGGAGGGCTGGAGAGAGAGAGG + Intergenic
1132293789 15:100720413-100720435 TGGGAGGACTGGGGAGAAAGTGG + Intergenic
1132642537 16:984368-984390 TGGCTGGCCCGGGGAGGAACAGG + Intronic
1132933518 16:2470273-2470295 TGGGTGGCCTGGGGACTAGCTGG - Intergenic
1132946122 16:2532280-2532302 TGGGAGGGCTGGGGCGAGGCGGG - Intergenic
1133041061 16:3059877-3059899 TGGGTGGCCTGGGGAGGAGGAGG - Exonic
1133286513 16:4693302-4693324 TCGGCCTCCTGGGGAGAAACGGG + Intergenic
1133914117 16:10093365-10093387 GGGGAGGCCTGATGAGAAGCAGG - Intronic
1134003953 16:10804935-10804957 TGGGAGGAGTGGGGAGAATGGGG - Intronic
1134299137 16:12974096-12974118 TGGAAGGCCTAGGAAGAAAAGGG + Intronic
1134514603 16:14876558-14876580 TGGGAGTCCTCTGAAGAAACTGG + Intronic
1134702280 16:16275211-16275233 TGGGAGTCCTCTGAAGAAACTGG + Intronic
1134969550 16:18519439-18519461 TGGGAGTCCTCTGAAGAAACTGG - Intronic
1135655371 16:24243867-24243889 TGGGACTACTGGGGAGAAATTGG - Intergenic
1137381428 16:48003081-48003103 TGGGTAGCCTTGGGAGAAAATGG + Intergenic
1137702637 16:50507923-50507945 GGGGAGGCCTGGGGCGCAGCAGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138212653 16:55176167-55176189 TGGGAGGGCTGGGGACACAGGGG - Intergenic
1138456902 16:57126310-57126332 TGGGAGGCCTGGGGTGGGAGTGG + Intronic
1138566865 16:57839988-57840010 TGGGAAGGCTGGGGAGGAATGGG - Intronic
1139501028 16:67365937-67365959 AGGGAAGCCTGGGAAGAAAAAGG - Intronic
1141380977 16:83576637-83576659 TGGGAGGGATGTGGAGAAACTGG - Intronic
1141448576 16:84080741-84080763 TAGGAGGACTGGGGAGGAAGAGG - Intronic
1141483999 16:84326706-84326728 TGGGGGGCCTGGGGAGGGAGAGG + Intronic
1141627030 16:85266748-85266770 TGGGAGGGGTGGGCAGAGACAGG + Intergenic
1141697174 16:85625643-85625665 AGAGAAGGCTGGGGAGAAACCGG + Intronic
1141733834 16:85839587-85839609 TGGGAAGCTTGGGGACAGACAGG + Intergenic
1141792290 16:86244856-86244878 TGGGAGGGATGGGGAGAAGCAGG + Intergenic
1141804491 16:86333900-86333922 TGGCTGTCCTGGGGAGAGACAGG + Intergenic
1142138268 16:88461272-88461294 TGCGAGGCCTGGTGAGGACCAGG + Intronic
1142614062 17:1124927-1124949 TGGGAGGCCTGGGGAGCAGACGG + Intronic
1142794309 17:2295640-2295662 TGGGAAGGCTGGCCAGAAACGGG - Intronic
1142927733 17:3255772-3255794 TGGGAGGATGGGGGAGAAGCGGG + Intergenic
1143023278 17:3927582-3927604 TGACAGCCCTGGGGAGACACTGG - Intronic
1143031694 17:3971501-3971523 TGGGAGGGCTGGGGGGCAGCGGG + Intergenic
1143775319 17:9195347-9195369 TGGGAGGCCAGAGGAGCAAGTGG + Intronic
1144372276 17:14603278-14603300 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
1144402395 17:14918824-14918846 AAGGAGGCATGGGCAGAAACCGG + Intergenic
1144451726 17:15386259-15386281 TGGCAAGCATGTGGAGAAACTGG + Intergenic
1144888324 17:18478628-18478650 TTGGAGGGCTGGGGGGAAGCTGG + Intronic
1145143882 17:20465674-20465696 TTGGAGGGCTGGGGGGAAGCTGG - Intronic
1146315361 17:31802688-31802710 TGGGAGCCCCAGGGAGAAACAGG - Intergenic
1146820794 17:35982459-35982481 TGGGAGGCAGGGGCAGAAACAGG + Intergenic
1146942762 17:36855243-36855265 AGGGTGGCCTGGGGAGGAAGTGG - Intergenic
1147384670 17:40074256-40074278 TGGGAGGGCTGGGGGCAAGCTGG - Exonic
1148088182 17:45006924-45006946 TGGGGGGCCTGGGGAGAGGTAGG + Intergenic
1148370420 17:47095568-47095590 TGGCAAGACTGTGGAGAAACCGG + Intergenic
1148456566 17:47814468-47814490 TGGGAGGCGGGTGGAAAAACAGG - Intronic
1148756457 17:49975633-49975655 CGGGCGGCCTGGGGAGCAGCAGG + Intergenic
1149291446 17:55221556-55221578 TGGGAGGTGAGGGGAGAAAGGGG + Intergenic
1149510410 17:57236763-57236785 TGGGAGGCATGAGGGGAAACTGG - Intergenic
1150123771 17:62623500-62623522 TGGGAGGGTAGGGGAGAGACAGG + Intergenic
1150135275 17:62692000-62692022 CGGGAGGTCTGGGGAGAAAGAGG - Intronic
1150272115 17:63873332-63873354 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150273470 17:63881512-63881534 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150275663 17:63896228-63896250 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150277795 17:63910917-63910939 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150458402 17:65326885-65326907 TAGGGTCCCTGGGGAGAAACTGG + Intergenic
1150650465 17:67006569-67006591 TGGGAAGCCTGGGGAGGTGCTGG - Intronic
1151714185 17:75823156-75823178 TGCGAGGCCTGGTGGGAAGCTGG - Intronic
1152192317 17:78896373-78896395 TGGCAGGGCTGGAGAGACACTGG - Intronic
1152241856 17:79165092-79165114 GGGGAGGCATGGGGAGCAGCCGG + Intronic
1152434039 17:80264359-80264381 CGGGAGGCCAGTGGAGAGACAGG + Intronic
1152546092 17:81000735-81000757 TGGCAGTCCTGGGGACAGACAGG - Intronic
1152962205 18:86649-86671 TGGGAGGCCTGGGAAGTGATGGG + Intergenic
1153880927 18:9421250-9421272 AGGGAGCCATGGGGAGAAAGTGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155430242 18:25748030-25748052 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
1155980117 18:32171137-32171159 AGGGAGGCCTGGGGAGAGTGGGG - Intronic
1156086090 18:33404464-33404486 TGGTAGGGATGTGGAGAAACTGG + Intronic
1157115201 18:44855954-44855976 GGGCAGGACTGGGGAGCAACGGG + Intronic
1157177906 18:45467896-45467918 TGGGAGGTATGGGGAGAGAGGGG + Intronic
1159016517 18:63105411-63105433 TGGGAGGGATGTGGAGAAACGGG + Intergenic
1159509407 18:69377231-69377253 TTGGAGCCCTTGAGAGAAACAGG + Intergenic
1159682167 18:71368322-71368344 AGGGAGGACTGGGGAGAAGTAGG + Intergenic
1159961273 18:74557455-74557477 AGGGAGGCCTGGGGAGCAGGAGG + Intronic
1160239448 18:77112629-77112651 TGGAAGGCCGGGAGAGAGACGGG + Intronic
1160709003 19:542204-542226 TGGGAGGCACGGGGAGCAGCCGG + Intergenic
1161280373 19:3442354-3442376 TGGGAAGCCTGGGGTGACAGAGG - Intronic
1161316976 19:3621717-3621739 TGGGGGGTCTGGGGAGCAAGGGG + Intronic
1161681606 19:5682410-5682432 TGGGAGTCCTGGAGAGAGAGAGG + Intronic
1162057969 19:8076390-8076412 TGGGAGGCCTAGGGAGCCTCCGG + Intronic
1162200805 19:9018589-9018611 GGGGAGGCCTGGAGAGAATTAGG - Intergenic
1163234670 19:16023541-16023563 GGGGAGGCCTGGGCAGGAAGGGG - Intergenic
1163779656 19:19239719-19239741 GAGGAGGCCTGGGGAGGAGCAGG - Intronic
1164351921 19:27357986-27358008 TTGGAGGCCTGTGGTGAAAAAGG - Intergenic
1164355073 19:27416232-27416254 TTAGAGGCCTGTGGAGAAATTGG - Intergenic
1164450513 19:28358891-28358913 TGGGAAGGTTGTGGAGAAACTGG + Intergenic
1164520724 19:28977076-28977098 TCTGAGGCCTGGGGAGAAAGTGG + Intergenic
1164821060 19:31251597-31251619 TGGGAGGCGTGGGGAGAGGGTGG - Intergenic
1165124179 19:33582295-33582317 TGGGAGGCCCAGGGAGCCACAGG - Intergenic
1165158241 19:33801206-33801228 TGGGCAGCCAGGGGAGACACAGG - Exonic
1165264458 19:34648068-34648090 GGTGAAGCCTGGGGAGAAGCAGG + Intronic
1165384563 19:35502764-35502786 AGGGAGGCTTGGGGAGAGTCAGG + Intronic
1165466657 19:35978787-35978809 AGGGCGGTGTGGGGAGAAACAGG - Intergenic
1165838847 19:38774827-38774849 TGAGAGGCCTGGGCAGAGGCAGG + Intergenic
1165840608 19:38787313-38787335 TGAGAGGCCTGGGCAGAGGCAGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166904306 19:46095160-46095182 TGGCAAGGCTGTGGAGAAACAGG - Intergenic
1167862664 19:52297700-52297722 GAGGAGGCCTGGGGAGTAGCGGG - Intronic
1167873201 19:52390428-52390450 GGGGAGGCCTGGGGAGCAGAAGG - Intergenic
1167915124 19:52734486-52734508 GGGGAGACCTGGGGAGCAGCAGG + Intronic
1167937934 19:52922871-52922893 GGGGAGACTTGGGGAGCAACAGG + Intergenic
1167952295 19:53037353-53037375 CGAGAGGCCTGGGGAGCAGCAGG + Intergenic
1167955093 19:53058008-53058030 GGGGAGGCCTGGGGAGCAGCAGG + Intergenic
1167960745 19:53102873-53102895 GGGGAGGCCTGGGGAGCAGCAGG + Intronic
1167964492 19:53132383-53132405 GGGGAGGCCTGGGGAGCAGCGGG + Intronic
1167967307 19:53158223-53158245 GGGGAGGCCTGGGGAGCAGCAGG + Intronic
1167971856 19:53192822-53192844 GGGGAGGCCTAGGGAGCAGCAGG + Intronic
1167991744 19:53366236-53366258 TGGGAGACCTGGGGAGCAGCAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168303398 19:55419748-55419770 TAGGAGGCCTGGGCAGAAGGGGG + Intergenic
926055523 2:9771730-9771752 AGGGAGGGCGTGGGAGAAACAGG + Intergenic
927142658 2:20140541-20140563 TGAGAGCCCTGGAGAGATACTGG - Intergenic
927918272 2:26950482-26950504 TGGGAGGCTTGTGCAGAGACTGG + Intergenic
928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG + Intergenic
929090841 2:38215795-38215817 TGTGTGGGCTGGGGAGAAATGGG - Intergenic
929940394 2:46329376-46329398 GGGGAGGCCTATGGAAAAACAGG + Intronic
932077864 2:68681878-68681900 TGGGAGTGCTGGGGATAACCAGG + Intronic
932346926 2:71001658-71001680 TGGGAGGCCTGGGGAGCTGGTGG - Intergenic
932388866 2:71366242-71366264 TGGGAGGCCTTGGGAGGCTCAGG + Intronic
932415029 2:71568352-71568374 AGGGAGGGCTGGGGAGAGCCAGG + Intronic
932456151 2:71851273-71851295 TGGGAGGTCTGGGGTAAGACAGG + Intergenic
932855869 2:75233406-75233428 TGTGAGCCCTGAGGAGAAAGCGG - Intergenic
933122217 2:78553036-78553058 TGGGAGGGAAGGAGAGAAACAGG + Intergenic
933397224 2:81748949-81748971 TGGGAGGAGTGAAGAGAAACTGG + Intergenic
933901906 2:86856124-86856146 TGCAAGCCCTGGGGAGAAGCAGG + Intronic
934051410 2:88214397-88214419 GGGTAGGAGTGGGGAGAAACAGG + Intergenic
934333904 2:92104571-92104593 TTTGAGGCCTGCGGAGAAAAAGG + Intergenic
934508492 2:94916733-94916755 TGGGCGGCCTGCCAAGAAACAGG + Intergenic
934772948 2:96919626-96919648 TGGGCGGTCTGGGGAGAACAGGG + Intronic
935339310 2:102045765-102045787 TGTGAGCCCGGGGGAGAAAAAGG - Intergenic
935452655 2:103227869-103227891 GGGAAGACCTGGGGAGATACAGG + Intergenic
935778638 2:106493140-106493162 TGCAAGCCCTGGGGAGAAGCAGG - Intergenic
935963556 2:108449843-108449865 GGGGTGGGCGGGGGAGAAACAGG - Intronic
936151162 2:110023161-110023183 TGGGAGGCCTGGGCAGGAGCAGG - Intergenic
936193513 2:110348208-110348230 TGGGAGGCCTGGGCAGGAGCAGG + Intergenic
937346243 2:121127588-121127610 TGGGAGGCCAGGGCAGCAGCAGG - Intergenic
937911133 2:127076083-127076105 TGGGAGGGCTGGGGAGCAGCTGG - Intronic
938134824 2:128748002-128748024 TGGCAAGCATGTGGAGAAACAGG + Intergenic
938244662 2:129767309-129767331 TGGGCTGCCTGGGGAGAGGCTGG - Intergenic
938946839 2:136220201-136220223 GGGGAAGCATGGGGAGAGACAGG - Intergenic
939747843 2:145999682-145999704 TGGTAAGGCTGGGGAGAAAAGGG + Intergenic
939962589 2:148578485-148578507 GGGGAGGGATGAGGAGAAACAGG + Intergenic
940052473 2:149479044-149479066 TGTGAGGCCTGAGGACAGACTGG - Intergenic
940303412 2:152199978-152200000 AGGGAGACATGGTGAGAAACTGG + Intergenic
940384172 2:153050846-153050868 TGGAAGGCCTGAGGAGGAGCTGG + Intergenic
941196081 2:162453596-162453618 TGGCAAGGCTGTGGAGAAACAGG - Intronic
941422442 2:165299335-165299357 TGGGAGGCCTGAGGAGATGCAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941694313 2:168534704-168534726 TGGGTGGCATGGGGAACAACAGG + Intronic
941905506 2:170714386-170714408 TGGGTGGCCTGGGGAGAAGGGGG + Exonic
942600168 2:177632934-177632956 TGGGGAGCCTGGGAAAAAACTGG - Intronic
942935533 2:181552152-181552174 GGGAAGGACTGGGGAGATACTGG + Intronic
943184218 2:184585775-184585797 TGGGAAGCTTGTGGAGAAAAGGG - Intergenic
943749580 2:191497290-191497312 TTGGAGGCAAGGGAAGAAACAGG + Intergenic
944288044 2:197974159-197974181 GGAGAGACCTGGGGAGGAACTGG + Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
946853188 2:223927908-223927930 AAGGAGGCCTGGGGGGAAAGGGG + Intronic
947320185 2:228908564-228908586 TAGGAGGATTGGGGAGATACTGG + Intronic
947354608 2:229279283-229279305 TGGGAAGGCTGTGGAGAAATAGG + Intergenic
948223567 2:236291684-236291706 GGGAAGGCTTGGGGGGAAACAGG + Intergenic
948283516 2:236767156-236767178 TGGCAAGGCTGTGGAGAAACTGG - Intergenic
948436731 2:237958812-237958834 AGAGAGGCCTTGGGAGAAACCGG - Intergenic
948506551 2:238431733-238431755 AGGGAGGCCTGAGGAGAGAGTGG + Intronic
948676657 2:239600898-239600920 TGGGAGGCCCAGGGAGGAAGAGG - Intergenic
948677265 2:239604103-239604125 GGGGAAGCCCAGGGAGAAACCGG + Intergenic
948863335 2:240763412-240763434 GGGGAGGCGTGAGGAGAAAGGGG + Intronic
948867061 2:240781561-240781583 TGGGCGGCGTGGGGAGGAAGCGG - Intronic
1169113687 20:3048946-3048968 TGGGAGACATGGAGAGAAGCTGG - Intergenic
1169184781 20:3605263-3605285 TGGCAAGGCTGTGGAGAAACAGG + Intronic
1169198644 20:3697020-3697042 GGGGTGGTCTGGGGAGAAGCAGG - Intronic
1169610141 20:7369936-7369958 TGGTAAGGCTGTGGAGAAACAGG - Intergenic
1169905145 20:10595098-10595120 TTGGAGGCCAGGGGAGAAGATGG + Intronic
1170811936 20:19680929-19680951 TGGGAGGCCGGAGGTCAAACTGG + Intronic
1170915880 20:20625017-20625039 AGGGAGGCATGGGTAGAGACAGG - Intronic
1171573991 20:26281923-26281945 TTTGAGGCCTGGGGTGAAAAAGG + Intergenic
1171574058 20:26283278-26283300 TTTGAGGCCTGTGGAGAAAAAGG + Intergenic
1172045525 20:32077371-32077393 TGGGAGGACTCACGAGAAACTGG - Intronic
1172454901 20:35062679-35062701 AGGGAGGCCTTGGGAGGAAATGG + Intronic
1172999905 20:39098223-39098245 TGGGAGGCCAGGGGACACATAGG + Intergenic
1173235851 20:41244768-41244790 TGGGAGGATTGGAGAGGAACTGG + Intronic
1173522349 20:43709515-43709537 TGGGAGACCTGGGAAGATGCTGG + Intronic
1174061306 20:47834869-47834891 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1174070221 20:47894454-47894476 CTGGAGGCCTGGGGAGGAGCTGG + Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1174156173 20:48516772-48516794 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1174378091 20:50139496-50139518 AGGGAGGTCGGGGGAGAACCAGG - Intronic
1174553554 20:51378472-51378494 TGGGAGGCGTGGGGAAAGCCAGG + Intergenic
1175238034 20:57526453-57526475 TGGGAGACCTGGGGGGGAAATGG + Intergenic
1175501169 20:59452262-59452284 AGGGAGGTCTGGAGAGAGACAGG - Intergenic
1175654276 20:60755003-60755025 TGGGAGGACTTGGGAGAAAGAGG - Intergenic
1175942308 20:62543159-62543181 TGGAGGCCCTGGGGAGAATCCGG + Intergenic
1175947550 20:62565829-62565851 TTGGAGGCCTGGGCAGGCACGGG + Intronic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1176120829 20:63453798-63453820 GGGGAGGCCTGGCGAGAGAAGGG + Intronic
1176268290 20:64222087-64222109 TCTGTGGCCTGGGGAGGAACAGG + Intronic
1176325344 21:5392901-5392923 TTTGAGGCCTGTGGTGAAACTGG - Intergenic
1176482909 21:7323488-7323510 TTTGAGGCCTGTGGTGAAACTGG - Intergenic
1176952705 21:15065134-15065156 TGGGAGGGAGGGGGAGAAAAGGG - Intergenic
1179079270 21:38155219-38155241 TGGCAAGGCTGTGGAGAAACAGG - Intronic
1180783799 22:18535941-18535963 TGTAGGGCCTGGGGAGAGACAGG + Intergenic
1180900083 22:19364704-19364726 AGGGAGGCCTGGGGAGAGGAAGG - Intronic
1181130138 22:20726402-20726424 TGTGAGGGCTGGGGACAGACCGG + Intronic
1181240699 22:21475293-21475315 TGTAGGGCCTGGGGAGAGACAGG + Intergenic
1181316039 22:21971402-21971424 TGGGAGCCCTGCAGAGAAGCAGG - Intronic
1181539385 22:23565389-23565411 TAGGAGGCCTGGGGAGGGGCAGG + Intergenic
1182423004 22:30257615-30257637 TGGGAGCCAAGGGGAGAAGCAGG + Intergenic
1183112055 22:35657682-35657704 AGGGAGGCCTGGAGAGGATCTGG - Intronic
1183367533 22:37415135-37415157 TGAGAGGCCTGGGAAGTGACGGG - Intronic
1183472601 22:38017454-38017476 TGGGAGCCCTTGGCAGAACCAGG - Intronic
1183506612 22:38212737-38212759 AAGGAGGCCTGGGGAGAGAGGGG + Intronic
1184034898 22:41913708-41913730 AGGGAGGAGTGGGGAGAAGCAGG + Intronic
1184152025 22:42644903-42644925 TGGGAGGGCCGGGGAGGAAATGG - Intronic
1184177313 22:42795740-42795762 TGGGAGGACTGAGGGGAAAAGGG + Intergenic
1184482389 22:44755491-44755513 AGGGAGGCCTGGGAAGCATCTGG - Intronic
1184805521 22:46792808-46792830 GGGGAGCCCTGGGGAGAGCCAGG + Intronic
1185284717 22:49995112-49995134 GGGGTGCCCTGGGCAGAAACTGG + Exonic
1185417819 22:50719932-50719954 ATGGAGGGCAGGGGAGAAACAGG - Intergenic
1202716447 2_KI270715v1_random:9146-9168 TTTGAGGCCTGCGGAGAAAAAGG + Intergenic
1202728434 2_KI270716v1_random:32885-32907 TTTGAGGCCTGCGGAGAAAAAGG + Intergenic
949441019 3:4080395-4080417 TAGGAGGGCTGGAGATAAACTGG - Intronic
950135658 3:10579090-10579112 TGGGAGGGATGGGGAGGACCAGG + Intronic
950201859 3:11050187-11050209 TGGGAGGCCTGGGGTGAGGGGGG + Intergenic
950525140 3:13518900-13518922 TGGGAGGGCTGGCGAGACCCAGG + Intergenic
950626765 3:14253110-14253132 TTGTGGGACTGGGGAGAAACTGG + Intergenic
951007097 3:17630576-17630598 AGGGAGGCCTGAGGAGAGAAGGG - Intronic
951522406 3:23621831-23621853 TGAGAGGGATGGGGAGAGACTGG - Intergenic
951641101 3:24836464-24836486 TGTGAGGCAAGGGTAGAAACAGG - Intergenic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
952838422 3:37624480-37624502 GTGCAGGACTGGGGAGAAACAGG - Intronic
953389117 3:42524378-42524400 TGGGAGCCCAGGGCAGAAAAAGG + Intronic
953547252 3:43872621-43872643 GGGGAGGCCTGGGGATAAGAAGG - Intergenic
953867873 3:46599855-46599877 TTGGAGGACAGGGGAGAAGCAGG - Intronic
954105993 3:48410133-48410155 TGGGAGAGCTGGCAAGAAACAGG - Intronic
955147615 3:56335862-56335884 TGCGGGACTTGGGGAGAAACAGG + Intronic
955249441 3:57264023-57264045 TGGGAAGCATGTGGAGAAAAGGG - Intronic
955334537 3:58074217-58074239 TAACAGGCCTGGGGTGAAACAGG - Intronic
955790069 3:62579850-62579872 TGGGAGGCAGGGGCAGAAGCAGG + Intronic
957056197 3:75444774-75444796 GGAGAGGCCTGGGCAGGAACCGG - Intergenic
957626533 3:82659627-82659649 TGGGAAGACTGTGGAGAAATAGG - Intergenic
957629589 3:82702062-82702084 TGGCTGGGCTGTGGAGAAACAGG - Intergenic
957672716 3:83326796-83326818 TGGAAAGGCTGTGGAGAAACAGG + Intergenic
958203906 3:90363072-90363094 TTGGAGGCCTGTGGTGAAAAAGG - Intergenic
958851968 3:99338312-99338334 TGGGAGGATTGGGGAGATATTGG - Intergenic
959428114 3:106218543-106218565 TGGGAGGCCAGGGGAGGGAAAGG - Intergenic
959618877 3:108378830-108378852 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
959650232 3:108744223-108744245 TGGGAGGCAGAGGGAGAAAGGGG - Intronic
960971196 3:123141357-123141379 TGGGAGGCCTCGGGAAATGCAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961614531 3:128168399-128168421 TGGGAGGCCAGAGGTGAACCTGG + Intronic
961636390 3:128335624-128335646 TGGGAGGCCAGTGGAGAGCCTGG + Intronic
961647344 3:128399761-128399783 TGGCAGGGCTGGGGAGAGCCAGG - Intronic
961657720 3:128452573-128452595 TGTGAGGCATGGGGAGAGAGGGG + Intergenic
961956554 3:130810161-130810183 TGGGGGGCATGTGGAGAAATAGG + Intergenic
962457982 3:135582870-135582892 TGTGAGGCTCGGGGAGAAAGGGG - Intergenic
962689196 3:137876711-137876733 TGGGTGGCTTGGGGAGAGATGGG + Intergenic
964511832 3:157460852-157460874 TGGGAGGTGAGGGGAGAGACGGG + Intronic
964972921 3:162583258-162583280 TGGGAGGCCGGGGCAGAGAATGG + Intergenic
965707339 3:171522310-171522332 TGGGAGGCCTGGAAAAAATCAGG - Intergenic
967156108 3:186693862-186693884 GGTGAGTCCTGGGGAGAAAAAGG + Intergenic
967562836 3:190936752-190936774 AGGGAGGAGTGGGGAGGAACAGG - Intergenic
967850232 3:194077016-194077038 TGGGAGGGGTGGGGAGCAGCTGG - Intergenic
968565334 4:1309620-1309642 TGGGAGGCCTGAGGAGTAAGCGG + Intronic
969536136 4:7757098-7757120 TGAGAGGCCGGGGGAGCAAGGGG + Intergenic
970238413 4:13982147-13982169 AGGGAGCCCTGGGGAGGAACAGG - Intergenic
970570797 4:17380403-17380425 TGGCAGGGCTGTGGAGAAATGGG - Intergenic
971164203 4:24165814-24165836 AGGGAGGCCTGAGGAGAAACAGG - Intergenic
971588367 4:28433860-28433882 AGGGAGGCTTGAGGAGAAGCTGG + Intergenic
972164081 4:36260996-36261018 TGGGAGGCAGGCGGAGAAGCAGG - Intergenic
972260043 4:37398447-37398469 TCGGAGGAGTGGGGAGAAAGGGG + Intronic
972383710 4:38543332-38543354 AGGGAGGCCTGAGGAGAAGGAGG + Intergenic
972545076 4:40072634-40072656 TGGGAGGCCTGGGGGGGTACAGG - Intronic
972577242 4:40363336-40363358 TGGGCAGCCTGTGGAGAAAGTGG + Intergenic
973161509 4:47023186-47023208 TGGGGGGCCTGAGGGGAAGCTGG + Intronic
973804977 4:54516819-54516841 TGGGAAGCCATGGGAGAGACTGG + Intergenic
973925592 4:55734359-55734381 TGGCAGGGCTGTGGAGAAAAGGG + Intergenic
974460518 4:62181477-62181499 TGGGAAGACTGGAGAGAATCAGG + Intergenic
975520016 4:75290453-75290475 TAGGTGGCCTGGGGAGAATCAGG - Intergenic
975769597 4:77707101-77707123 TGGGAGACCTGGAGGGAAACTGG + Intergenic
976172857 4:82322671-82322693 TGAGTGGCCTGGGGAGGAGCAGG - Intergenic
976442453 4:85090655-85090677 TGGGGGGTCTGGGGAGATGCTGG + Intergenic
976955717 4:90896672-90896694 TGGGAGCACTGGTGAAAAACTGG + Intronic
977072109 4:92404393-92404415 TGGCAAGGCTGTGGAGAAACAGG + Intronic
977114816 4:93010496-93010518 TGGGATGCCTGGAGAGAACATGG - Intronic
977536708 4:98261907-98261929 CGGGCGGCCTCTGGAGAAACGGG - Intronic
978258846 4:106726607-106726629 TGGGAGGCATGAGGAGATTCTGG + Intergenic
979686130 4:123511885-123511907 TGGAAGGCTTGTGGAGAAATAGG - Intergenic
980183415 4:129430713-129430735 AGGGATGCCTGCCGAGAAACTGG - Intergenic
980411550 4:132426051-132426073 TGGCAGGGCTGTGGAGAAAAGGG - Intergenic
980848449 4:138352722-138352744 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
982029938 4:151290528-151290550 TGGGAGGGTTGGGAAGAAATGGG + Intronic
982044372 4:151428500-151428522 AGAGTGGCCTGGGGAGAAGCAGG - Intronic
982094672 4:151911169-151911191 TGGCTGGCCTTGGGAGAAAATGG - Intergenic
982195233 4:152905029-152905051 TGGGAAGGCTGTGGAGAAATAGG - Intronic
983013891 4:162584715-162584737 TGGGAAGGATGCGGAGAAACAGG + Intergenic
983631720 4:169856082-169856104 TGGGAAGGATGTGGAGAAACTGG + Intergenic
984125331 4:175801671-175801693 TGGAATGCCTGGGGGGACACAGG + Intronic
985124433 4:186678702-186678724 TGGCAAGGCTGCGGAGAAACAGG + Intronic
986322608 5:6645135-6645157 TGGGAGTGCTGGGGAGAGAGTGG + Intronic
986776439 5:11018301-11018323 AGGGAGGCCTGAGGAGAGAGAGG - Intronic
987189052 5:15454734-15454756 TGGGAGGCTCGGGGAGAGGCTGG - Intergenic
987525965 5:19050675-19050697 TGGGAGGAATGGGGAGATAATGG - Intergenic
988740346 5:34063518-34063540 TGGGGGGGCTGGGGGGAAGCTGG + Intronic
989842088 5:46089100-46089122 TTGGAGGCCTACGGAGAAAAAGG + Intergenic
990116112 5:52393687-52393709 TGGGAATTCTGGGGAGAACCTGG + Intergenic
990138570 5:52677288-52677310 TGGCAAGGCTGTGGAGAAACAGG - Intergenic
992342019 5:75834067-75834089 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
992852521 5:80824658-80824680 TGGTAGACCTGGGGAGAATGGGG - Intronic
993396062 5:87390412-87390434 GGGGAGGGGCGGGGAGAAACAGG - Intronic
993831151 5:92759620-92759642 TGGGAGGGGTGGGGACAAAGAGG + Intergenic
993959538 5:94280044-94280066 TCGGTGGCCTGGGGAGTGACAGG + Intronic
994345003 5:98674112-98674134 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
996219940 5:120918704-120918726 TGCCAGCCCTGGGCAGAAACAGG + Intergenic
996693187 5:126363325-126363347 TGGCAAGCATGTGGAGAAACTGG + Intronic
997391933 5:133524253-133524275 TTGGAGGCCTGGGAAGAAATTGG + Intronic
997511200 5:134455799-134455821 TGGGGGTGCTGGGGAGAAGCGGG + Intergenic
998335864 5:141371742-141371764 TAGGAGGCCTGGTGGAAAACGGG - Exonic
999170802 5:149593103-149593125 TGGCAGGAATGTGGAGAAACTGG - Intronic
999400408 5:151259740-151259762 TGGGATGGCTGGGGACAATCAGG - Exonic
999523993 5:152382541-152382563 TGGCAAGGCTGTGGAGAAACGGG - Intergenic
999801960 5:155046707-155046729 TGTAGAGCCTGGGGAGAAACAGG - Intergenic
1000639599 5:163685948-163685970 TTGGAGGACTAGGGAGAAATTGG - Intergenic
1001505054 5:172272422-172272444 TGAGGGGCATGGGGAGAAGCAGG + Intronic
1001975815 5:175997499-175997521 TGGGGCACCTGGGGAGAATCAGG - Intronic
1002180949 5:177430967-177430989 GGTGAGGCCTGGGCAGAGACTGG + Exonic
1002258984 5:177981394-177981416 TGGGAAGGCTGGAGAGAAGCGGG + Intergenic
1002597671 5:180334800-180334822 TTGGAGGCCTGGGAGGAGACAGG + Intronic
1002940660 6:1712893-1712915 TTGGAGGGCTGAGGAGAAAGTGG + Intronic
1003118369 6:3298524-3298546 TGGGAAGGGTGGGGGGAAACTGG + Intronic
1003164089 6:3661086-3661108 TGCAAGGGCTGGGGAGACACAGG + Intergenic
1003200191 6:3952394-3952416 TGGCAGGGTTGGGGAGAAAAAGG - Intergenic
1003206998 6:4021602-4021624 TGGGAGGCATGGGGAGCAGGCGG + Intronic
1003379786 6:5613978-5614000 TGGGAGTCCTGGGGGGAAAAGGG + Intronic
1003527520 6:6910403-6910425 TGGAAGGCCTGGGAAGAAAAGGG - Intergenic
1003590564 6:7433250-7433272 TGGGAGGGCAGGTGAGAATCAGG + Intergenic
1005194791 6:23270539-23270561 TGTGAGAACAGGGGAGAAACAGG - Intergenic
1005311113 6:24560337-24560359 TGGCGAGCCTGTGGAGAAACTGG - Intronic
1005495220 6:26382380-26382402 CGGGAGGCCTTGGGGGAAGCAGG - Intergenic
1005988748 6:30890656-30890678 TGTGAGGATTGGGGAGAATCTGG + Intronic
1006188051 6:32191614-32191636 TGGGGTGCCTAGGGAGAAACAGG + Intronic
1006193477 6:32223293-32223315 TGGGAGGCCAGAGAATAAACAGG - Intronic
1006317376 6:33298644-33298666 GGGGGCGCCTGGGGAGAGACGGG + Exonic
1007138449 6:39546326-39546348 AGAGAGCCCAGGGGAGAAACTGG - Intronic
1007180485 6:39926004-39926026 GGTGAGGCCTGGGGAGATGCTGG - Intronic
1007251478 6:40498031-40498053 TGGGAGGACAGGGTGGAAACTGG + Intronic
1007259819 6:40555671-40555693 TGGGAGGACAGGAGAGAAGCAGG - Intronic
1007298038 6:40843400-40843422 TGGCAGGACAGGGGAAAAACCGG - Intergenic
1007697853 6:43744886-43744908 GGGGAGGGCTGGGGAGAGATAGG + Intergenic
1007753141 6:44081988-44082010 AGGGAGGCCTGGGGATAAGCAGG + Intergenic
1009519990 6:64669495-64669517 TGAGAGTACTGGGGAGAAAAGGG + Intronic
1009622410 6:66094675-66094697 GCGGAGCCCTGGGGAGAGACTGG + Intergenic
1009706351 6:67257089-67257111 TGGCAGGGCTGTGGAGAAATAGG - Intergenic
1010210909 6:73362528-73362550 TGGGCGGCCTCGGAAGAAGCCGG + Intergenic
1011886564 6:92103783-92103805 TGGCAAGGCTGGGGAGAAAAAGG - Intergenic
1012314397 6:97767703-97767725 TGGCAAGGCTGTGGAGAAACAGG - Intergenic
1013015522 6:106157603-106157625 TGGGATGCCTGGGGGGAGGCTGG + Intergenic
1013251298 6:108336277-108336299 TGGGGGGAATGGAGAGAAACAGG + Intronic
1014714463 6:124848392-124848414 TGGGAGGGCTCGGAAGAAGCAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015630002 6:135222759-135222781 TGCGGGGACTGGGTAGAAACGGG - Intergenic
1016242414 6:141946119-141946141 TTGGGGGCCTGGGGAGCAAGGGG + Intergenic
1016358054 6:143239137-143239159 TTGGAGCACTGGGGAGAGACTGG + Intronic
1017009767 6:150055360-150055382 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1017590214 6:155971154-155971176 TGTGAGCCTTGGTGAGAAACAGG + Intergenic
1017619477 6:156281059-156281081 GGGGTGGTCTGGGGACAAACTGG - Intergenic
1017816856 6:158022345-158022367 TGGGAGGCCTGGGGTGGTCCCGG + Intronic
1017943819 6:159077392-159077414 TGGGAGGCTCGGGGAGGAAAGGG + Intergenic
1018494663 6:164337384-164337406 TGGGCTCCCTGGGGAGATACAGG - Intergenic
1019283355 7:211412-211434 GGGGAGGCCTGGGGAGGAAGAGG - Intronic
1019376734 7:696842-696864 CAGGAGGCCTTGGGAGAAAGGGG + Intronic
1019572489 7:1719523-1719545 TGGGAGGCTTGGGGAACAACAGG - Intronic
1019688278 7:2394734-2394756 GCTGAGGCCTGGGGAGAAGCCGG + Intergenic
1019736869 7:2654672-2654694 AGGGAGGCCTTGGAAGAAGCCGG - Intronic
1021559172 7:21952242-21952264 TGGGAGGACTGGGGAGATGTTGG - Intergenic
1021804382 7:24340662-24340684 TGTTTGGGCTGGGGAGAAACTGG + Intergenic
1023053476 7:36273350-36273372 GGGGAGGAATGGGGAGAAAAAGG - Intronic
1023630495 7:42159061-42159083 GGGGAGGTGTGGGGAGAAATAGG - Intronic
1024461248 7:49661816-49661838 TGGTAGGTCTGGGGAGACGCTGG - Intergenic
1025233117 7:57216199-57216221 CTGGAGGCCTGGGGAGGAGCTGG + Intergenic
1025501551 7:61307263-61307285 TTTGAGGCCTGGGGTGAAAAAGG - Intergenic
1025516414 7:61653486-61653508 TTTGAGGCCTGGGGTGAAAAAGG - Intergenic
1025525646 7:61806320-61806342 TTTGAGGCCTGGGGTGAAAAAGG - Intergenic
1025540749 7:62082312-62082334 TTTGAGGCCTGGGGTGAAAAAGG - Intergenic
1025610147 7:63070887-63070909 TGGGAGCCCTGGGCAGGCACTGG - Intergenic
1025709261 7:63891922-63891944 TGGGAGCCCTGGGCAGGCACTGG + Intergenic
1026593883 7:71718166-71718188 AGGGAGGGTTGGGGAGAAGCTGG + Intergenic
1026937982 7:74270017-74270039 TGGGAGGCCTGGGCATAAACAGG - Intergenic
1029408126 7:100390122-100390144 TGGGAGGCTTGGGGAGAGGGCGG - Intronic
1029596212 7:101538776-101538798 TGGGATCCCTGGGGACAAAGTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030015307 7:105213444-105213466 TAAGAGTGCTGGGGAGAAACTGG + Intronic
1030207620 7:106966391-106966413 TGAGAGGGCTGGGGTGAAAGAGG + Intergenic
1030626109 7:111847855-111847877 TGAGAGGCTTGGGGAGAAAAGGG - Intronic
1030632843 7:111914296-111914318 TGGGAGGGCAGCAGAGAAACAGG - Intronic
1031312123 7:120211610-120211632 TGGCAAGCCTGTGGAGAAACAGG + Intergenic
1032086810 7:128888776-128888798 TGGGAGGGCTGGGAGGAAAGTGG + Intronic
1032604630 7:133336475-133336497 TGGGAAGGCTGTGGGGAAACAGG - Intronic
1032823598 7:135547834-135547856 TGGCAAGCATGTGGAGAAACTGG + Intergenic
1033409525 7:141104705-141104727 AGAGAGGCCTCTGGAGAAACCGG - Intronic
1034256235 7:149726020-149726042 TGGGAGTCCTGTGGGGAACCAGG + Exonic
1034519951 7:151612197-151612219 TGGGCATCCTGGGGAGAGACAGG - Intronic
1034901394 7:154910024-154910046 TGGGAGCCCTGCTTAGAAACTGG + Intergenic
1035242979 7:157544224-157544246 CGGGAGGCCTTGGGAGAAGTGGG + Intronic
1035250970 7:157596651-157596673 TGGGAGGTGTGGGGAGGAGCTGG - Intronic
1035924524 8:3712849-3712871 TGGGGGACCTGGGGAGATGCTGG + Intronic
1037529352 8:19757930-19757952 TGGGAGGCCAGGAGAGAAGAGGG + Intronic
1037619689 8:20552379-20552401 TGATAGGCCTGGGGAGAGAGGGG + Intergenic
1040085745 8:43338993-43339015 TGGTGAGCCTGTGGAGAAACAGG + Intergenic
1040111325 8:43568332-43568354 AGGCAGGCCTGGGAAGAAAGTGG - Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1040842397 8:51798690-51798712 TGGCAAGGCTGTGGAGAAACAGG + Intronic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1041220160 8:55642737-55642759 TGGCAGGGCTGTGGAGAAAAAGG - Intergenic
1041767288 8:61432546-61432568 AGAGAGGCCTCGGAAGAAACTGG + Intronic
1042347578 8:67743595-67743617 TGGGAGATTTGGGGAGAAATAGG - Intronic
1042353267 8:67799757-67799779 TGAGAGGCCTGGGCAGAACCAGG - Intergenic
1042799992 8:72708092-72708114 TGGGTGTGCTGGGGAGAGACTGG - Intronic
1042840701 8:73120774-73120796 TGGGAGGCGTGGGGAGAGGAAGG - Intronic
1043104573 8:76091038-76091060 TGGGAGACCTGGGAAGATAGTGG - Intergenic
1043665280 8:82802950-82802972 TGGGAGAAATGGGGAGATACTGG + Intergenic
1043817859 8:84825354-84825376 TGGCAGGGCTGTGGAGAAAAGGG + Intronic
1043985049 8:86684352-86684374 TGGCAAGCCTGGGAAGAAACTGG + Intronic
1044359468 8:91264558-91264580 GGGGAGGACTGGGGAGAGACTGG - Intronic
1044568337 8:93689826-93689848 TGGGAGGTCTGGAGGGAAATAGG + Intergenic
1045130887 8:99151016-99151038 TGGTAGGGATGTGGAGAAACAGG - Intronic
1045344037 8:101278742-101278764 TGGCAGGGCTGTGGAGAAAAGGG + Intergenic
1045507882 8:102791295-102791317 TGGGAGGTTGGGGGAGAGACCGG - Intergenic
1046650668 8:116833663-116833685 TGGGAGACCTTGGGAGACCCTGG + Intronic
1047343939 8:124009376-124009398 CTGGAGGCCTGGGGAGGAGCTGG + Intronic
1047619141 8:126588670-126588692 TGGGAGGCCAGAGCAGAATCAGG + Intergenic
1047785222 8:128147847-128147869 CTGGAGGCCTGGGAAGAAAAAGG - Intergenic
1047978879 8:130159285-130159307 TGGGTGGCCTGGTGAGCAACAGG + Intronic
1048300079 8:133245000-133245022 AGGGTGGCCTGGGGTGAAACGGG + Intronic
1048331774 8:133475604-133475626 TGGGAGGCCTGGGCTGAAAGTGG - Intronic
1049289083 8:141792027-141792049 TGGGAGGACTGAGCAGAACCTGG - Intergenic
1049298605 8:141856893-141856915 TGAGGGCCCTGGGGAGAAAGGGG + Intergenic
1049546234 8:143232688-143232710 TGGGCGTCCTGGGGAGAATTGGG + Intergenic
1049888166 9:42311-42333 TGGGGAGGCTGTGGAGAAACAGG - Intergenic
1050119998 9:2298370-2298392 TGTGGGGCCTGGGCAGAAGCTGG + Intergenic
1050167091 9:2776619-2776641 TGGCAAGGCTGAGGAGAAACGGG + Intronic
1050349833 9:4730168-4730190 TGGGAGGGTTGGGGAGAAATGGG + Intronic
1051639063 9:19207291-19207313 TGGGAGGCTTGGGCAAATACTGG + Intergenic
1051719543 9:20021993-20022015 GGGGAGGCATTGGAAGAAACAGG - Intergenic
1051943261 9:22534606-22534628 TGGCAAGGCTGTGGAGAAACAGG + Intergenic
1052148406 9:25079178-25079200 TGGGAGAAATGGAGAGAAACTGG - Intergenic
1052168957 9:25370072-25370094 AGGGGAGGCTGGGGAGAAACTGG + Intergenic
1053145069 9:35706544-35706566 TGCAAGGCCTGGGGAGGAAGTGG + Exonic
1053302363 9:36961075-36961097 TGGGTACCCTGGGGAGAAAGAGG - Intronic
1055201891 9:73673874-73673896 TGGCAGGGCTGTGGAGAAAAGGG + Intergenic
1055804416 9:80076742-80076764 GGTGTGGCCTGGGGAGACACTGG - Intergenic
1056762421 9:89424928-89424950 TGCAAGCCCTGGAGAGAAACAGG - Intronic
1056832887 9:89931000-89931022 TGGCCGGCCTGGGGAGGAAGAGG + Intergenic
1057009568 9:91589579-91589601 TGGGAGTGCTGGGGGGACACTGG + Intronic
1057214390 9:93219974-93219996 TTGGAGGCCTGGGGACCAAAGGG + Intronic
1057842839 9:98500350-98500372 TGGGAGGGATGGGGAGAGATGGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058628801 9:106964302-106964324 TGGCAAGGCTGTGGAGAAACTGG - Intronic
1058981363 9:110173655-110173677 TGGAAATCCTGGGGAGAAAAAGG - Intergenic
1059219066 9:112594863-112594885 TGGCAGGGATGTGGAGAAACTGG - Intronic
1060402214 9:123355705-123355727 TGGGAGCACTGGGGAGCAGCAGG + Intergenic
1060661103 9:125405677-125405699 GAGGAGGCCTGGGGACAAAGGGG + Intergenic
1061196380 9:129109359-129109381 CAGGAGTCCTGGAGAGAAACAGG - Intronic
1061275527 9:129567897-129567919 TAGGAGGCCTGGGGAGGGGCAGG + Intergenic
1061395481 9:130341388-130341410 TGGGAGAGCTGGGGAGAAGCAGG - Intronic
1061451657 9:130670262-130670284 TCTGAGTCCTGGGGAGAAAATGG - Intronic
1061502960 9:131014097-131014119 TGGGAGGCCCAGAGAGAAAGAGG - Intronic
1061752137 9:132786458-132786480 TGGGGGTCCAGGGGAGAAGCAGG - Intronic
1061881744 9:133572331-133572353 GGGGAGGCCTGGGCAGAGCCAGG + Intronic
1062035886 9:134382364-134382386 AGTGAGGCCTGGGGAGACAGTGG + Intronic
1062131387 9:134895728-134895750 AGGGAGGCATGGGGATAAATTGG + Intergenic
1062168555 9:135121611-135121633 TCCAAGGCCTGGGGAGATACGGG - Intergenic
1062250651 9:135592098-135592120 GGGGAGCCCTGGGGAGAACATGG - Intergenic
1062403619 9:136383232-136383254 TGGGAGGCCTGGGCAGACCTCGG + Exonic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1062591889 9:137278090-137278112 TGGGAGGCCTGGGTTGAGCCTGG + Intronic
1062715620 9:138008699-138008721 TCGCAGGCCTGTGGTGAAACGGG + Intronic
1062735935 9:138137468-138137490 TGGGAGGCCTGGGAAGTGATGGG - Intergenic
1185779182 X:2829990-2830012 TAGGAGGCCGGGGGTGACACTGG + Intronic
1187397368 X:18930425-18930447 TGGGAGTTCTGAGGAGCAACTGG + Intronic
1188414083 X:29910877-29910899 TGACAAGCCTGTGGAGAAACTGG + Intronic
1188441961 X:30222013-30222035 TAGGAGGCCTAGGGAGGAGCTGG + Intergenic
1188485070 X:30673539-30673561 TGTGTGCCCTGGGGAGAAATAGG + Intronic
1189350667 X:40273342-40273364 TTGGAGACCTGGGGAGAAGTTGG - Intergenic
1189658273 X:43269745-43269767 GGGGAGGCCGGGGGTGAGACTGG + Intergenic
1190442757 X:50492243-50492265 TTGGAGCTCTGGGGAGAAGCTGG + Intergenic
1190448220 X:50552431-50552453 TGGTGGGGCTGGAGAGAAACAGG + Intergenic
1190581934 X:51898256-51898278 TGGGAGGCAAGGGGAGACAAGGG - Intronic
1190741690 X:53292942-53292964 TGGGAGGCCTGAGGTGAAGATGG - Intronic
1191271298 X:58474768-58474790 TGTGAGGCCTATGGTGAAACAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191726012 X:64282078-64282100 TGGCAAGGCTGGGGAGAAATAGG + Intronic
1191856761 X:65633532-65633554 TGAGAGGCCTGGGGAAATACAGG - Intronic
1192276237 X:69633996-69634018 TGGCAGGGATGTGGAGAAACTGG - Intronic
1192655614 X:72990467-72990489 TGGCAAGGCTGGGGAGAAAAGGG + Intergenic
1193309717 X:79991644-79991666 TGGCAGGGCTGTGGAGAAATAGG + Intergenic
1195884082 X:109622389-109622411 AGGGAGGCCTGGGGAGGATGTGG - Intergenic
1196058254 X:111379367-111379389 TGGGAGGTTTGGGGAGAAATAGG - Intronic
1196070228 X:111512681-111512703 TTGGAGGCCTGTGGAGAACTTGG + Intergenic
1196456699 X:115896021-115896043 TGGGAGTGCTGTGGAGAACCAGG - Intergenic
1197066644 X:122240780-122240802 TGGTGGGGCTGGGGAGAAAAGGG - Intergenic
1197396634 X:125935787-125935809 TGGCAAGGCTGTGGAGAAACAGG - Intergenic
1197650649 X:129060035-129060057 TGGGAGGCCTGGGAACCAAAAGG + Intergenic
1199541385 X:148961166-148961188 TGAGCTGCCTGAGGAGAAACTGG - Intronic
1200034585 X:153319308-153319330 GGGGAGGCCTGGGCAGCAGCTGG + Intergenic
1200045199 X:153397279-153397301 GGGGAGGCCTGGGCAGCAGCTGG + Intergenic
1200319438 X:155171295-155171317 TGTGAGGCCTGGGGAGAAAAGGG - Intergenic
1200398153 X:156003287-156003309 TGGGAGGCCTGGGAAGTGATGGG - Intronic
1201290864 Y:12420503-12420525 TAGGAGGCCGGGGGTGACACCGG - Intergenic
1201489468 Y:14524880-14524902 TGGGAGGCAAGGGGAGGAAAGGG - Intronic
1201499588 Y:14627545-14627567 TGGCAGGCCAGGGCAGAAAGGGG - Intronic